ID: 1172555866

View in Genome Browser
Species Human (GRCh38)
Location 20:35840793-35840815
Sequence TGGACCTGGCCACTAACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172555860_1172555866 21 Left 1172555860 20:35840749-35840771 CCTTGATGATTTACATGTGTGTG 0: 1
1: 1
2: 2
3: 19
4: 251
Right 1172555866 20:35840793-35840815 TGGACCTGGCCACTAACCCAAGG 0: 1
1: 0
2: 1
3: 9
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172555866 Original CRISPR TGGACCTGGCCACTAACCCA AGG Intronic
901013219 1:6212497-6212519 AGGACCTGGCCTGTACCCCACGG + Intronic
901222872 1:7593780-7593802 TGTACCTGGCCCCTAACACTAGG + Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
905898959 1:41567984-41568006 GGGACCTGCCCTCTCACCCAAGG + Intronic
906961137 1:50420052-50420074 TGGACCTGGCCACTTCTCCACGG - Intronic
920250413 1:204619027-204619049 TGGACATCACCAATAACCCACGG - Exonic
922617001 1:226966583-226966605 TGGAACTAACCACTCACCCAAGG - Intronic
922698025 1:227741417-227741439 TGGACCTGGCCCATGAGCCAAGG - Intronic
922800494 1:228362670-228362692 TGGCCCTGGCCCCTGCCCCAGGG + Exonic
1062829769 10:597900-597922 TGGACCTGGCCATGCCCCCAGGG + Intronic
1063245061 10:4209265-4209287 AGGACCCTGCTACTAACCCAGGG + Intergenic
1064548978 10:16479394-16479416 TGGGCCTGGACACTGACCAACGG - Intronic
1069872478 10:71541449-71541471 GGGACCTGCCCTCTAGCCCAGGG - Intronic
1074469613 10:113715269-113715291 TGGAGCTGGCCACTATCCCTGGG - Intronic
1075799294 10:125142903-125142925 ATGTCCTGGCCACTAAACCACGG - Intronic
1076621848 10:131794009-131794031 CAGACCTGGCCCCCAACCCAGGG - Intergenic
1082026763 11:47578450-47578472 AGGACCTGGCCACTAGGCCGGGG - Intronic
1082278510 11:50246423-50246445 TGGCCCTGGCCAGGAACCCCTGG - Intergenic
1087958523 11:104319639-104319661 TGAACCTGGCCATTCACCCCAGG - Intergenic
1097934769 12:65234145-65234167 TGGATCTGGCCCATAAGCCATGG - Intronic
1097987174 12:65796046-65796068 TGGACCTAGGCACTAACACCTGG - Intergenic
1104564788 12:129870870-129870892 GGGACCCAGCCATTAACCCACGG + Intronic
1114221329 14:20700256-20700278 TGTAGCTGGCCACTTATCCAGGG + Exonic
1119887024 14:78151885-78151907 TGGACCTGGACAAGAATCCAGGG + Intergenic
1121798960 14:96757523-96757545 TGGACATGGCTGGTAACCCATGG + Intergenic
1122068777 14:99191760-99191782 TGGGCTTGGCCACTAAGGCAGGG + Intronic
1122211877 14:100178719-100178741 GGGACCAGGCCAGTGACCCAAGG - Intergenic
1126110492 15:45172170-45172192 TGGATCTGTCCACTCCCCCAGGG + Exonic
1131029102 15:89171316-89171338 TGGACCTCACCCCAAACCCACGG - Intronic
1135712844 16:24732366-24732388 TGGGACTGGGCACTAAGCCAGGG + Intronic
1141529610 16:84637157-84637179 TGGACCTGGCCATGTGCCCATGG + Intergenic
1144669583 17:17125398-17125420 TGGACCTGGACATTTAACCATGG + Intronic
1148239249 17:45989099-45989121 TTTACCTGCCCATTAACCCATGG - Intronic
1150206654 17:63413858-63413880 TTCACCTGGTCACTCACCCATGG + Intronic
1162495519 19:11021256-11021278 TGGCGCTGGCCCCTACCCCATGG + Intronic
1165430504 19:35769173-35769195 TAGACCTGGCCACGAAACCTTGG + Exonic
927981779 2:27378912-27378934 TGGGCCTGGCCTCTCACCCCTGG + Exonic
930676390 2:54205228-54205250 TGGATATTGCCAGTAACCCATGG + Intronic
930750520 2:54930153-54930175 TTGACATGGCCATTATCCCAAGG + Intronic
933345369 2:81078399-81078421 TGGACCTGTCCTCTTGCCCAAGG + Intergenic
937381360 2:121380359-121380381 AGGGCCTGACCTCTAACCCAAGG - Intronic
944472647 2:200071452-200071474 TGGACCCAGCCACTAACCCAGGG - Intergenic
946312815 2:218892397-218892419 TGCTCCTGGCCCCTACCCCAGGG + Intronic
946866276 2:224043852-224043874 TGGCCTTGGCCACCATCCCAAGG + Intergenic
947393600 2:229665336-229665358 TGGACCTGGTGACCAACCCTTGG - Intronic
1170418617 20:16170533-16170555 GGCACCTGGCCAATAACACACGG - Intergenic
1172555866 20:35840793-35840815 TGGACCTGGCCACTAACCCAAGG + Intronic
1178704029 21:34858195-34858217 TGGTCCTGGCCACAACCTCATGG - Intronic
1179922760 21:44516041-44516063 GGGACCTGGCCACAAACACACGG - Intronic
1179998519 21:44984872-44984894 TGGACCTGGCCTTTGCCCCACGG + Intergenic
1183058178 22:35319722-35319744 TTGGCCTGGCCACTGACCCACGG - Intronic
1185408047 22:50667072-50667094 TGGTCCTGGCCACAAAGCCAAGG + Intergenic
950019891 3:9779856-9779878 AGCCCATGGCCACTAACCCATGG - Exonic
955218942 3:57007973-57007995 TGGACCATGGCACAAACCCAAGG - Intronic
957593171 3:82226011-82226033 TGTACATGGCCCCTAACCTAGGG + Intergenic
961591475 3:127984813-127984835 TGGACCTGGTCTGTAAGCCAGGG + Exonic
962174800 3:133141792-133141814 GGGTCATGTCCACTAACCCAAGG - Intronic
965874692 3:173301903-173301925 TGGCCCTGGCCAGAAACCCAGGG - Intergenic
968487226 4:868502-868524 TGGACCTGGCCACTTGCAGAGGG - Intronic
969339200 4:6529745-6529767 TGGCCCCAGCCACTGACCCAGGG + Intronic
974351374 4:60751301-60751323 TGGACCTGGTCCCTAGGCCAAGG + Intergenic
976778354 4:88731173-88731195 TGTCCCTGGGCACAAACCCAAGG + Intronic
978009292 4:103659210-103659232 TGGTACTGGTCCCTAACCCAGGG + Intronic
981268171 4:142812219-142812241 TGCACCTGCCCACACACCCATGG + Intronic
985337346 4:188911081-188911103 TGTAACTCGCCACTAACCCGTGG + Intergenic
988616948 5:32784151-32784173 TGGACCAGGGCACTGACCCAGGG - Intronic
990978094 5:61576580-61576602 TGCCCATGGCCACTAACACAGGG + Intergenic
997979758 5:138461608-138461630 TGGGCCTGGCCATCCACCCAGGG - Intergenic
1006051853 6:31351508-31351530 TCTACCTGGCCTCTACCCCATGG + Intronic
1006419561 6:33924772-33924794 TGGGCCTGCCCACTGCCCCAGGG + Intergenic
1006561073 6:34913063-34913085 TGTACCTGGCTCCTAACACAGGG - Intronic
1012430862 6:99162456-99162478 CAGACCTGGCCATTGACCCAGGG + Intergenic
1013765105 6:113565109-113565131 TGGGCCTGGCCCCTCATCCAGGG + Intergenic
1018111288 6:160539095-160539117 TGGGCCTGGTCACAAGCCCATGG - Intronic
1018131945 6:160740152-160740174 TGGGCCTGGCCACAAGCCCAGGG + Intronic
1019601107 7:1884276-1884298 TGCCCCTGGCCACCCACCCATGG + Intronic
1019737552 7:2658220-2658242 AGGAGCTGGCCACAGACCCATGG - Intronic
1022980242 7:35598425-35598447 GGGACCAGGCGACTAACCCCAGG - Intergenic
1024013122 7:45287604-45287626 GGGACCCGGCCCCTAACCTATGG - Intergenic
1024373109 7:48608596-48608618 TGGACCTGGGCATTACCCAATGG + Intronic
1024530184 7:50384800-50384822 TGGTGCTTCCCACTAACCCAAGG - Intronic
1025093406 7:56080926-56080948 TGGCCCTGGCCAGGAACCCCTGG - Exonic
1025654963 7:63510274-63510296 TGGCCCTGGCCAGGAACCCCTGG + Intergenic
1026314404 7:69215579-69215601 TGGACAAAGCCACTAACACAGGG + Intergenic
1029736321 7:102467802-102467824 TGGAGCTGCCCACAAGCCCAGGG + Exonic
1034726799 7:153343672-153343694 TGGATTTGGCCACTTCCCCAAGG - Intergenic
1036748759 8:11429749-11429771 TGAACCTGGGTTCTAACCCAGGG - Intronic
1037174765 8:15933527-15933549 TGGACCTTGCCTCTAGGCCAAGG - Intergenic
1049579987 8:143406841-143406863 TGGGGCTGGCCACCACCCCAGGG + Intergenic
1052991396 9:34521188-34521210 TGGACCCGGCCCCTGACCCTTGG + Exonic
1057800954 9:98191460-98191482 GGGACCTGACCACTGCCCCAGGG + Intronic
1059716118 9:116915015-116915037 TGGAGCTGCCCACTAATCCTGGG - Intronic
1061043835 9:128153879-128153901 TGGACATGGCCCCTCACCCACGG - Intergenic
1061763654 9:132868066-132868088 TTGGCCTGGCCCCTGACCCAAGG + Intronic
1187337857 X:18396386-18396408 TGTGCCTGGCCACAAACCAAAGG - Intergenic
1189167322 X:38873049-38873071 TTGACCTGGCAAAGAACCCAGGG - Intergenic
1191227215 X:58055755-58055777 TGGACCTGACCACTTTCCCCAGG + Intergenic
1199978621 X:152908769-152908791 TGGCCCTGGCCACACTCCCAGGG - Intergenic