ID: 1172547258

View in Genome Browser
Species Human (GRCh38)
Location 20:35771837-35771859
Sequence GGGCCTGTTTCCCGCGCGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172547257_1172547258 -10 Left 1172547257 20:35771824-35771846 CCTGCTAGGGCGCGGGCCTGTTT 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1172547258 20:35771837-35771859 GGGCCTGTTTCCCGCGCGTCAGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172547258 Original CRISPR GGGCCTGTTTCCCGCGCGTC AGG Intergenic