ID: 1172551649

View in Genome Browser
Species Human (GRCh38)
Location 20:35805158-35805180
Sequence CTGTGGTCCCAGCACTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7835
Summary {0: 3, 1: 38, 2: 160, 3: 937, 4: 6697}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172551649_1172551660 22 Left 1172551649 20:35805158-35805180 CCTCCTGAGTGCTGGGACCACAG 0: 3
1: 38
2: 160
3: 937
4: 6697
Right 1172551660 20:35805203-35805225 TATTTTTATTTTTCCAGACAAGG 0: 1
1: 18
2: 588
3: 2790
4: 30189
1172551649_1172551654 -3 Left 1172551649 20:35805158-35805180 CCTCCTGAGTGCTGGGACCACAG 0: 3
1: 38
2: 160
3: 937
4: 6697
Right 1172551654 20:35805178-35805200 CAGGCCAGATCCATGGCACCCGG 0: 1
1: 0
2: 17
3: 388
4: 3774
1172551649_1172551652 -10 Left 1172551649 20:35805158-35805180 CCTCCTGAGTGCTGGGACCACAG 0: 3
1: 38
2: 160
3: 937
4: 6697
Right 1172551652 20:35805171-35805193 GGGACCACAGGCCAGATCCATGG 0: 1
1: 0
2: 3
3: 44
4: 555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172551649 Original CRISPR CTGTGGTCCCAGCACTCAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr