ID: 1172525111

View in Genome Browser
Species Human (GRCh38)
Location 20:35596024-35596046
Sequence GGCCCATGGACCAACAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172525105_1172525111 -4 Left 1172525105 20:35596005-35596027 CCCTGGCTACCCCAGGTGTGGCC No data
Right 1172525111 20:35596024-35596046 GGCCCATGGACCAACAGCACTGG No data
1172525102_1172525111 3 Left 1172525102 20:35595998-35596020 CCTACTACCCTGGCTACCCCAGG No data
Right 1172525111 20:35596024-35596046 GGCCCATGGACCAACAGCACTGG No data
1172525101_1172525111 6 Left 1172525101 20:35595995-35596017 CCACCTACTACCCTGGCTACCCC No data
Right 1172525111 20:35596024-35596046 GGCCCATGGACCAACAGCACTGG No data
1172525099_1172525111 27 Left 1172525099 20:35595974-35595996 CCAGAGCTCGCTAATACTTAACC No data
Right 1172525111 20:35596024-35596046 GGCCCATGGACCAACAGCACTGG No data
1172525106_1172525111 -5 Left 1172525106 20:35596006-35596028 CCTGGCTACCCCAGGTGTGGCCC No data
Right 1172525111 20:35596024-35596046 GGCCCATGGACCAACAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172525111 Original CRISPR GGCCCATGGACCAACAGCAC TGG Intergenic
No off target data available for this crispr