ID: 1172545363

View in Genome Browser
Species Human (GRCh38)
Location 20:35756789-35756811
Sequence CTGTAATCCCAGCTACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172545363_1172545367 -3 Left 1172545363 20:35756789-35756811 CCCTCCAGTAGCTGGGATTACAG No data
Right 1172545367 20:35756809-35756831 CAGGTACACACCACCACACCCGG 0: 101
1: 2412
2: 11953
3: 39216
4: 81957
1172545363_1172545373 26 Left 1172545363 20:35756789-35756811 CCCTCCAGTAGCTGGGATTACAG No data
Right 1172545373 20:35756838-35756860 TTTGTATTTTTAGTAGAAACGGG 0: 5507
1: 175085
2: 210457
3: 120902
4: 65033
1172545363_1172545372 25 Left 1172545363 20:35756789-35756811 CCCTCCAGTAGCTGGGATTACAG No data
Right 1172545372 20:35756837-35756859 TTTTGTATTTTTAGTAGAAACGG 0: 6652
1: 204514
2: 138631
3: 62119
4: 38307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172545363 Original CRISPR CTGTAATCCCAGCTACTGGA GGG (reversed) Intergenic
No off target data available for this crispr