ID: 1172526755

View in Genome Browser
Species Human (GRCh38)
Location 20:35604427-35604449
Sequence CTGAATCGGCAGATCCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172526751_1172526755 3 Left 1172526751 20:35604401-35604423 CCTGCTCAGCACACGTCCAAGGG No data
Right 1172526755 20:35604427-35604449 CTGAATCGGCAGATCCAGAGTGG No data
1172526749_1172526755 21 Left 1172526749 20:35604383-35604405 CCTAACTACAGAGCGGCACCTGC No data
Right 1172526755 20:35604427-35604449 CTGAATCGGCAGATCCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172526755 Original CRISPR CTGAATCGGCAGATCCAGAG TGG Intergenic
No off target data available for this crispr