ID: 1172550361

View in Genome Browser
Species Human (GRCh38)
Location 20:35794331-35794353
Sequence CAAGATAAGCACATACATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172550361_1172550367 15 Left 1172550361 20:35794331-35794353 CCCTTATGTATGTGCTTATCTTG 0: 1
1: 0
2: 2
3: 21
4: 219
Right 1172550367 20:35794369-35794391 CCCCACTAGAGAACAGGGTCCGG 0: 1
1: 0
2: 0
3: 7
4: 126
1172550361_1172550364 10 Left 1172550361 20:35794331-35794353 CCCTTATGTATGTGCTTATCTTG 0: 1
1: 0
2: 2
3: 21
4: 219
Right 1172550364 20:35794364-35794386 GCCTTCCCCACTAGAGAACAGGG 0: 1
1: 0
2: 0
3: 8
4: 131
1172550361_1172550363 9 Left 1172550361 20:35794331-35794353 CCCTTATGTATGTGCTTATCTTG 0: 1
1: 0
2: 2
3: 21
4: 219
Right 1172550363 20:35794363-35794385 TGCCTTCCCCACTAGAGAACAGG 0: 1
1: 0
2: 0
3: 17
4: 126
1172550361_1172550369 16 Left 1172550361 20:35794331-35794353 CCCTTATGTATGTGCTTATCTTG 0: 1
1: 0
2: 2
3: 21
4: 219
Right 1172550369 20:35794370-35794392 CCCACTAGAGAACAGGGTCCGGG 0: 1
1: 0
2: 1
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172550361 Original CRISPR CAAGATAAGCACATACATAA GGG (reversed) Intronic
905197167 1:36289316-36289338 CAAGATAAGGACAAAGCTAAGGG + Exonic
906898089 1:49801467-49801489 CAATATAATCACAAACATAGTGG - Intronic
908540349 1:65116318-65116340 TAAGATAAGAGCAGACATAATGG - Intergenic
910252208 1:85209514-85209536 CCAGATAGGCACATCCATAGAGG + Intergenic
912168353 1:107067385-107067407 AAAAATAAGCAAATACTTAAGGG - Intergenic
913978189 1:143482500-143482522 CAATATAAGAAAATACAAAATGG - Intergenic
915406324 1:155662611-155662633 AAAGCTAAGCACACACATAAGGG + Intronic
916451537 1:164925456-164925478 CAAAATAAGGACATGCATTAGGG - Intergenic
917215173 1:172670791-172670813 CCAGACAAACACATACGTAAAGG + Intergenic
917955246 1:180089814-180089836 GAGGATAAGCACATATATAGTGG + Intronic
918909466 1:190547250-190547272 AATCATAAGCACATACATACAGG - Intergenic
919119317 1:193319171-193319193 AAAAATAGGCACATACACAATGG - Intergenic
920112815 1:203598999-203599021 CCAGACAAGCTCATAAATAATGG + Intergenic
922457115 1:225784018-225784040 CTAGAGAAGCACATATATATGGG - Intronic
923472773 1:234307045-234307067 CACCATAATCACAAACATAAAGG + Intronic
923543636 1:234908280-234908302 CCAGATAATCACATACAAATTGG + Intergenic
1064704390 10:18056694-18056716 AAATATATCCACATACATAATGG + Intergenic
1066586021 10:36936446-36936468 CAAGATAGGGACTTACATAAGGG - Intergenic
1067720794 10:48726261-48726283 CAAGAAAAGCACTTACATGAAGG - Intronic
1068450190 10:57176417-57176439 CATTATAAGAACATACAGAATGG - Intergenic
1068838904 10:61588415-61588437 CTACCCAAGCACATACATAAAGG + Intergenic
1069164770 10:65140114-65140136 TCAGCTAAACACATACATAAAGG - Intergenic
1069523096 10:69141757-69141779 CAATATAATCACATTAATAATGG - Intronic
1071074483 10:81734355-81734377 CAACATAAGCAAATGCTTAAGGG - Intergenic
1071108912 10:82131304-82131326 CAAGCTAAGAACATACATTGGGG - Intronic
1071213880 10:83376196-83376218 CAACATATGCAAATCCATAAAGG + Intergenic
1073671055 10:105589685-105589707 CACTAGAAGCACATACATAGTGG + Intergenic
1074297900 10:112208092-112208114 CAGGATAACCACATGCATCAGGG + Intronic
1077738432 11:4817420-4817442 CAAAATAAATAAATACATAAAGG + Intronic
1078951557 11:16140634-16140656 AAAGGTAAGCACAAAAATAAAGG + Intronic
1080546314 11:33322467-33322489 CAAGATTAGCTCAATCATAAAGG + Intronic
1083516853 11:63267890-63267912 CCAGGTATGCACATGCATAAAGG - Intronic
1085881402 11:80471282-80471304 CAAAATGAGCACATACATCCCGG - Intergenic
1085902129 11:80713720-80713742 CAAGATAGAGACTTACATAAGGG + Intergenic
1086365270 11:86103072-86103094 AAATATAAACAAATACATAATGG + Intergenic
1086735069 11:90296281-90296303 AAAGATCAACACAGACATAATGG - Intergenic
1087189134 11:95233741-95233763 GAACATAAACACATACATAATGG - Intergenic
1087935722 11:104032432-104032454 TAATACAAGCACATACTTAAAGG + Intronic
1088055753 11:105574538-105574560 GAGGAGAAACACATACATAAAGG + Intergenic
1088536822 11:110870555-110870577 AAAAATAAGCATATACACAATGG + Intergenic
1088612850 11:111594758-111594780 CTAGAGAAGCACAAAAATAAGGG + Intergenic
1089747060 11:120624852-120624874 CAAGATAATCAAATACATGAAGG - Intronic
1092256619 12:6929353-6929375 CAAAATAAGCCCATGCACAAAGG - Intronic
1093200655 12:16182538-16182560 AGAGATAATCACATGCATAATGG + Intergenic
1093398980 12:18719887-18719909 CAAGAAAAGTACATATATTATGG + Intronic
1094238671 12:28197461-28197483 CAATAAAACAACATACATAAAGG - Intronic
1094798848 12:34006504-34006526 CAAGATAGGCAAATCAATAAAGG + Intergenic
1096418787 12:51437794-51437816 CAATATGAGCAAAGACATAAAGG + Intronic
1099131335 12:78836001-78836023 CAAAATAAGCAAATAGAGAATGG + Intergenic
1100049697 12:90432911-90432933 TATAATAAGCACATACATATAGG - Intergenic
1104772074 12:131369713-131369735 CCAAATGTGCACATACATAAGGG + Intergenic
1104949614 12:132433512-132433534 CAAGATAAGCATGAACATACAGG - Intergenic
1105417102 13:20223013-20223035 GAAGTAAAACACATACATAAAGG + Exonic
1105745307 13:23372715-23372737 AGAGATAAGCACATACAGAGGGG - Intronic
1105826942 13:24131254-24131276 CAAGATATGCCCATACGTGATGG - Intronic
1108205970 13:48090838-48090860 CAAGAAAAACTCATACATCAGGG + Intronic
1109842765 13:67941699-67941721 TAAGATAAGCACACAAACAAAGG - Intergenic
1110746513 13:79059986-79060008 GAAGATATGCAAATACACAATGG - Intergenic
1110918752 13:81057832-81057854 CAAAAGAAGAAGATACATAAAGG - Intergenic
1111261514 13:85746457-85746479 GAAGCTGAGCACATACACAATGG + Intergenic
1113012240 13:105782105-105782127 AAAGAAAAGCACATAGATTAGGG + Intergenic
1114366922 14:22037873-22037895 CGAGATGAGCACATATTTAATGG + Intergenic
1115316817 14:32033539-32033561 CAAGAGAACAACATGCATAAAGG - Intergenic
1115468741 14:33745861-33745883 CAAAAGAAGCACATACCAAATGG + Intronic
1115802419 14:37010110-37010132 AAACATAACCACATATATAATGG + Intronic
1116930281 14:50683901-50683923 CATGCTAAGAACATACATTAGGG - Intergenic
1117426108 14:55599288-55599310 CAAGAGTAGCACATACAAACAGG - Intronic
1117525626 14:56599813-56599835 CAACATAAGCCCATACAAAATGG + Intronic
1118093991 14:62516051-62516073 CAAGAGAAGGACTTACTTAAGGG + Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1124104308 15:26723088-26723110 CATGGTAAGCACATTAATAAAGG + Intronic
1127468970 15:59273490-59273512 CAACATAAACACACACAAAATGG + Intronic
1127624535 15:60767301-60767323 CATGATAAGGACACACACAAAGG + Intronic
1127701573 15:61506437-61506459 CAACATAAGCACATGCATTTAGG - Intergenic
1128770740 15:70279626-70279648 CAACATATGCACATACACACAGG + Intergenic
1128872511 15:71172629-71172651 AAAGATAGGCAAATAGATAATGG + Intronic
1130849638 15:87780512-87780534 AAAGAAAAGAACATACCTAATGG + Intergenic
1131606642 15:93911120-93911142 TAAGATAAGTAGAAACATAATGG - Intergenic
1135144070 16:19946360-19946382 TCAGATAAGCAAATAAATAAAGG + Intergenic
1135906245 16:26514444-26514466 CAATATAAACATATACATACAGG - Intergenic
1136405659 16:30045126-30045148 AAAGATAAGCACAGAGAGAAAGG + Intronic
1137061946 16:35798924-35798946 CAAGGCAATCACGTACATAAAGG + Intergenic
1139726756 16:68906290-68906312 CGAGATAAGAAAATGCATAAAGG - Intronic
1140101305 16:71919838-71919860 CAAAATAATCACACAGATAAAGG - Intronic
1140151728 16:72374276-72374298 CAAGAGAAGTAGATACTTAAAGG + Intergenic
1141011290 16:80402355-80402377 CAAAATAAATAGATACATAAAGG + Intergenic
1143299685 17:5900244-5900266 GAAGAGAAGCACATCCACAATGG + Intronic
1143647550 17:8240985-8241007 CAAGATATGCATATACACTATGG + Intronic
1143807715 17:9443021-9443043 TAAGATAATCTCATAGATAAAGG + Intronic
1144593233 17:16542613-16542635 CAAGAAAAGAAAAAACATAAAGG - Intergenic
1144599504 17:16599880-16599902 CAAGATGAGCTCATAAATAAAGG + Intergenic
1146196364 17:30816408-30816430 AATGACAATCACATACATAATGG + Intronic
1146303272 17:31708649-31708671 CAATAAAAGCAAATACACAAAGG + Intergenic
1149443534 17:56695588-56695610 GCAAATAAGCACATACAAAAAGG - Intergenic
1152299540 17:79487027-79487049 AAAAATAAGCAGATACACAAAGG + Intronic
1153162659 18:2226308-2226330 AAAGATATGCAAATACACAATGG - Intergenic
1153422252 18:4919562-4919584 CAACATAATAAGATACATAAAGG + Intergenic
1155827105 18:30459623-30459645 CAAAAGAAGCAAAAACATAAAGG - Intergenic
1159232317 18:65625305-65625327 AATGACAAGCACATAAATAAGGG - Intergenic
1162042706 19:7980170-7980192 CAAGATACCCACAGACGTAAGGG - Intronic
1166977124 19:46611219-46611241 CAAGAGAAGCCCAGACATCAAGG + Intergenic
1168378259 19:55898941-55898963 CAAAATAAAAACATACAAAAGGG + Intronic
926049248 2:9732965-9732987 CAAGAGAAGCAAATAAACAATGG + Intergenic
926375895 2:12227154-12227176 CAATATGACTACATACATAATGG - Intergenic
926844820 2:17124521-17124543 AAGGAGAAACACATACATAAAGG + Intergenic
930409058 2:51000267-51000289 CAGGATAAGGACATAGAGAATGG - Intronic
931564432 2:63600422-63600444 TTAGGTAAGAACATACATAAGGG - Intronic
933334365 2:80937741-80937763 CAAGAGAAGCTCATTCACAAAGG - Intergenic
935128682 2:100245337-100245359 CTATAGAAGCACATACAAAATGG - Intergenic
936767925 2:115876234-115876256 CAAGATAAGCAAAAACATGTGGG - Intergenic
937185926 2:120042583-120042605 CAAGAGAACAGCATACATAATGG + Intronic
937967360 2:127524311-127524333 CAAGAAAAGCATATATAAAATGG + Intronic
938097691 2:128474245-128474267 CAAGACAAGCACCTACAAAGGGG - Intergenic
940001170 2:148967425-148967447 CAACATAATCACATACAGAAGGG - Intronic
940157190 2:150670082-150670104 AAAAATAAGCACATAGATCAGGG + Intergenic
940492630 2:154383218-154383240 CAAGAAAACAACAGACATAATGG + Intronic
940917273 2:159270128-159270150 CAATATAAGGAAATATATAATGG - Intronic
941479158 2:165984469-165984491 CAAAATATACACATGCATAATGG + Intergenic
941634471 2:167921081-167921103 CAATAAAAGCACACACACAAAGG + Intergenic
942869704 2:180720143-180720165 CAAGAGAAGAAAGTACATAAAGG + Intergenic
943150408 2:184105652-184105674 CAAGAGAAGAACTTATATAAGGG - Intergenic
1169764377 20:9133170-9133192 CAACATAAGCAAAGACCTAAAGG - Intronic
1170234020 20:14081816-14081838 AAAGATATGTACATACTTAAAGG - Intronic
1172550361 20:35794331-35794353 CAAGATAAGCACATACATAAGGG - Intronic
1174682129 20:52418898-52418920 AAACATAAGCTAATACATAATGG - Intergenic
1178769273 21:35487864-35487886 CTGGATAAGCACATAAATAAGGG - Intronic
1179492450 21:41750135-41750157 CCAGCTAAGCACATGCACAATGG + Intronic
1181341095 22:22180646-22180668 AAAAATAAGCACAAATATAATGG - Intergenic
1185157131 22:49199965-49199987 CATGATAATCACATAGATGAGGG - Intergenic
949134273 3:543750-543772 CAAGATAAACAGAAACAGAATGG - Intergenic
949617061 3:5765470-5765492 CAAGATATGCACCTTCAAAATGG - Intergenic
952149782 3:30576720-30576742 TAAAATAAGCACATAAATATTGG + Intergenic
952233301 3:31454116-31454138 CAAGATAAGGACAAAGCTAAGGG + Intergenic
953806212 3:46070716-46070738 CAAGATAAAGACTGACATAATGG - Intergenic
955956847 3:64299150-64299172 GTATATCAGCACATACATAAGGG + Intronic
957731192 3:84139230-84139252 CATAATAAACACATACATCAAGG + Intergenic
958559821 3:95732141-95732163 CAAAATAAACACAAAAATAATGG + Intergenic
959144493 3:102528457-102528479 CAAGATAAGAACCTACAGCAGGG - Intergenic
959220378 3:103510865-103510887 CATGATAAGCAATTACATAATGG - Intergenic
959329881 3:104990902-104990924 CACGATTATCACATTCATAAAGG + Intergenic
960549836 3:118962825-118962847 CAAGAAAAGCACCTAGACAAGGG + Intronic
962899970 3:139753413-139753435 CAAAATAAACAAATAAATAAAGG + Intergenic
962938490 3:140103840-140103862 AAAGATAAACACATAAAAAAGGG + Intronic
963584147 3:147163219-147163241 CAAAATAACCCCATAAATAATGG - Intergenic
964027224 3:152090317-152090339 CAAGAGAAGCATATAGATAATGG - Intergenic
965515066 3:169612619-169612641 GAAAATAAGCACATAAAAAAAGG - Intronic
965876571 3:173329908-173329930 AAATATAAATACATACATAAAGG - Intergenic
966495189 3:180572400-180572422 CGAGATATCCACAGACATAAAGG + Intergenic
967406593 3:189122728-189122750 CAACTTATGCACATAAATAAGGG - Intronic
970539784 4:17065832-17065854 AAAAATAAATACATACATAATGG + Intergenic
973170909 4:47142404-47142426 CAAGATAGGGACAGAAATAAGGG + Intronic
973298386 4:48552960-48552982 TAATATATGCACATACATATAGG + Intronic
974265050 4:59576138-59576160 GAAGTTAAGCAAATACAAAAGGG - Intergenic
976474753 4:85471305-85471327 CAAAATAGGCACATACACAGAGG + Intergenic
977250986 4:94688666-94688688 ACACACAAGCACATACATAAAGG + Intergenic
977759405 4:100713737-100713759 AAAGAGAAGCAAATACATATAGG - Intronic
977799395 4:101207875-101207897 CAGCCTAAGCACATATATAATGG + Intronic
978697895 4:111604952-111604974 CAAAATAAGCAAAAACATTATGG + Intergenic
978819979 4:112955734-112955756 AAAGATTAGCACATAAATATTGG - Intronic
979401745 4:120257352-120257374 GAAGATAAGCAAATACATAAAGG + Intergenic
980145357 4:128976817-128976839 CAAGATAAGCACAAGCATAAAGG + Intronic
980589077 4:134860005-134860027 ACAAGTAAGCACATACATAAAGG + Intergenic
980676413 4:136089080-136089102 GAAGATACACACATACATACAGG - Intergenic
981419574 4:144533841-144533863 AAAAATAAGCAAATAAATAAAGG + Intergenic
981595044 4:146410830-146410852 CAAAATAAATACATAAATAAAGG - Intronic
981596856 4:146434123-146434145 GAAAATACTCACATACATAAAGG + Intronic
982812243 4:159840381-159840403 GAAGAGAAGCAAATACATATAGG + Intergenic
983159576 4:164394837-164394859 AAAGATAAGCAAACACATCATGG - Intergenic
983816378 4:172133217-172133239 CAAGTTAGCCACATACTTAAGGG - Intronic
984819996 4:183873753-183873775 CAGGAGAAGCACACACATAATGG - Intronic
987831677 5:23103664-23103686 CACCATACTCACATACATAAAGG - Intergenic
987886300 5:23817485-23817507 CAAGATAAGTATATACTTATAGG + Intergenic
990086257 5:51981837-51981859 CAGGATAAGCAACTACTTAATGG + Intergenic
990244473 5:53850657-53850679 CAACATATGCAAATAAATAAAGG - Intergenic
993607375 5:90008611-90008633 TAAAAAAAGAACATACATAATGG + Intergenic
994020533 5:95018965-95018987 AAACATAAACACATACATATAGG + Intronic
994522974 5:100864922-100864944 CAAGATAAGAACAGAAACAAAGG - Intronic
996840265 5:127840477-127840499 CAAAATAAAGACATACATATAGG + Intergenic
996973815 5:129406642-129406664 AAAGATAAGAACATACTTTAAGG + Intergenic
999577466 5:152995440-152995462 CAAGAGAATGACATATATAAAGG + Intergenic
1000093856 5:157953661-157953683 CAAGTCAAGAGCATACATAAGGG - Intergenic
1000552367 5:162682896-162682918 CAAGATTAGCACTTTTATAATGG - Intergenic
1000829411 5:166084500-166084522 AAAGATAAGTACATATGTAAGGG + Intergenic
1001371496 5:171208645-171208667 CAAGATAACAAGATACATAGAGG + Intronic
1001838366 5:174851921-174851943 GAAGATAAGCACATACCAATAGG - Intergenic
1003952870 6:11133421-11133443 CAAGATAAACAGATACGTAAGGG - Intronic
1008784289 6:55146806-55146828 CTAGATAAGCAGAAACATCATGG - Intronic
1009712132 6:67337505-67337527 TAAGATAAGTACATACAGAAGGG - Intergenic
1012504366 6:99928136-99928158 CAATATATGCAAATCCATAAAGG - Intronic
1015201649 6:130588599-130588621 AAAGATAAGCACATTCACAATGG + Intergenic
1016729432 6:147412632-147412654 ATAGATAAGCACATATATATAGG + Intergenic
1016834179 6:148460583-148460605 CAATATAGGCACTTACATCAAGG - Intronic
1017272219 6:152520676-152520698 AAAGGTTAGCAAATACATAAAGG + Intronic
1018531324 6:164766730-164766752 CAAGATCAGCAGAAACATTATGG - Intergenic
1019007957 6:168818732-168818754 AAAGACAAGCTCATACAAAATGG + Intergenic
1020605988 7:10337539-10337561 CAAGTTAGGCACACACATTATGG - Intergenic
1021028895 7:15704269-15704291 GAAGCAAAGAACATACATAATGG + Intergenic
1022536088 7:31099533-31099555 CAGAATCAGCACATACATAGGGG - Intronic
1022858121 7:34337081-34337103 AAAGATAGCAACATACATAATGG - Intergenic
1023318203 7:38963741-38963763 AAAGATAATGACAGACATAAGGG - Intergenic
1024447269 7:49495686-49495708 CTAGAAAAGCAGACACATAAGGG + Intergenic
1025641338 7:63373764-63373786 AAAGCAAAACACATACATAAAGG + Intergenic
1026434979 7:70388289-70388311 TAAGACAAGCACATAAATAATGG - Intronic
1026652451 7:72227305-72227327 CAAGGTAAGCAGATAACTAAAGG + Intronic
1028033669 7:85950770-85950792 CAAAATAAACACCTTCATAAGGG - Intergenic
1028282809 7:88953114-88953136 CAAGAGAAGAACAAACATAAAGG - Intronic
1028765246 7:94549628-94549650 CAAAGTAAATACATACATAACGG - Exonic
1028834261 7:95357176-95357198 CAAGATAATCACATAAAGATTGG + Intergenic
1030030831 7:105367696-105367718 CAAGAGAAGTGCAAACATAAAGG - Intronic
1033622097 7:143070712-143070734 ATATATATGCACATACATAAAGG + Intergenic
1034013419 7:147555653-147555675 AAAGCTGAGCACATACATAAAGG - Intronic
1034044122 7:147909833-147909855 CAAGATGGGCACATACATGGTGG + Intronic
1035347203 7:158209773-158209795 CAAGAATAGCCCATACATTATGG + Intronic
1035733523 8:1870414-1870436 CAAAATAAGTACAAACATATTGG + Intronic
1036542631 8:9732445-9732467 AAAGATAAATAAATACATAATGG - Intronic
1036919073 8:12834310-12834332 GAAAAAAAGCACATACAAAATGG + Intergenic
1038280967 8:26164358-26164380 AAAGAGTAGCACATGCATAAAGG + Intergenic
1039010992 8:33092609-33092631 AAATATAAGAACACACATAAAGG - Intergenic
1040918292 8:52586817-52586839 GGAGATTAGCAGATACATAAGGG - Intergenic
1046005586 8:108478936-108478958 CAAGATAATCAAAAACATAAGGG - Intronic
1046610768 8:116422561-116422583 CACCAGAAGCACATCCATAAAGG + Intergenic
1047320233 8:123772533-123772555 TAAGATAAGCACATACATTCTGG + Intronic
1047388204 8:124428890-124428912 CATGAGAAGCAGAGACATAAAGG + Intergenic
1048073790 8:131046726-131046748 GAAGACAAGCACATGCATGAGGG - Intergenic
1050971077 9:11875225-11875247 CAAGATCAGAACATACAGAAAGG + Intergenic
1052613424 9:30806446-30806468 CAACATAAGAACATAGGTAAAGG + Intergenic
1055361722 9:75498024-75498046 CATGATAAGTACATATATATTGG + Intergenic
1057411727 9:94822228-94822250 CAAGATCAACACATCCTTAAAGG - Intronic
1059737117 9:117112908-117112930 GGAGATAAGCAAATACAAAATGG + Intronic
1059851844 9:118350618-118350640 AAAGATAAATACATAAATAAAGG - Intergenic
1061675914 9:132215579-132215601 CAAAATAAGTAAATAAATAAAGG + Intronic
1185507310 X:640857-640879 CAAGAGAATCAGATGCATAAAGG + Exonic
1186163151 X:6799370-6799392 CAAAATAAGTACATAAAGAAAGG + Intergenic
1189725485 X:43964414-43964436 CAAGCCAAGGACATACATATAGG - Intronic
1189883730 X:45518281-45518303 AAAGATAAGGACAGACATAGTGG - Intergenic
1192414135 X:70962978-70963000 CATGATAAGCACCTCCAAAAGGG - Intergenic
1194075693 X:89389671-89389693 CAAGATAAGCAAATTACTAAAGG + Intergenic
1194848650 X:98844101-98844123 CAACATATGCAAATCCATAAAGG - Intergenic
1194910780 X:99641803-99641825 TAAGACACACACATACATAAAGG - Intergenic
1196242815 X:113363602-113363624 CAAGAAAAACAAATACAAAATGG - Intergenic
1196528919 X:116760125-116760147 AAAAATAAGCACATAGATCAAGG + Intergenic
1200414695 Y:2896957-2896979 GAAGATAAGCATATATATAGTGG + Intronic
1200731294 Y:6743826-6743848 CAAGATAAGCAAATTACTAAAGG + Intergenic