ID: 1172525107

View in Genome Browser
Species Human (GRCh38)
Location 20:35596010-35596032
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172525098_1172525107 28 Left 1172525098 20:35595959-35595981 CCTTGCTCTTGAGCTCCAGAGCT No data
Right 1172525107 20:35596010-35596032 GCTACCCCAGGTGTGGCCCATGG No data
1172525099_1172525107 13 Left 1172525099 20:35595974-35595996 CCAGAGCTCGCTAATACTTAACC No data
Right 1172525107 20:35596010-35596032 GCTACCCCAGGTGTGGCCCATGG No data
1172525101_1172525107 -8 Left 1172525101 20:35595995-35596017 CCACCTACTACCCTGGCTACCCC No data
Right 1172525107 20:35596010-35596032 GCTACCCCAGGTGTGGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172525107 Original CRISPR GCTACCCCAGGTGTGGCCCA TGG Intergenic