ID: 1172525107 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:35596010-35596032 |
| Sequence | GCTACCCCAGGTGTGGCCCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1172525098_1172525107 | 28 | Left | 1172525098 | 20:35595959-35595981 | CCTTGCTCTTGAGCTCCAGAGCT | No data | ||
| Right | 1172525107 | 20:35596010-35596032 | GCTACCCCAGGTGTGGCCCATGG | No data | ||||
| 1172525099_1172525107 | 13 | Left | 1172525099 | 20:35595974-35595996 | CCAGAGCTCGCTAATACTTAACC | No data | ||
| Right | 1172525107 | 20:35596010-35596032 | GCTACCCCAGGTGTGGCCCATGG | No data | ||||
| 1172525101_1172525107 | -8 | Left | 1172525101 | 20:35595995-35596017 | CCACCTACTACCCTGGCTACCCC | No data | ||
| Right | 1172525107 | 20:35596010-35596032 | GCTACCCCAGGTGTGGCCCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1172525107 | Original CRISPR | GCTACCCCAGGTGTGGCCCA TGG | Intergenic | ||
| No off target data available for this crispr | |||||