ID: 1172557757

View in Genome Browser
Species Human (GRCh38)
Location 20:35857204-35857226
Sequence GCCCCACCCATTTTTGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172557757_1172557759 19 Left 1172557757 20:35857204-35857226 CCTGGGGCAAAAATGGGTGGGGC 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1172557759 20:35857246-35857268 CAAAATTTGAAAGTGTTGTTTGG 0: 1
1: 0
2: 0
3: 37
4: 333
1172557757_1172557760 20 Left 1172557757 20:35857204-35857226 CCTGGGGCAAAAATGGGTGGGGC 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1172557760 20:35857247-35857269 AAAATTTGAAAGTGTTGTTTGGG 0: 1
1: 0
2: 1
3: 76
4: 779

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172557757 Original CRISPR GCCCCACCCATTTTTGCCCC AGG (reversed) Intronic
900126252 1:1070180-1070202 GCCACACCCACCCTTGCCCCAGG - Intergenic
900582372 1:3415500-3415522 GCGCCTCCCATTGTTTCCCCGGG + Intronic
900873353 1:5322416-5322438 GCCCCACCCATCTTTCCAGCTGG - Intergenic
901242027 1:7700656-7700678 GCCCAACACATTCTTTCCCCCGG - Intronic
902185668 1:14723408-14723430 GTCCCACTCATTGCTGCCCCGGG - Intronic
902200842 1:14832343-14832365 GCCTCTCCCATCTTAGCCCCTGG + Intronic
902752444 1:18526581-18526603 CCCCCACCCAGCTCTGCCCCAGG + Intergenic
903303608 1:22396554-22396576 GCCCAGCACATTTTTGCCTCAGG + Intergenic
905014857 1:34770807-34770829 GGCCCACCCATTTGTGCTGCGGG - Intronic
906346912 1:45021426-45021448 GCCCCGCTCCTTTTTGCCCCAGG - Intronic
907460780 1:54604238-54604260 GCCCAACCCATTCCTGGCCCAGG + Intronic
907788310 1:57635758-57635780 TCCCCAACCATTTTGGCACCAGG - Intronic
909443727 1:75724883-75724905 GCCGCACCTATTTTTGGCCCAGG - Intronic
909565899 1:77053274-77053296 TCCACAACCATTTTTGGCCCTGG - Intronic
910243643 1:85115639-85115661 TCCCCAACCTTTTTTGCACCAGG + Intronic
911702231 1:100967214-100967236 TCCCCAACCATTTTGGCACCAGG + Intronic
911768465 1:101708493-101708515 ACCATACCCATTTATGCCCCTGG - Intergenic
912447707 1:109750545-109750567 GCCACACTCAGTTCTGCCCCAGG + Intronic
913526483 1:119698526-119698548 TAGCTACCCATTTTTGCCCCAGG + Intronic
914213511 1:145603552-145603574 GCCCCACCACTTCTTGCTCCAGG - Intergenic
914465447 1:147923980-147924002 GCCCCACCACTTCTTGCTCCAGG - Intergenic
915521004 1:156443812-156443834 GCCTCACCCATTTCTTCCTCAGG - Intergenic
916629900 1:166601181-166601203 TCCCCACCCTTTTTGGCACCAGG + Intergenic
917266246 1:173223853-173223875 CCACCACCCATTCTTTCCCCTGG - Intergenic
917995931 1:180438271-180438293 TCCCCACCCTTTTTGGCACCAGG - Intronic
918572175 1:186009879-186009901 TCCCCAACCATTTTGGCACCAGG + Intronic
918889286 1:190244188-190244210 TCCCCATCCATTTTGGCACCAGG - Intronic
919806012 1:201381429-201381451 GACCCACCCATCTTTGTCCCTGG - Exonic
920146656 1:203867303-203867325 TCCCCAACCATTTTGGCACCAGG + Intronic
922766765 1:228160097-228160119 GCCCCACCCACCCCTGCCCCCGG - Intergenic
1063819587 10:9819380-9819402 GCCCCATCCTTTTTAGCACCAGG + Intergenic
1064881957 10:20065438-20065460 GCCCCAACTATTTTGGCACCAGG + Intronic
1064901897 10:20304055-20304077 TCCCCAACCTTTTTTGCACCAGG - Intergenic
1065858374 10:29849259-29849281 TCCCCACCCATACTGGCCCCAGG + Intergenic
1070644777 10:78194288-78194310 CCCCTACCCATTTTTCCACCTGG - Intergenic
1071852826 10:89592693-89592715 GCTCCACCCCTTTTTGTGCCTGG + Intronic
1074735302 10:116425023-116425045 TCCCCAACCATTTTGGCACCAGG - Intergenic
1075616941 10:123897068-123897090 CCCCCACCCACTTTGGCCCAGGG + Intronic
1075644717 10:124090070-124090092 GCCACACCCATTGTGGGCCCAGG - Intronic
1076116615 10:127906001-127906023 GCCCTGCCCATTTCTGTCCCTGG - Intergenic
1077007969 11:368074-368096 GCCCCACCCCTTTTTGAGACAGG - Intergenic
1077868477 11:6241802-6241824 ACCCCACCCATCCTTGTCCCTGG - Intronic
1080293463 11:30698261-30698283 TCCCCAACCATTTTGGCACCAGG + Intergenic
1082989724 11:59196995-59197017 TCCCCAACCATTTTGGCCCCAGG - Intronic
1083300221 11:61736161-61736183 GCCCCATCCATTTTTCCCTTTGG - Intronic
1084576695 11:69993172-69993194 GCTGCACCCTTGTTTGCCCCTGG + Intergenic
1084786251 11:71443439-71443461 GCACCACCCATGTGTGCACCAGG + Intronic
1086795891 11:91101583-91101605 TCCCCAACCATTTTGGCACCAGG - Intergenic
1087088519 11:94244397-94244419 GCCCCACCCAATTCTTTCCCTGG + Intergenic
1089865550 11:121628244-121628266 TCCCCAACCTTTTTTGCACCAGG + Intronic
1091585561 12:1814282-1814304 GCTCCCCCCATTTCTGCCCAAGG - Intronic
1091942271 12:4498671-4498693 GCCCCAACCTTTTTGGCACCAGG + Intronic
1092649088 12:10613522-10613544 GCCACAGCCATTTTTGTACCCGG + Exonic
1092766038 12:11853891-11853913 TCCCCACCCTTTTTGGCACCAGG + Intronic
1093251402 12:16808439-16808461 TCCCCAACCTTTTTTGCACCAGG - Intergenic
1093329777 12:17821717-17821739 ACCCCACCCATTCTTGTCCTAGG + Intergenic
1094053875 12:26249042-26249064 GCCCCAACCTTTTTGGCACCAGG + Intronic
1094454381 12:30616067-30616089 TCCCCACCCACCCTTGCCCCAGG - Intergenic
1095730500 12:45501414-45501436 GCCTCACCCATTTCTTCCCATGG + Intergenic
1096593429 12:52677848-52677870 ACTCCACTCCTTTTTGCCCCAGG + Intronic
1096799189 12:54098224-54098246 GCCCCAGGCATTATTTCCCCAGG + Intergenic
1097385291 12:58943748-58943770 GTCCCAACCATTTTGGCACCAGG - Intergenic
1098370090 12:69749402-69749424 TCCCCAACCTTTTTGGCCCCAGG - Intronic
1099224722 12:79956094-79956116 GCCACACTCATCTGTGCCCCTGG - Intergenic
1099914340 12:88873312-88873334 CCTCCATCCATTTTAGCCCCAGG + Intergenic
1100612573 12:96203535-96203557 GCCCCACCTTGTTTTGCCCTTGG + Intronic
1101839369 12:108316783-108316805 GCCCCACCCATTTCTGCTATGGG - Intronic
1103701064 12:122848964-122848986 GCCCCTCCCACTGTCGCCCCTGG - Intronic
1104361290 12:128135563-128135585 TCCCCACCCTTTTTGGCACCCGG - Intergenic
1104737020 12:131141589-131141611 GCCCCACACATTCTTGCTCTGGG + Intergenic
1105736962 13:23281587-23281609 TCCCCAACCATTTTGGCACCAGG + Intronic
1106062695 13:26310332-26310354 TCCCCAACCATTTTGGCACCAGG + Intronic
1106239742 13:27901547-27901569 CCCCCACACATTTTATCCCCTGG - Intergenic
1107441766 13:40434035-40434057 TCCCCAACCATTTTGGCACCAGG - Intergenic
1108385664 13:49897070-49897092 GAGCCACCCATTTCTCCCCCAGG - Intergenic
1110358346 13:74595458-74595480 TCCCCAACCATTTTGGCACCAGG + Intergenic
1113158233 13:107349872-107349894 TCCCCAACCATTTTGGCACCAGG + Intronic
1113339152 13:109404818-109404840 GCCCCACCCATGGCTGCCCATGG + Intergenic
1116996826 14:51333348-51333370 TGCCCACCCATTTTTGCACCTGG - Intergenic
1117157868 14:52958513-52958535 TCCCCAACCATTTTGGCACCAGG - Intergenic
1117240326 14:53825639-53825661 TCCCCAACCTTTTTGGCCCCAGG - Intergenic
1117493369 14:56275273-56275295 TCCCCAGCCATTTTGGCACCAGG + Intronic
1117768041 14:59103178-59103200 TCCCCAACCATTTTGGCACCAGG - Intergenic
1118758330 14:68861750-68861772 GCCATAACCATTTTTGTCCCTGG - Intergenic
1121274181 14:92656653-92656675 GCCCCACACATTCGTGCCCACGG - Intronic
1122692395 14:103537586-103537608 GCCCCACCCATGCCTGCCTCAGG + Intergenic
1123160645 14:106275308-106275330 TCCCCAACCATTTTGGCACCAGG + Intergenic
1124966561 15:34436835-34436857 ACCCCACACCTTGTTGCCCCTGG - Intronic
1124983180 15:34582947-34582969 ACCCCACACCTTGTTGCCCCGGG - Intronic
1126118234 15:45228247-45228269 TCCCCACCCTTTTTGGCACCAGG - Intergenic
1126462818 15:48931335-48931357 GCCACACACATTTTTAGCCCAGG + Intronic
1126821705 15:52510783-52510805 TCCCCAACCTTTTTGGCCCCAGG - Intronic
1127160757 15:56182261-56182283 TCCCCAACCATTTTGGCACCAGG - Intronic
1127899782 15:63332539-63332561 CCACCACCCATTCTTTCCCCAGG - Intronic
1128230608 15:66032152-66032174 TCCCCAGCCTTTTTTGCTCCAGG - Intronic
1135277606 16:21127109-21127131 TCCCCACCCATTTTGGCCACAGG - Intronic
1137899874 16:52255833-52255855 GCCCAAATCATTTCTGCCCCTGG - Intergenic
1138257663 16:55580995-55581017 TCCCCAACCATTTTGGCACCAGG - Intronic
1138425844 16:56931721-56931743 CCCCCACCCTTTTTCACCCCAGG - Intergenic
1138447579 16:57074128-57074150 GCCCCAACCATATGTGACCCAGG - Intronic
1141688183 16:85582080-85582102 TCCCCACCCAATTCCGCCCCAGG - Intergenic
1141740089 16:85885322-85885344 ACCCCATCCATTCTTGGCCCTGG + Intergenic
1146496987 17:33331265-33331287 TCCCCAACCATTTTGGCACCAGG - Intronic
1147316768 17:39624838-39624860 TCCCCACCCTTCTTGGCCCCAGG + Intergenic
1147704005 17:42413606-42413628 GCCCCACCCCTTTTGGCCCCAGG - Intronic
1151315309 17:73318228-73318250 GGCTCCCCCATTTTTGCCACGGG - Intergenic
1151724092 17:75874758-75874780 GCCCCACCCCTTCTCGCCCACGG - Exonic
1152535076 17:80945957-80945979 GCCCCACCCACACCTGCCCCGGG + Intronic
1153622904 18:6996864-6996886 TCCTCACCCTTTTTTGACCCAGG + Intronic
1154402075 18:14049511-14049533 TCCCCAACCATTTTGGCACCAGG + Intergenic
1155294640 18:24373995-24374017 CCTCCACCCATGTTTGCCTCAGG - Intronic
1155493893 18:26424480-26424502 GCCCCACCCATTCCTGCCTTTGG + Intergenic
1156886556 18:42141799-42141821 TCCCCACCCTTTTTGGCACCAGG + Intergenic
1157209995 18:45734032-45734054 TCCCCAGCCTTTTTGGCCCCAGG - Intronic
1158366774 18:56745394-56745416 GCCCCAACCTTTTTGGCACCAGG + Intronic
1158727503 18:59986925-59986947 CCCACCCCCACTTTTGCCCCAGG + Intergenic
1159356720 18:67345716-67345738 TCCCCAACCATTTTGGCACCAGG - Intergenic
1160245767 18:77158387-77158409 TCCCCAACCATTTTGGCACCAGG + Intergenic
1160777481 19:862653-862675 GCCCCACCCAATCTTGGCCCCGG - Intronic
1161163382 19:2772876-2772898 GCGTCACCCATTTCTGCCCTCGG - Intronic
1163051741 19:14689792-14689814 CCCCGCCCCACTTTTGCCCCGGG + Intronic
1163138093 19:15327855-15327877 CCCCCCGCCACTTTTGCCCCTGG - Intronic
1164910797 19:32010158-32010180 TCCCCAACTATTTTTGCACCGGG - Intergenic
1165383334 19:35495881-35495903 CCCCCACCCCTTTGTCCCCCTGG - Intergenic
1166476709 19:43132931-43132953 GCCTGACCCAGTTTTTCCCCAGG - Intronic
1166857056 19:45787477-45787499 TCCCCAACCATTTTGGCACCAGG - Intronic
1166944703 19:46389870-46389892 GCCCCTCCCATTCTTTCCCCTGG + Intronic
1168075503 19:53978985-53979007 ACCCCACCCCTTTTTTCGCCTGG - Intronic
926995499 2:18730566-18730588 TCCCCAACCTTTTTGGCCCCAGG - Intergenic
927228076 2:20789920-20789942 TCCCCAACCATTTTGGCCTCTGG - Intronic
927914948 2:26929638-26929660 TCCCCAACCATTTTGGCACCAGG - Intronic
928723618 2:34147594-34147616 GCCCCACCCATGGCTGCCCATGG - Intergenic
929417427 2:41757645-41757667 TCCCCAACCTTTTTTGCACCAGG + Intergenic
930317581 2:49816515-49816537 TCCCCAACCTTTTTGGCCCCAGG + Intergenic
932412242 2:71554432-71554454 GCCCCACATCTCTTTGCCCCTGG - Intronic
933639242 2:84741528-84741550 GCCCCACCCTCTTTAGCCCCAGG - Intronic
934475081 2:94588289-94588311 ACCCCACCCATGCTGGCCCCAGG - Intergenic
936152129 2:110027693-110027715 GCACTTCCCATTTCTGCCCCTGG - Intergenic
936192549 2:110343720-110343742 GCACTTCCCATTTCTGCCCCTGG + Intergenic
937018082 2:118624484-118624506 TCCCCAACCATTTTGGCACCAGG - Intergenic
937363307 2:121243939-121243961 GCCCCAACCTTTTTGGCACCAGG - Intronic
937957798 2:127431666-127431688 GCCCCACCTATTCCTCCCCCAGG - Intergenic
939547504 2:143571333-143571355 TCCCCAGCCATTTTGGCACCAGG - Intronic
939658182 2:144853350-144853372 TCCCCAACCATTTTGGCACCAGG - Intergenic
940169571 2:150813477-150813499 GCCCCAACCTTTTTGGCACCAGG + Intergenic
943180223 2:184530924-184530946 GGCCCACCCATGGTTGCCCATGG - Intergenic
943648851 2:190435111-190435133 TCCCCAACCATTTTGGCACCAGG - Intronic
944242674 2:197500590-197500612 GCCCGACCCTTTTCTCCCCCAGG + Intronic
946620750 2:221560113-221560135 GCCCTGCCCATTTTTGCCCAAGG + Intronic
948690199 2:239697254-239697276 TCCCCACCCTTTTTGGCACCAGG + Intergenic
948712474 2:239833651-239833673 GCCCCACCCATGGCTGTCCCTGG + Intergenic
948996747 2:241584510-241584532 GCCACACCCACTTCTGCCGCAGG + Exonic
1169557215 20:6764023-6764045 TCCCCAACCATTTTGGCACCAGG - Intergenic
1171197626 20:23212684-23212706 GCCCCAGGCATTTGTTCCCCAGG - Intergenic
1171797233 20:29576122-29576144 GCCCCAGGCATTATTTCCCCGGG - Intergenic
1171851019 20:30308039-30308061 GCCCCAGGCATTATTTCCCCAGG + Intergenic
1172557757 20:35857204-35857226 GCCCCACCCATTTTTGCCCCAGG - Intronic
1173145988 20:40524750-40524772 GTCCCACCCAATTTTCCCACAGG + Intergenic
1173810334 20:45951450-45951472 TCCCCACCCTTTTTGGCACCAGG + Intronic
1175550770 20:59815906-59815928 TCCCCATCCATTTTTGTACCAGG + Intronic
1176105159 20:63382432-63382454 TCCCCACCCATTTTACCCCCAGG + Intergenic
1176243588 20:64086188-64086210 GCCCCACCCATGTGTCCCCCTGG - Intronic
1178151691 21:29802021-29802043 GTTCCATCCATTTTTGCCTCAGG - Intronic
1178325277 21:31640828-31640850 TCCCCAACCTTTTTTGCACCAGG + Intergenic
1178635206 21:34296397-34296419 TCCCCAACCATTTTGGCACCAGG - Intergenic
1179302490 21:40124883-40124905 TCCCAACCCATTTCAGCCCCTGG + Intronic
1180034320 21:45235908-45235930 CCCCCACCTATTTTTTCCCTCGG - Intergenic
1181001801 22:19991220-19991242 CCCCCACCCTTTCTTGGCCCTGG - Intronic
1181171208 22:21011319-21011341 CCCCCACCCATCCCTGCCCCAGG + Intronic
1181178137 22:21049200-21049222 CCCCCACCCATCCCTGCCCCAGG - Intronic
1182470450 22:30544964-30544986 TCGCCACCCTTCTTTGCCCCGGG + Intronic
1183104638 22:35607258-35607280 CCCCCACCCATCTGGGCCCCGGG - Exonic
1183660647 22:39219095-39219117 GTCCCATCCATTTTTGCCCTTGG - Intergenic
1183713489 22:39520412-39520434 GCCCCAACCGTTTATGCCCAGGG - Intronic
1183821002 22:40346000-40346022 GCCCCACCCACTCCTGCCCGCGG - Intergenic
1184032792 22:41904802-41904824 TCCCCACCCATCTATGCCCAGGG - Intronic
1184257029 22:43293122-43293144 GCCTCAGCCATGTCTGCCCCTGG + Intronic
1184876212 22:47277296-47277318 GCCCCACGCAGGTTTGCACCTGG - Intergenic
1184932938 22:47694933-47694955 TCCCCACCCTTTTTGGCACCAGG + Intergenic
1185319817 22:50195358-50195380 GCCCCACCCACTTTGGGCCTGGG - Intronic
949931375 3:9081041-9081063 TCCCCAACCTTTTTTGCACCAGG - Intronic
950613275 3:14139494-14139516 GCCCCACCCAGCCTGGCCCCTGG - Intronic
950899306 3:16482918-16482940 GCCCCACCCAACTCTGACCCTGG + Intronic
953232553 3:41077664-41077686 GCGAAACCCATTTTTGCCCTAGG - Intergenic
954879354 3:53823235-53823257 CCCCCACCCATCTTGGCCCGTGG - Intronic
956877087 3:73474706-73474728 GCCCCATCCATTTCAGGCCCTGG + Intronic
956899695 3:73702399-73702421 CCCCCAACCATTTTGGCACCAGG - Intergenic
960699485 3:120426484-120426506 ACTCCACCCATTTTTGCCTTGGG + Intronic
961006935 3:123411677-123411699 GCCCCACCCTGCTTTGCCTCTGG - Intronic
961325332 3:126106057-126106079 ACCCAACCCAATCTTGCCCCCGG - Intronic
961370946 3:126431147-126431169 GCCCCACCCACCTTGGACCCTGG - Intronic
961768100 3:129227999-129228021 CCCCCACCCATTTCTCCCCCTGG - Intergenic
962170366 3:133095368-133095390 GCCCCAGCCTTTTTGGCACCAGG + Intronic
962465122 3:135650459-135650481 GCCCCACCTCTTGTTTCCCCAGG + Intergenic
962848230 3:139289123-139289145 GGCCCATCCATTTATGCCCAGGG + Intronic
963154601 3:142082455-142082477 TCCCCAACCTTTTTGGCCCCAGG - Intronic
967056040 3:185829235-185829257 TCCCCAACCATTTTGGCACCAGG + Intergenic
968919332 4:3514595-3514617 GCCCCACACACTTGTGGCCCTGG + Intronic
969587304 4:8101710-8101732 GCCACACCCATGTGTGCCCTCGG - Intronic
972495022 4:39626260-39626282 TCCCCAACCTTTTTTGCACCAGG - Intronic
972675074 4:41252273-41252295 TCCCCAGCCTTTTTGGCCCCAGG + Intergenic
974229529 4:59091851-59091873 GACCCACCCCTTTCTGCCCAGGG - Intergenic
974897075 4:67952927-67952949 GCCCCAACCTTTTTGGCACCAGG + Intronic
976163807 4:82231800-82231822 TCACCACCCATCTTTGCCACTGG - Intergenic
978301047 4:107270081-107270103 GCCCCACCCATGGCTGCCCATGG - Intronic
982328281 4:154152545-154152567 GAGCCACCCATTTTTGCCAGTGG + Intergenic
982893163 4:160881825-160881847 ACCCCACCCTTTATTTCCCCAGG + Intergenic
986234742 5:5896310-5896332 TCCCCAACCATTTTGGCACCAGG - Intergenic
986952119 5:13101373-13101395 TCCCCAACCTTTTTTGCACCAGG - Intergenic
991542391 5:67744013-67744035 TCCCCAACCATTTTGGCACCAGG - Intergenic
992693127 5:79259368-79259390 GGCCCGCCCATGTTTGCCCACGG - Intronic
992897583 5:81258885-81258907 TCCCCAACCATTTTTGCATCAGG - Intronic
993467313 5:88265273-88265295 TCCCCAACCTTTTTGGCCCCAGG + Intronic
994323583 5:98422732-98422754 TCCCCACCCTTTTTAGCACCAGG + Intergenic
996244693 5:121247251-121247273 GCCACACTCATCCTTGCCCCTGG - Intergenic
997516778 5:134495644-134495666 CCCCCACCCATTCTTGGCCCAGG + Intergenic
997898369 5:137740627-137740649 GCCCCAACCTTTTTGGCACCAGG + Intergenic
998138405 5:139686640-139686662 GAACCACCCAGTTTTGCCACAGG - Intergenic
998432787 5:142080887-142080909 TCCCCAACCATTTTGGCACCAGG - Intergenic
998830506 5:146152637-146152659 GCCCCAACCTTTTTGGCACCAGG - Intronic
998984355 5:147739334-147739356 TCCCCACACATTTATGCCACAGG + Intronic
999645455 5:153712943-153712965 TCCCCACCCACTTCTGCCCCAGG + Intronic
1001539468 5:172527243-172527265 GTCTCACCCATTTTTTCCCATGG - Intergenic
1001660210 5:173385523-173385545 GCCCCATTCATTTTTGACACAGG + Intergenic
1001944980 5:175771231-175771253 GTCCCATCCATGTTGGCCCCTGG - Intergenic
1004127802 6:12890291-12890313 GCCCCAACCTTTTTGGCACCAGG - Intronic
1006356868 6:33564499-33564521 GCCCCACTAATTTTTGCCTCAGG + Intergenic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1007357117 6:41329097-41329119 GCCCCACCAATGTTGGCCCCAGG + Intergenic
1007737682 6:43991784-43991806 ACCCCACCAATTTTTGGCACAGG - Intergenic
1008950793 6:57156753-57156775 TCCCCAACCATTTTGGCACCAGG + Intronic
1015465598 6:133544822-133544844 TCCCCAACCATTTTGGCACCAGG - Intergenic
1016441162 6:144084810-144084832 TCCCCAACCTTTTTGGCCCCAGG - Intergenic
1017774643 6:157671307-157671329 GTCCAACCCATCTGTGCCCCAGG + Intronic
1018489395 6:164276055-164276077 TCCCCAACCTTTTTTGCACCAGG - Intergenic
1019133631 6:169894880-169894902 GCCCCAACCTTTTTGGCTCCAGG - Intergenic
1020017076 7:4837325-4837347 GCCCCATCCATCTGTGCACCAGG + Intronic
1022888081 7:34667235-34667257 GCCCCAGGCATTTCTGCCCTGGG + Intronic
1023684014 7:42716901-42716923 ACCCCAGCCATTGGTGCCCCTGG - Intergenic
1025829569 7:65038052-65038074 GCCCCACCCCTTTCTCCCCCGGG + Intergenic
1025916806 7:65873001-65873023 GCCCCACCCCTTTCTCCCCCGGG + Intergenic
1029103845 7:98157816-98157838 GCCCCACCCATGTGTACCCCTGG - Intronic
1030263296 7:107589164-107589186 TCCCCACCCTTTTTGGCACCAGG + Intronic
1032021059 7:128407308-128407330 GCCTCCCCCATTGATGCCCCCGG + Intronic
1036115973 8:5961256-5961278 TCCCCAACCATTTTGGCACCAGG + Intergenic
1036735986 8:11317308-11317330 TCCCCAACCATTTTGGCACCAGG + Intronic
1038257043 8:25959676-25959698 GCCGCAAACATCTTTGCCCCAGG + Intronic
1040106673 8:43545778-43545800 GCCTCACCCCTTTTTTTCCCTGG + Intergenic
1041167911 8:55109063-55109085 GTCCCACCCATTTTGTCCCAGGG - Intronic
1044545663 8:93456475-93456497 TCCCCAACCATTTTGGCACCAGG + Intergenic
1044569781 8:93704356-93704378 TCCCCAACCATTTTGGCACCAGG + Intronic
1045098343 8:98821381-98821403 TCCCCAACCATTTTGGCACCAGG - Intronic
1045891608 8:107164449-107164471 TCCCCAACCTTTTTTGCACCAGG - Intergenic
1047969104 8:130069816-130069838 GTCTGCCCCATTTTTGCCCCAGG - Intronic
1048387650 8:133927587-133927609 TCCCCACCCTTTTTGGCACCAGG + Intergenic
1049468727 8:142765513-142765535 GCCATGCCCATTTTTGCCTCTGG + Intronic
1050289521 9:4139604-4139626 TCCCCAACCTTTTTGGCCCCAGG + Intronic
1051788635 9:20774186-20774208 TCCCCAGCCTTTTTTGCACCAGG - Intronic
1052309156 9:27045354-27045376 TCCCCAACCATTTTGGCACCAGG - Intronic
1052854971 9:33401473-33401495 ACCCCACCCATGCTGGCCCCAGG + Intronic
1053682991 9:40497802-40497824 ACCCCACCCATGCTGGCCCCAGG + Intergenic
1053932973 9:43126116-43126138 ACCCCACCCATGCTGGCCCCAGG + Intergenic
1054280723 9:63127126-63127148 ACCCCACCCATGCTGGCCCCAGG - Intergenic
1054296091 9:63333302-63333324 ACCCCACCCATGCTGGCCCCAGG + Intergenic
1054394107 9:64637797-64637819 ACCCCACCCATGCTGGCCCCAGG + Intergenic
1054428757 9:65143010-65143032 ACCCCACCCATGCTGGCCCCAGG + Intergenic
1054501623 9:65878533-65878555 ACCCCACCCATGCTGGCCCCAGG - Intronic
1059051631 9:110932869-110932891 TCCCCAACCTTTTTGGCCCCAGG - Intronic
1059061967 9:111042326-111042348 GCCCCACCCACCTTTGCCGCTGG - Intergenic
1060435042 9:123586003-123586025 GCCCCAAGGATTTTTGCCCTCGG - Intronic
1061824449 9:133248977-133248999 GCCCAACCCAGTTTCCCCCCAGG - Intergenic
1062250645 9:135592091-135592113 GCCCCTCCCATGTTCTCCCCAGG + Intergenic
1186350496 X:8734018-8734040 GCCCCAACCTTTTTGGCACCAGG - Intergenic
1186488619 X:9953385-9953407 GCCCCTCCCATTATTGGCCCAGG - Intergenic
1186565117 X:10654372-10654394 GCCCCAACCCTTTTGGCGCCAGG + Intronic
1187131661 X:16509147-16509169 TCCCCAACCATTTTGGCACCAGG + Intergenic
1187651029 X:21406321-21406343 TCCCCAACCTTTTTGGCCCCAGG - Intronic
1187865452 X:23719503-23719525 CCCCCAACCTTTTTTGCACCAGG + Intronic
1188429981 X:30095688-30095710 CCCCCAGCCCTTGTTGCCCCTGG + Intergenic
1190747207 X:53331622-53331644 GCCCCGGCCACTGTTGCCCCTGG + Intergenic
1193278561 X:79620901-79620923 TCCCCAACCATTTTGGCCCCAGG - Intergenic
1195599002 X:106725157-106725179 GTCCTACCCATTTTTCCCCTAGG + Intronic
1198797478 X:140414356-140414378 TCCCCAACCATTTTGGCACCAGG + Intergenic
1199170723 X:144731939-144731961 CTCCCACACATATTTGCCCCTGG - Intergenic
1199283990 X:146036025-146036047 GCCCCAACCTTTTTGGCACCAGG - Intergenic
1199347737 X:146761448-146761470 GCCACACCCATCTGTGCACCTGG + Intergenic
1199757079 X:150874617-150874639 GCCACACCCAGGTTTGCACCTGG + Intronic