ID: 1172533687

View in Genome Browser
Species Human (GRCh38)
Location 20:35653797-35653819
Sequence GTTCATCCAATTACTAAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172533687 Original CRISPR GTTCATCCAATTACTAAGAA AGG (reversed) Exonic
900708918 1:4098676-4098698 GTTCCACCAATTATTGAGAAAGG + Intergenic
901903252 1:12385289-12385311 GTTCATCCACTTCATATGAACGG - Exonic
909171031 1:72295907-72295929 TTCCATCCAATTATTCAGAAAGG - Intergenic
909249888 1:73339970-73339992 TTCCATGGAATTACTAAGAATGG - Intergenic
909541396 1:76795773-76795795 GTAAATCAAATTATTAAGAATGG + Intergenic
909785941 1:79613426-79613448 CTTGATCCAATGACTGAGAAAGG + Intergenic
910391468 1:86749513-86749535 GTTCATCCAAATATTAAAATGGG - Intergenic
910800836 1:91144129-91144151 GTTCATCAAATTCCGAAGCATGG - Intergenic
911778113 1:101840925-101840947 GTTCTTCCAATTAACACGAAAGG - Intronic
912193693 1:107372717-107372739 GTTCTATCAATTACTGAGAAAGG + Intronic
912528537 1:110303361-110303383 CTTCATCCAATAACTATGTATGG + Intergenic
912879969 1:113402008-113402030 GTTTATCCATATACTAAGATTGG - Intronic
913494338 1:119414449-119414471 GTTCAACAATTTGCTAAGAATGG + Intergenic
915826029 1:159077801-159077823 GTTAATTCAATGAATAAGAAAGG - Intronic
916953653 1:169809056-169809078 GTTCATCCAAGTCCTAAAACTGG + Intronic
917262692 1:173187305-173187327 GTTCATCCACTGAGCAAGAAAGG - Intronic
921339112 1:214116774-214116796 GTTCCTCCACCTACTTAGAAGGG - Intergenic
922924054 1:229332602-229332624 GTTCTGCCAATTACTAAGAAAGG - Intronic
1063726148 10:8639563-8639585 GTCCATCCAATTACTTATATGGG - Intergenic
1063753599 10:8980444-8980466 CTTCATCCAATTAATATAAAAGG - Intergenic
1064024572 10:11836934-11836956 TTTCATCCCACTACTCAGAATGG - Intronic
1067219001 10:44328533-44328555 GTTCTTCTAATTACTGAGAGTGG - Intergenic
1068353948 10:55885928-55885950 GTACATCCAATTAGGAAGAAAGG + Intergenic
1068362006 10:55987795-55987817 GTTCATCCAAATAGGAAGAGAGG + Intergenic
1068557114 10:58471063-58471085 GTTCTATCAATTACTGAGAAGGG + Intergenic
1071701516 10:87943483-87943505 GTTGATCTAATTAGTAAGACTGG - Intronic
1072201398 10:93162172-93162194 GTTCTAACAATTACTGAGAAAGG + Intergenic
1073743760 10:106441771-106441793 GATTATCCAATTTTTAAGAAGGG - Intergenic
1076321566 10:129586082-129586104 TTTCATCCCACTACTCAGAATGG + Intronic
1079621451 11:22560482-22560504 GTTCATCAAAGTAGTAAGAGTGG - Intergenic
1083223153 11:61266675-61266697 GTTAATCAAAGTACTGAGAATGG - Intronic
1083624751 11:64066756-64066778 GTTGATCTAAGTACTCAGAAGGG - Intronic
1086874612 11:92080273-92080295 GTTCTTCCAATTCATAAGCATGG - Intergenic
1087553452 11:99682619-99682641 GTTCAACCTATTACACAGAACGG - Intronic
1088634860 11:111809681-111809703 ATTCATCCAATAAAGAAGAATGG - Exonic
1090339295 11:126002408-126002430 TTTCATCTAATTACTAAGTCTGG - Intronic
1090822731 11:130358594-130358616 TTTAATGTAATTACTAAGAAAGG + Intergenic
1091351201 11:134896316-134896338 GTTCTATCAATTACTGAGAAAGG + Intergenic
1093966959 12:25338029-25338051 ATTCATCCAATTACTTTAAAAGG + Intergenic
1094245562 12:28288165-28288187 GTACATCCAAATAAAAAGAAAGG - Intronic
1095766356 12:45899904-45899926 GTTTATCCAATTTCTTAAAAGGG - Intronic
1097780242 12:63694432-63694454 GCTCTATCAATTACTAAGAAAGG + Intergenic
1098159249 12:67633159-67633181 GTTCATATAATTAGTAAGTAGGG + Intergenic
1098433977 12:70449718-70449740 ATTCATACAATTACAATGAACGG + Intergenic
1100250147 12:92812501-92812523 CTTCCTCCTATTACCAAGAAAGG + Intronic
1101307200 12:103540371-103540393 GATCTATCAATTACTAAGAAAGG + Intergenic
1106040829 13:26090823-26090845 GTTCTATCAATTACTAAGAGAGG + Intergenic
1106328189 13:28715031-28715053 ATTCATTCAATGACTAAAAACGG - Intronic
1106722451 13:32449984-32450006 GTTCTATCAATTACTGAGAAAGG - Intronic
1107103145 13:36615624-36615646 GTTCATCCAATCCCAAAGCAGGG - Intergenic
1107494967 13:40917533-40917555 GGTCATCCAATTAGGAATAAAGG - Intergenic
1107521889 13:41191426-41191448 ATTCATGACATTACTAAGAATGG + Exonic
1108221896 13:48243387-48243409 GTTCAACAAATTACAAAGGATGG - Intronic
1109414844 13:62025392-62025414 GTTCATTCATTTTCCAAGAAAGG - Intergenic
1109549887 13:63881388-63881410 TTTCATAAAATTACTAAAAATGG + Intergenic
1109908736 13:68881504-68881526 ATTCTATCAATTACTAAGAAAGG + Intergenic
1110612121 13:77500764-77500786 GTTCAGTGAATTACTTAGAATGG + Intergenic
1111314321 13:86532977-86532999 GTCTATCCAATGATTAAGAATGG + Intergenic
1111478371 13:88785122-88785144 GTCCATCCAAATACGAAGAGAGG - Intergenic
1112105919 13:96239138-96239160 ATTCATGCAATGACTCAGAATGG + Intronic
1116091473 14:40312541-40312563 TTTCATCACATTACTAAGAACGG + Intergenic
1116424570 14:44774711-44774733 GTTCTTCTAATTAGTATGAATGG - Intergenic
1117909003 14:60618677-60618699 GTTCATCTAATTATAAGGAAAGG + Intergenic
1118716892 14:68566381-68566403 GTTCTTCTAATTACTAACAAAGG - Intronic
1118750139 14:68800559-68800581 TTTCATCATATTACTTAGAATGG + Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1122526587 14:102389989-102390011 ATTCATTCAATTATTAAGAATGG - Intronic
1123951023 15:25274815-25274837 GTTCAATCACATACTAAGAAAGG - Intergenic
1125365645 15:38912574-38912596 GTTCTATCAAGTACTAAGAAAGG + Intergenic
1125494432 15:40178633-40178655 GTTATATCAATTACTAAGAAGGG + Intronic
1126111734 15:45179255-45179277 GTTCCTCCACTTACGTAGAATGG - Intronic
1126190841 15:45876937-45876959 CTTCATAAAATTACTTAGAAAGG - Intergenic
1126335246 15:47580236-47580258 GCTCATCCCATTAGGAAGAAAGG - Intronic
1127451006 15:59116362-59116384 GATCATTCAATTGCCAAGAAGGG - Intronic
1127643394 15:60936201-60936223 GGTCTTCCTTTTACTAAGAAGGG - Intronic
1127695400 15:61441893-61441915 GTTCAACCAATGGCTAAGGATGG + Intergenic
1128769922 15:70274345-70274367 GGCCAGCCAATTACTAAGTAAGG + Intergenic
1130230606 15:82093890-82093912 TTTCATCACACTACTAAGAACGG - Intergenic
1131652335 15:94414337-94414359 GTTCTTCCAATTACTCATGAGGG + Intronic
1131671293 15:94622222-94622244 GTTTATCCAATTAACTAGAAAGG - Intergenic
1131966473 15:97849232-97849254 CTCCATCTAATTACTAACAAGGG - Intergenic
1138253012 16:55520440-55520462 GTTCTGTCAATTACCAAGAAAGG - Intronic
1138300635 16:55926305-55926327 CTTCAACCAATAACTATGAAGGG + Intronic
1139730518 16:68940691-68940713 TTTCATAAAATTACTAAAAAGGG - Intronic
1140798999 16:78467791-78467813 GTTCTTCCAAATTCTAAGTAAGG - Intronic
1145783081 17:27576685-27576707 TTTCATCACATTACTCAGAATGG + Intronic
1149134609 17:53349473-53349495 TTTCATCAAACTACTCAGAATGG - Intergenic
1152092252 17:78253429-78253451 GTTCTGCCATTTACTAAGTATGG + Intergenic
1153048047 18:874371-874393 TTTCATCCAGTGACTTAGAATGG + Intergenic
1153597679 18:6744637-6744659 GTTCATTCAATTACTCAAAGTGG + Intronic
1160628425 18:80228837-80228859 GTTCATCAAAATACTTATAAGGG + Intronic
1162260782 19:9532203-9532225 GTTCATCATACTACTGAGAATGG + Intronic
1164039207 19:21480085-21480107 GGGCATCCAAATACGAAGAAAGG - Intronic
1164413803 19:28029058-28029080 GCTCATCCTGTGACTAAGAATGG - Intergenic
1164642201 19:29833989-29834011 GTTCATGCTATTACGAAAAATGG + Intergenic
1167875832 19:52411701-52411723 GTTTTTCCAGTTACTGAGAACGG + Intronic
926401777 2:12504458-12504480 TTTCTTCCAATTACAGAGAAGGG + Intergenic
928718492 2:34091459-34091481 TTTCATCACATTACTCAGAATGG + Intergenic
930056883 2:47258981-47259003 GGTCATCTAATTAGAAAGAAGGG + Intergenic
930780623 2:55222085-55222107 GTTCATCCAATTTCTCAGAAAGG - Intronic
931493755 2:62779287-62779309 ATTAATCCAATAATTAAGAATGG + Intronic
931559940 2:63549877-63549899 GTTGCTCCAAATAGTAAGAAAGG + Intronic
937820692 2:126307546-126307568 TTTTATCTAATTATTAAGAAGGG + Intergenic
939161092 2:138589733-138589755 TTTCATCAAACTACTCAGAATGG + Intergenic
940950664 2:159669498-159669520 GTTCTATCAATTACTGAGAAGGG + Intergenic
942172787 2:173303969-173303991 GTCCATGAAATTATTAAGAAAGG - Intergenic
943007965 2:182409651-182409673 ATTCATTCAATTGCTATGAATGG - Intronic
944633799 2:201655047-201655069 GTTCTTCCAATTTATGAGAAAGG - Intronic
1169920986 20:10733983-10734005 TGTCATCCAGTTACTAGGAAGGG + Intergenic
1170762915 20:19266574-19266596 GTTTATCCAATCACAAAGGATGG + Intronic
1172533687 20:35653797-35653819 GTTCATCCAATTACTAAGAAAGG - Exonic
1173734529 20:45349760-45349782 GTTCAGCCCACTGCTAAGAATGG - Intergenic
1175447172 20:59031196-59031218 GGTCACCCAGTTAGTAAGAATGG - Intronic
1177076308 21:16578973-16578995 GTTTATCCAATTATTATGTAGGG + Intergenic
1182912740 22:34000443-34000465 GTTCTTTCAATTACTGAGAGAGG - Intergenic
949121982 3:396422-396444 GTGCTTCCAATTGGTAAGAATGG - Intronic
949664563 3:6322211-6322233 TTTCATCACATTACTCAGAAGGG + Intergenic
951774975 3:26300221-26300243 GCTGATCTAATTACAAAGAAGGG + Intergenic
951878077 3:27450575-27450597 GTTCCTCCAATTAGTACTAATGG + Intronic
952305386 3:32141383-32141405 GTTCATACAAATAGTAAAAAAGG - Intronic
954892237 3:53941420-53941442 TTTCATCCCACTACTCAGAATGG + Intergenic
955952949 3:64260550-64260572 GTTCATTGAGTTACTAAGACAGG - Intronic
956710977 3:72038557-72038579 TTTCATCACATTACTCAGAACGG + Intergenic
961245052 3:125444199-125444221 GTTAATGTAATTAGTAAGAAAGG - Intergenic
962083175 3:132162023-132162045 GTTCATACAATTAATTTGAAGGG + Intronic
963492599 3:146019561-146019583 GTTCATCCAATGACTGAGCATGG - Intergenic
963611652 3:147476149-147476171 GTTCATACAATAACCAAGACAGG + Intronic
963795988 3:149631455-149631477 CTTCAGCCAGTTACTAAAAAAGG + Intronic
964122815 3:153203958-153203980 GTTAATAGAATTACTAAGGATGG + Intergenic
964645510 3:158954718-158954740 GTTAACCCAATTATGAAGAAGGG - Intergenic
965000857 3:162951503-162951525 CTTCATCAAATTATTTAGAAAGG - Intergenic
966481224 3:180411431-180411453 GTTCGCGCAATTACTAAGTAAGG + Intergenic
967288771 3:187898953-187898975 GTTCATCCCTTTACAAAAAAAGG - Intergenic
971582441 4:28359405-28359427 GTTCCTTCAATTACTAATTATGG + Intergenic
973149577 4:46870510-46870532 GTGCATCCAAATACGAAGAGAGG + Intronic
973334921 4:48946217-48946239 GTTAATCTAAGTACTTAGAAAGG - Intergenic
975238673 4:72031343-72031365 ATTTATACAATTACTAAGAAAGG - Intergenic
975709241 4:77142833-77142855 GTTCATCCAATTACCTAATAAGG + Intergenic
975917711 4:79344510-79344532 GTTCCTCCAAAAACTAAAAATGG - Intergenic
976362779 4:84199634-84199656 GTTTATCACATTACTCAGAATGG + Intergenic
976463772 4:85344186-85344208 GTTCTCTCAATTATTAAGAAGGG + Intergenic
976494295 4:85709171-85709193 GTTCTGACAACTACTAAGAAAGG - Intronic
977473331 4:97471112-97471134 TTTCATCACATTACTCAGAATGG + Intronic
978143783 4:105348236-105348258 CTTCATCCACTTACCAAGACCGG - Intergenic
978467940 4:109029246-109029268 TTTCATCCCACTACTCAGAATGG - Intronic
979795069 4:124835742-124835764 GTTTAATCAGTTACTAAGAAAGG + Intergenic
979936258 4:126700126-126700148 TTTTATACAATTACTAATAATGG - Intergenic
981000092 4:139821156-139821178 GTTCATCTAATTAATTTGAATGG - Intronic
981388593 4:144160757-144160779 GTTCATCCAAATAGGAAGATAGG - Intergenic
983155752 4:164345955-164345977 ATTTATTCAATTACTAATAAAGG - Intronic
983353323 4:166622664-166622686 GTTCATCTTACTACTCAGAATGG + Intergenic
987918325 5:24245708-24245730 GTGCATCCAAATAATTAGAATGG + Intergenic
988439622 5:31218057-31218079 TTACAACCAATTACTAAAAATGG + Intronic
990630156 5:57659926-57659948 GTTCATTCAATTAATAACCATGG - Intergenic
992033606 5:72749164-72749186 GTTCATCACATTGCTCAGAACGG - Intergenic
992930704 5:81641497-81641519 GTTCATTCAATAACTATAAAAGG - Intronic
996160216 5:120152634-120152656 TTTCATCACATTACTCAGAATGG - Intergenic
996343837 5:122468732-122468754 GTTCAGCCAATTAGGAACAATGG + Intergenic
996794222 5:127326639-127326661 GTTCCTCAAACTACTCAGAAAGG - Intronic
997085666 5:130795234-130795256 TTTCATCACATTACTCAGAATGG + Intergenic
998590040 5:143468052-143468074 GTTCTATCAATTACTGAGAAAGG + Intergenic
999894674 5:156018148-156018170 ATTCATTCATTTACTAAGACAGG - Intronic
1000102240 5:158027118-158027140 GCTCTTCCATTTACAAAGAAGGG - Intergenic
1000644645 5:163746255-163746277 GTTCTTCCAATTCATAAGCATGG + Intergenic
1003491710 6:6628127-6628149 GTTCATGCATTTCCTCAGAATGG + Intronic
1004035791 6:11921383-11921405 GTTCCTCCATCTACAAAGAAGGG + Intergenic
1004845317 6:19635309-19635331 GTTCCTCAACTTACTAAGAAAGG - Intergenic
1005706270 6:28456798-28456820 GTTCATAGAATCAATAAGAAGGG - Intergenic
1006234865 6:32620887-32620909 GTTTATCTGATTACTAATAAGGG - Intergenic
1008589408 6:52978177-52978199 GTTCATCCTCATAATAAGAATGG - Exonic
1008811437 6:55505465-55505487 GTTCATTCACTTAATAATAATGG - Intronic
1008932045 6:56951299-56951321 GTTAATCTACTTACTGAGAATGG + Intronic
1011090789 6:83596907-83596929 GTTTATTCAATTATAAAGAAGGG - Intronic
1011832844 6:91394027-91394049 CTTCATCCACTTCCTTAGAAGGG - Intergenic
1013141392 6:107339417-107339439 ATTCATTCAATTAATAAGACTGG + Intronic
1014471891 6:121826271-121826293 CTTCATCCAATAACTACGTAAGG - Intergenic
1014952781 6:127577797-127577819 GTTCATCTCATTGCTTAGAAAGG - Intronic
1015337392 6:132055816-132055838 GTTCCTCAAAATACTAAAAATGG + Intergenic
1022461756 7:30615331-30615353 CTTCATCCCATTTCAAAGAATGG - Intronic
1024912438 7:54460374-54460396 TGTCAACCAATTACTAAAAAAGG + Intergenic
1026213887 7:68331098-68331120 ATTCATCAAATTATTGAGAAAGG + Intergenic
1026408082 7:70089158-70089180 GTTCTTTCAATTATTAAGAAAGG + Intronic
1028785854 7:94792921-94792943 GTTCTACCAATTACTGAGAAGGG - Intergenic
1029799195 7:102928255-102928277 GTTCTTTTAAGTACTAAGAATGG - Intronic
1030136219 7:106252950-106252972 GCTCACCAAATTAATAAGAAAGG - Intronic
1030508015 7:110449056-110449078 GTTCATGCAGCTACTAAGAAGGG + Intergenic
1032925609 7:136601213-136601235 GTTCTATCAATTACTAAGATAGG - Intergenic
1034051791 7:147991290-147991312 GTTCATTAAATTAATATGAATGG + Intronic
1034114743 7:148574810-148574832 GTTCATCGAAATATTAATAAAGG - Intergenic
1038603631 8:28975444-28975466 ATTCATCCAGATATTAAGAAAGG + Intronic
1039319735 8:36414968-36414990 TTTTATCCAATTCCTAAGGAGGG - Intergenic
1040579823 8:48688790-48688812 GTTCAGATAATAACTAAGAAAGG - Intergenic
1040767462 8:50930602-50930624 GTTCTACCAATTAATGAGAAAGG - Intergenic
1044191120 8:89318917-89318939 CTACCTCCAATTACAAAGAAAGG + Intergenic
1045165820 8:99603664-99603686 CTTCATCACACTACTAAGAATGG + Intronic
1045538604 8:103059571-103059593 GTTCAACCAAATACTATGGAAGG - Intronic
1049028858 8:140017824-140017846 ATTCTTCCAATCACTAAGCATGG + Intronic
1051023325 9:12572536-12572558 TTTCAGCCATTTACTAAAAATGG - Intergenic
1051142669 9:13994663-13994685 GTTCATCCAATCCCAAAGCATGG - Intergenic
1052143147 9:25013415-25013437 GATCTTTCAATTACTAAAAAAGG - Intergenic
1052285418 9:26779206-26779228 TTTCATCATATTACTCAGAACGG - Intergenic
1055301002 9:74882704-74882726 GTTCCTCCAAAAACTAAAAATGG + Intronic
1057686884 9:97242601-97242623 GGTCATCCAATTAGGAATAAAGG + Intergenic
1058759203 9:108113722-108113744 GTCCATCCTATTACTAAAAGAGG + Intergenic
1185526895 X:787247-787269 GTCTTTCCAATCACTAAGAAGGG - Intergenic
1192206375 X:69099498-69099520 GTTTATCCAGTAACTAACAATGG + Intergenic
1196545449 X:116959280-116959302 GCTCATAAAATTACTTAGAATGG + Intergenic
1199366485 X:146991174-146991196 GTTCATTCAATTATTTAGTAGGG + Intergenic
1199443832 X:147898263-147898285 CTTCATCCCATTACTCAAAATGG - Intergenic
1199464716 X:148123151-148123173 GTTCATACATTTACCAAAAAAGG + Intergenic