ID: 1172535284

View in Genome Browser
Species Human (GRCh38)
Location 20:35667984-35668006
Sequence CTTTGGGAGGCGAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322665
Summary {0: 2, 1: 1318, 2: 28457, 3: 107821, 4: 185067}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172535284_1172535290 -8 Left 1172535284 20:35667984-35668006 CCATCCACCTTCGCCTCCCAAAG 0: 2
1: 1318
2: 28457
3: 107821
4: 185067
Right 1172535290 20:35667999-35668021 TCCCAAAGTACTGGGATTACAGG 0: 8025
1: 304317
2: 263755
3: 146383
4: 128484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172535284 Original CRISPR CTTTGGGAGGCGAAGGTGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr