ID: 1172562427

View in Genome Browser
Species Human (GRCh38)
Location 20:35901123-35901145
Sequence CCTAAGCATGCTTTTTATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172562427_1172562431 16 Left 1172562427 20:35901123-35901145 CCTCAATAAAAAGCATGCTTAGG 0: 1
1: 0
2: 1
3: 20
4: 209
Right 1172562431 20:35901162-35901184 CACCTGAAATCCCAGCACTTTGG 0: 368
1: 71808
2: 207412
3: 251313
4: 204268
1172562427_1172562434 20 Left 1172562427 20:35901123-35901145 CCTCAATAAAAAGCATGCTTAGG 0: 1
1: 0
2: 1
3: 20
4: 209
Right 1172562434 20:35901166-35901188 TGAAATCCCAGCACTTTGGGAGG 0: 1326
1: 296799
2: 267546
3: 155755
4: 134271
1172562427_1172562432 17 Left 1172562427 20:35901123-35901145 CCTCAATAAAAAGCATGCTTAGG 0: 1
1: 0
2: 1
3: 20
4: 209
Right 1172562432 20:35901163-35901185 ACCTGAAATCCCAGCACTTTGGG 0: 385
1: 75426
2: 306750
3: 245351
4: 150298
1172562427_1172562435 23 Left 1172562427 20:35901123-35901145 CCTCAATAAAAAGCATGCTTAGG 0: 1
1: 0
2: 1
3: 20
4: 209
Right 1172562435 20:35901169-35901191 AATCCCAGCACTTTGGGAGGTGG 0: 3798
1: 3826
2: 2729
3: 1935
4: 2347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172562427 Original CRISPR CCTAAGCATGCTTTTTATTG AGG (reversed) Intronic
906320485 1:44812695-44812717 CCTAGGCTTGATTTTTTTTGAGG - Intronic
906855872 1:49303810-49303832 CCTTTGCCTGCTTTTTAATGGGG + Intronic
909248843 1:73326794-73326816 CCTCAGCTTCCTTTTCATTGGGG + Intergenic
911986581 1:104633181-104633203 CATAAGCATGCTTCTTTTTTAGG + Intergenic
912040365 1:105382943-105382965 TGTAAGCAGGTTTTTTATTGAGG + Intergenic
912223194 1:107701125-107701147 CCTTTGCCTGCTTTTTAATGGGG + Intronic
913695599 1:121322209-121322231 AGTAAGCATGCTTTTTAAAGGGG - Intronic
914141966 1:144957850-144957872 AGTAAGCATGCTTTTTAAAGGGG + Intronic
915693121 1:157710439-157710461 CTTTAGCATGCTTCTTATTAAGG - Intergenic
920482928 1:206340591-206340613 AGTAAGCATGCTTTTTAAAGGGG - Intronic
921402768 1:214744433-214744455 CATAAGCATGCTTTTTTGTGGGG - Intergenic
923533693 1:234831668-234831690 ACTATGCCTGCTTTTTTTTGGGG - Intergenic
1063186668 10:3658093-3658115 TCTAAACATGCTTTTTCCTGTGG - Intergenic
1063442268 10:6082379-6082401 CCTAAGCAAGCCATTTATAGGGG + Intergenic
1071496531 10:86171166-86171188 CCAAAGCATGCTTTTCATAGTGG - Intronic
1073171769 10:101516224-101516246 GCTAAGCATGCTTTTCATGAGGG + Intronic
1075227824 10:120645423-120645445 TATAAGCATGGCTTTTATTGTGG - Intergenic
1077693766 11:4374837-4374859 CTCAAGCATGCTTTTCATGGTGG + Intergenic
1079683800 11:23331625-23331647 GCTAAGCATGCCTATTCTTGGGG + Intergenic
1080150195 11:29043733-29043755 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
1081553664 11:44137744-44137766 CCTAAGCATTCTTTAAATTTAGG + Intronic
1082927306 11:58563334-58563356 CTTAAGGATGCTTTTTACTTTGG - Intronic
1083129007 11:60604114-60604136 CCTTTGCCTGCTTTTTAATGGGG + Intergenic
1084210928 11:67622002-67622024 CCCAAGCTTTCTTTTCATTGAGG + Intergenic
1086031788 11:82368044-82368066 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
1086168764 11:83811539-83811561 ACTAAACATACTTTTTAGTGAGG - Intronic
1086606568 11:88703013-88703035 CCTAAGCATGCTTTAAATTGGGG + Intronic
1092082015 12:5724098-5724120 CCTAAGCATCCTTATTATATGGG - Intronic
1093617090 12:21238833-21238855 TCTAATAATTCTTTTTATTGGGG - Intronic
1093824005 12:23659301-23659323 CCTAAACATTAATTTTATTGCGG + Intronic
1096259880 12:50083844-50083866 CTAAAGCATCCTTTGTATTGGGG - Intergenic
1101171495 12:102101212-102101234 CATAATCATGCTTTTTATGGAGG + Intronic
1101671321 12:106877044-106877066 CTTAACCATGCTGTTTACTGTGG + Intronic
1101932551 12:109026373-109026395 CCTAAAAATAATTTTTATTGTGG + Intronic
1105042264 12:132969786-132969808 CCTCTGCCTGCTTTTTATTCTGG - Intergenic
1106001899 13:25731519-25731541 CCAAAGAATGCTTTTTATTTGGG + Intronic
1106364516 13:29065452-29065474 CGTTTGCATGCTTTTTAATGGGG + Intronic
1107873649 13:44769738-44769760 CCACAGTCTGCTTTTTATTGGGG - Intergenic
1108765979 13:53629948-53629970 CCTTTGCATACTTTTTAATGGGG + Intergenic
1109510050 13:63359847-63359869 CCTAAGCATTTATTTTATTTTGG - Intergenic
1109941905 13:69379213-69379235 CATATGGATGCTTTTAATTGGGG + Intergenic
1111464048 13:88584837-88584859 CCTAAGCAGTCTTTTTCTTAGGG - Intergenic
1112460421 13:99599108-99599130 CCTAAGCCCACTTTTTAATGGGG + Intergenic
1114198282 14:20498610-20498632 CCTGAGCATGATTTTTATCGAGG + Intergenic
1114261997 14:21043675-21043697 CCTGAGCTTGCTGTTTCTTGGGG - Exonic
1115047604 14:29015701-29015723 CCTCTGCTTGCTTTTTAATGGGG + Intergenic
1116766801 14:49082365-49082387 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
1117966006 14:61207198-61207220 TATAAGCATCCTTTCTATTGTGG - Intronic
1119971577 14:78976648-78976670 CCTCAAAATGCTTTCTATTGTGG + Intronic
1121599315 14:95191359-95191381 CCTGAGCATGCTTTTTTCTTTGG - Exonic
1123687570 15:22810043-22810065 CCTAAGCACTTTTTTTTTTGAGG - Intronic
1125784778 15:42306314-42306336 CATAAATATGTTTTTTATTGTGG - Intronic
1127465199 15:59237480-59237502 CTTAAGCATGTTTTGAATTGAGG - Intronic
1128250672 15:66161889-66161911 GCAAAGCATACTTTTTATTGTGG - Intronic
1131280461 15:91017114-91017136 CCTAATTATGCTAATTATTGAGG + Intronic
1131853967 15:96572428-96572450 CCTTTGCCTGCTTTTTAATGGGG + Intergenic
1134382928 16:13745113-13745135 CCTTTGCCTGCTTTTTAATGGGG + Intergenic
1137735919 16:50723007-50723029 CCTTAGAATTCTTTTTAATGTGG - Intronic
1139135201 16:64194933-64194955 CCTAAGGGTTCTTTTTATTGTGG - Intergenic
1141019065 16:80478070-80478092 CAAAAGCATGCTTTCTATTTGGG + Intergenic
1141372888 16:83503713-83503735 CCTTCGCCTGCTTTTTAATGGGG + Intronic
1142778096 17:2157524-2157546 AGTAAGCATGCTTCTAATTGTGG - Intronic
1151029949 17:70725068-70725090 CCTCAGCAAGCATTTTATGGTGG + Intergenic
1151049292 17:70958439-70958461 CCTTGGCCTGCTTTTTAATGGGG + Intergenic
1151637996 17:75366028-75366050 CCTAAGCATTATTTTAATAGCGG + Intronic
1153885736 18:9463931-9463953 ACTTAGCATGCTTTCTTTTGAGG + Intergenic
1154332797 18:13443338-13443360 CCCAAGCATTTTGTTTATTGAGG + Intronic
1155060152 18:22221350-22221372 TCTAAGAATGCCTTTTATTCTGG + Intergenic
1155488587 18:26373921-26373943 CCTAATCATGCTTTGTGTTAAGG - Intronic
1157938554 18:51899849-51899871 CCTTTGCCTGCTTTTTAATGAGG + Intergenic
1158031662 18:52972895-52972917 GCTATGCATGATTTTTATGGGGG + Intronic
1158230767 18:55251958-55251980 CTTAAACTTCCTTTTTATTGTGG + Intronic
1159315602 18:66769604-66769626 CCTAAGCATACATCTCATTGAGG - Intergenic
1159354585 18:67321387-67321409 CCTTTGCTTGCTTTTTAATGGGG + Intergenic
1160131671 18:76230876-76230898 CCAAAGCAGGCTTTCTTTTGTGG - Intergenic
1160597104 18:79983372-79983394 CATAAGCATGCTTTTTCTTTAGG + Intronic
1162225929 19:9222534-9222556 CCTAAGCATTCTATTTTTGGGGG + Intergenic
1163462825 19:17448860-17448882 CCTAAGCATCGATTGTATTGTGG + Intronic
1164032331 19:21418804-21418826 CAGGAGCATGCTTTTTTTTGTGG + Intronic
1164439313 19:28260210-28260232 CCTTTGCCTACTTTTTATTGGGG - Intergenic
1165291555 19:34890046-34890068 TCTAAGCTTGCTTTTGATTCAGG + Intergenic
1167519317 19:49943862-49943884 CCTTTGCCTGCTTTTTAATGTGG - Intronic
925698746 2:6611688-6611710 CCTTTGCCTGCTTTTTAATGGGG + Intergenic
925986767 2:9222756-9222778 CCTACCCATGATTTTTACTGTGG - Intronic
927690191 2:25202793-25202815 CTAAAGCATGCTTTTTACTGAGG - Intergenic
928748116 2:34439580-34439602 CCTGAGCATGCTTTAGAATGTGG - Intergenic
930714672 2:54582213-54582235 TCTAAGAAAGCATTTTATTGGGG + Intronic
931082447 2:58789951-58789973 CATAAGCATGCTTTTTCTAAAGG - Intergenic
932752851 2:74382747-74382769 CCTAAGCATGCCTTGAATTATGG + Intronic
932908305 2:75778529-75778551 CCTCTGCCTGCTTTTTAATGAGG - Intergenic
935446976 2:103167276-103167298 CTTAAGAATGTTTTTTTTTGGGG - Intergenic
935877420 2:107525749-107525771 CCAAAGCTTGCTATTTCTTGGGG - Intergenic
937848365 2:126607285-126607307 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
937976681 2:127586748-127586770 ACTAAGCCTTCTTTTTATTTTGG + Intronic
938134553 2:128744349-128744371 CCTTTGCTTGCTTTTTAATGGGG + Intergenic
938421369 2:131149924-131149946 CATAAGAATGCCATTTATTGAGG + Intronic
939262312 2:139826073-139826095 CCTAATCATACTTTTAATTCTGG + Intergenic
939527348 2:143313527-143313549 CCGTAGCATGGTTTTTATGGGGG - Intronic
939953269 2:148501582-148501604 CCTAATTATTGTTTTTATTGTGG + Intronic
940392897 2:153153222-153153244 CCTTTGCCTGCTTTTTAATGAGG + Intergenic
940632975 2:156261876-156261898 CATAAGCATGAGTTTTATAGTGG - Intergenic
941828916 2:169931780-169931802 CCTAAGCGTGATTATTAGTGAGG + Intronic
942576498 2:177369031-177369053 CCTTAGCCTGCTTTTTGATGGGG + Intronic
945149162 2:206769937-206769959 CCCAAAGATGCTGTTTATTGTGG + Intronic
945470352 2:210222056-210222078 CCTAAGTATCATTTTTTTTGTGG + Intronic
945498489 2:210539063-210539085 CCTTAGAATTCTTTTTATTTAGG + Intronic
946592839 2:221270321-221270343 CACAAGATTGCTTTTTATTGGGG - Intergenic
947460108 2:230296725-230296747 CCTCAGCCTGATTATTATTGAGG + Intronic
948955890 2:241290751-241290773 TCTAAGTAGACTTTTTATTGAGG - Intronic
1169047254 20:2543482-2543504 CCTGGCCATGCTGTTTATTGTGG - Intronic
1169761580 20:9100952-9100974 CCCAAGCATGATTTTTATGTGGG + Intronic
1169887414 20:10415701-10415723 CTTAATCATAGTTTTTATTGTGG - Intronic
1170381595 20:15766094-15766116 GCCAAGTATGCTTTTTAGTGTGG + Intronic
1170755263 20:19198027-19198049 CCTTTGCATACTTTTTAATGGGG + Intergenic
1171316993 20:24203914-24203936 GCTAAGCAGGCTTTTTTTTCAGG + Intergenic
1171330616 20:24334722-24334744 TTTTAGCATGCTTTCTATTGGGG - Intergenic
1172562427 20:35901123-35901145 CCTAAGCATGCTTTTTATTGAGG - Intronic
1178554505 21:33576459-33576481 CTTTAGCATGCTTCTTATTAGGG - Exonic
1179770043 21:43608268-43608290 CCTTTGCCTGCTTTTTAATGAGG - Intronic
1185261849 22:49870647-49870669 CCTTTGCTTGCTTTTTAATGGGG + Intronic
949456156 3:4241345-4241367 CCTAAGCATACATATTATTTGGG - Intronic
949578208 3:5359670-5359692 CCCAAGCATGACTTTTTTTGTGG + Intergenic
951065075 3:18254851-18254873 CTTAAGAGTGCTTTTTGTTGGGG - Intronic
951897920 3:27627942-27627964 CCTAACCCTACTTTTTAATGGGG - Intergenic
952832655 3:37578032-37578054 CCCAAACATGGTTTTTAGTGAGG + Intronic
953662929 3:44904104-44904126 ACTGAGCATGCTTTTTGTTTTGG - Intronic
955623725 3:60894085-60894107 ATTTAGCATGCTTTTTATTGTGG + Intronic
955813041 3:62811419-62811441 CCAATGCATGCATTTTCTTGAGG - Intronic
957793131 3:84964287-84964309 CCTAAGCATGCATTTGAAAGTGG + Intronic
958267546 3:91457202-91457224 CCAAAGGATGTTTTTTATTTGGG + Intergenic
958849840 3:99311486-99311508 CCTTTGCTTGCTTTTTAATGAGG - Intergenic
959068745 3:101683640-101683662 CTTAAACATTTTTTTTATTGTGG + Intronic
959128703 3:102323533-102323555 CCTAAGGATATTTTTTTTTGTGG - Intronic
960295991 3:115944601-115944623 ACTAAGTATGCTTTTTACTGTGG + Intronic
960768019 3:121159477-121159499 TCTAAGCATGTTTTTTATGATGG + Intronic
960893271 3:122474108-122474130 CCTAAGTATTCTGTTTTTTGGGG - Intronic
961224093 3:125223624-125223646 GCTATGCATGTTTTTTGTTGGGG - Intergenic
964146823 3:153473846-153473868 CTTCTGCATGCTTTTTATTCTGG - Intergenic
964864114 3:161235497-161235519 CCTAAGTATGATATTTCTTGAGG + Intronic
966712614 3:182985326-182985348 CCTTAGCATGGTTCTTAATGTGG - Intronic
967604042 3:191423216-191423238 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
968017772 3:195354504-195354526 CCTTTGCCTGCTTTTTAATGGGG + Intronic
970230936 4:13910394-13910416 TCTCAGCATCCTTTATATTGAGG - Intergenic
973306911 4:48662561-48662583 CCTTAGCATGCTTTTTCTTTGGG - Intronic
974417451 4:61627970-61627992 TCCAAGCATCCTTGTTATTGAGG - Intronic
974951353 4:68586448-68586470 CCTTAGCCCACTTTTTATTGGGG - Intronic
975680474 4:76870427-76870449 CCTTTGCCTGCTTTTTAATGAGG - Intergenic
975798701 4:78036077-78036099 CCTACATATTCTTTTTATTGGGG - Intergenic
977403333 4:96563264-96563286 CTTATGCATGCCATTTATTGGGG - Intergenic
978695565 4:111573515-111573537 CCTAAAGATGATTTTTATGGAGG + Intergenic
982411027 4:155077486-155077508 CTTGAGCATGCGTTTAATTGAGG + Intergenic
982900581 4:160995643-160995665 CCTTTGCATACTTTTTAATGGGG + Intergenic
983038390 4:162895314-162895336 CCCAAGCAATCTTTTTATTGAGG - Intergenic
985037125 4:185851709-185851731 CCTCTGCCTGCTTTTTATTCTGG - Intronic
985829149 5:2215233-2215255 CCTCACCAGGCTTTTTATTTGGG + Intergenic
988109252 5:26795727-26795749 TGTAAGCATTCTTTTTAATGTGG - Intergenic
988146002 5:27309438-27309460 ACTTAGCATCCTGTTTATTGGGG - Intergenic
989219247 5:38937012-38937034 TGTAAGTATGCTTTTTATTTCGG + Intronic
989826502 5:45863233-45863255 CCTATGTATGCTTTCTATTGAGG - Intergenic
992201533 5:74389259-74389281 ACTAATCATGCTTTATTTTGGGG + Intergenic
993746398 5:91602873-91602895 ATTAAGCTTGCTTTTTTTTGTGG + Intergenic
997858614 5:137395796-137395818 CCAAAGCATGCTGTTTATCCTGG + Intronic
997886251 5:137632824-137632846 CCTTTGCCTGCTTTTTAATGGGG - Intronic
999463988 5:151783759-151783781 CCTAAACATTCTTTTTTTTCTGG + Intronic
999692776 5:154163030-154163052 TTTAAGAATGCTTTTTATGGTGG + Intronic
1000005388 5:157178215-157178237 CCTTAGCATGTTTTGTATTCTGG + Intronic
1004839280 6:19563925-19563947 CCTTTTCATGCTTTTTAATGGGG + Intergenic
1005813620 6:29533475-29533497 CCTAAGAATGCCTCTTCTTGGGG + Intergenic
1006999276 6:38293990-38294012 CCTTTGCATGCTTTTTGATGGGG - Intronic
1007007886 6:38384483-38384505 ACTAAGCAGGCTTTTGTTTGTGG - Intronic
1008987669 6:57564388-57564410 CCAAAGGATGTTTTTTATTTGGG - Intronic
1009176273 6:60462993-60463015 CCAAAGGATGTTTTTTATTTGGG - Intergenic
1009454889 6:63844681-63844703 CCTTTGCACGCTTTTTAATGGGG + Intronic
1009783145 6:68296192-68296214 CCTTTGCATACTTTTTAATGGGG - Intergenic
1010435824 6:75829768-75829790 CTTAAGCTTGCTTTTAATTTTGG - Intronic
1010453069 6:76025489-76025511 CGTAAGCATCCTTTTTTTTGTGG + Intronic
1010560921 6:77349331-77349353 CATATGCATTCTTTTTATTATGG - Intergenic
1010719478 6:79266009-79266031 CGTAAGCATGATGTTTGTTGTGG - Intergenic
1010769605 6:79813054-79813076 TCTCAGCATGCTTTTTTTTTAGG - Intergenic
1012770625 6:103429036-103429058 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
1013083884 6:106838546-106838568 CCCCAGCAGGCTTTTTATTTTGG + Intergenic
1013295928 6:108758442-108758464 CCTTAGCATTTTGTTTATTGGGG + Intergenic
1013860252 6:114626895-114626917 CCTTTGCCTGCTTTTTAATGGGG + Intergenic
1014976791 6:127896016-127896038 GTTAAACATGCTTTTAATTGTGG - Intronic
1015472336 6:133619904-133619926 CCTTCGCATGCTTTTTGATGGGG - Intergenic
1016864628 6:148753495-148753517 CCTAAGAATTTTTTTTATTGCGG + Intronic
1016996200 6:149963908-149963930 CCTAGGCATGCACTTTTTTGGGG - Intergenic
1017204272 6:151788271-151788293 CCTTTGCCTGCTTTTTAATGAGG - Intronic
1019535606 7:1528219-1528241 CCAAAGTTTACTTTTTATTGTGG - Intergenic
1023494499 7:40780040-40780062 CCTAAGCATTCTTTAAATTATGG + Intronic
1024680014 7:51676168-51676190 CCTTTGCTTGCTTTTTAATGGGG + Intergenic
1025739971 7:64186734-64186756 ACTATGCATGCTTTTTAATCTGG - Intronic
1025901145 7:65745853-65745875 CCCAAGAATGCTCTTTATTTGGG - Intergenic
1026187550 7:68093974-68093996 CCTTAGAATTCTTTCTATTGTGG + Intergenic
1028043420 7:86087912-86087934 CCTCTGCCTGCTTTTTATTCTGG - Intergenic
1028044143 7:86094021-86094043 CCTCTGCCTGCTTTTTATTCTGG - Intergenic
1031784874 7:126016851-126016873 CCAAAGAATGCATTTTATTGAGG - Intergenic
1032920690 7:136543007-136543029 CCTATGCATGCTGCTTACTGGGG + Intergenic
1037137389 8:15479104-15479126 CCTTTGCCTGCTTTTTAATGGGG + Intronic
1038079176 8:24113510-24113532 CCTAACCATGTGTTTTACTGAGG + Intergenic
1039020687 8:33202511-33202533 CTTAAGCATCCATTTTATTGAGG - Intergenic
1039481869 8:37879928-37879950 ACTAACCATTTTTTTTATTGTGG - Intronic
1040490703 8:47919178-47919200 CCTAAGAATGTTTTTAATTCAGG + Intronic
1041498364 8:58512142-58512164 CCTTATAATGCTTTTTATTTGGG + Intergenic
1041668435 8:60468309-60468331 CCTTAGCATGCTGTTTTCTGAGG + Intergenic
1044020262 8:87097058-87097080 CAAAAGCTTGCTTTTTAGTGAGG + Intronic
1044982197 8:97727924-97727946 TTTATGCATGCATTTTATTGGGG + Exonic
1044991212 8:97797684-97797706 CATAAGGATTTTTTTTATTGAGG + Intronic
1045923692 8:107563421-107563443 ACTAAGTATGCTTTTCCTTGTGG - Intergenic
1047276922 8:123412876-123412898 CTTAAGCAGGCATTTTAATGGGG - Intronic
1048727454 8:137402323-137402345 CTTAAGTGTGCTTTTTGTTGTGG - Intergenic
1050389821 9:5130299-5130321 CATATACATGCTATTTATTGAGG + Intergenic
1050792960 9:9497057-9497079 ACAAAGCATGCTTATTGTTGAGG + Intronic
1052694454 9:31858265-31858287 CCTAAGCATTCTATATTTTGTGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057409860 9:94808538-94808560 ACTAACCATGCTATTTATAGAGG + Intronic
1059839879 9:118202346-118202368 CCTAAGTATTCTTTTTCCTGTGG + Intergenic
1062296701 9:135833975-135833997 CCTTAGCCTGCTTTTTATTTGGG - Intronic
1188210273 X:27415602-27415624 TCTAAGCATCCTTATTATTTGGG + Intergenic
1189611181 X:42737699-42737721 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
1190000204 X:46678712-46678734 CCTAAGTATCCTTATTACTGAGG - Intronic
1190892754 X:54585239-54585261 CCTTATCTGGCTTTTTATTGGGG + Intergenic
1191872305 X:65758632-65758654 ACAAAGCATGTTTTTTATTGTGG - Intergenic
1193992865 X:88329983-88330005 GGTAAGAATGCTTTTTATTTTGG + Intergenic
1195320528 X:103718158-103718180 CCTAAGAAGACTTTTTACTGCGG - Intronic
1196216865 X:113063076-113063098 CCTTTGCCTACTTTTTATTGGGG + Intergenic
1196963040 X:121024860-121024882 TCTAATCATGCTTTTGACTGAGG - Intergenic
1197539209 X:127734319-127734341 CCAAGGCATTCTTTTTATTTTGG - Intergenic
1199798188 X:151223135-151223157 CCTATGCTTGTTTTTTTTTGTGG + Intergenic
1200172875 X:154091121-154091143 CCTAAGCAGGCTATTTCTTATGG + Intronic
1201428938 Y:13885795-13885817 TCTATGCATGTTTTTTATGGAGG - Intergenic