ID: 1172530176

View in Genome Browser
Species Human (GRCh38)
Location 20:35625639-35625661
Sequence CCAGCCCAGCTCTGCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172530172_1172530176 -9 Left 1172530172 20:35625625-35625647 CCATCTTTGTATTCCCAGCCCAG No data
Right 1172530176 20:35625639-35625661 CCAGCCCAGCTCTGCCCTGAGGG No data
1172530170_1172530176 30 Left 1172530170 20:35625586-35625608 CCTTCTCCTTTTGCTGCTTTTTA No data
Right 1172530176 20:35625639-35625661 CCAGCCCAGCTCTGCCCTGAGGG No data
1172530171_1172530176 24 Left 1172530171 20:35625592-35625614 CCTTTTGCTGCTTTTTATGAAGT No data
Right 1172530176 20:35625639-35625661 CCAGCCCAGCTCTGCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172530176 Original CRISPR CCAGCCCAGCTCTGCCCTGA GGG Intergenic
No off target data available for this crispr