ID: 1172564778

View in Genome Browser
Species Human (GRCh38)
Location 20:35920709-35920731
Sequence GCATGTCCACTGGTGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172564778_1172564782 13 Left 1172564778 20:35920709-35920731 CCCAGCACCACCAGTGGACATGC 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1172564782 20:35920745-35920767 CACATACATACCCACACTTTAGG 0: 1
1: 0
2: 6
3: 64
4: 559
1172564778_1172564784 20 Left 1172564778 20:35920709-35920731 CCCAGCACCACCAGTGGACATGC 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1172564784 20:35920752-35920774 ATACCCACACTTTAGGCTGAGGG 0: 1
1: 0
2: 1
3: 10
4: 100
1172564778_1172564783 19 Left 1172564778 20:35920709-35920731 CCCAGCACCACCAGTGGACATGC 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1172564783 20:35920751-35920773 CATACCCACACTTTAGGCTGAGG 0: 1
1: 0
2: 0
3: 7
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172564778 Original CRISPR GCATGTCCACTGGTGGTGCT GGG (reversed) Intronic
903231856 1:21927098-21927120 GCTTCTCCACGGGTGGGGCTGGG - Intronic
903805229 1:26000399-26000421 TTTTGTCCACTGGTGGTGCGTGG - Intergenic
908164843 1:61447862-61447884 GCAGGTACGCTGGTGGTGCCCGG + Intronic
910209326 1:84777368-84777390 CCATCTCCACTGGTGGCTCTCGG + Intergenic
910399776 1:86826872-86826894 TCATGTCCACTGGTGCTACCTGG - Intergenic
910610331 1:89134313-89134335 GCATGTGCATTGGTGGTGGCAGG - Intronic
912373191 1:109189464-109189486 TCATGTTCAGTGGTGGTTCTGGG + Intronic
916392150 1:164342458-164342480 GCATGTGCACTGGTGGCAGTGGG - Intergenic
919803829 1:201369147-201369169 GCATGGCCACTGGGTGGGCTGGG - Intronic
923559373 1:235027195-235027217 GCCACCCCACTGGTGGTGCTGGG + Intergenic
1065588641 10:27243265-27243287 GCATGCCCACTGCATGTGCTGGG + Intergenic
1067958140 10:50816228-50816250 CCTTGTCCACTGGTTTTGCTAGG + Exonic
1070714881 10:78712367-78712389 ACATGTCCACTCCTGGAGCTGGG - Intergenic
1071592745 10:86891152-86891174 GCTTGTCCCCTGGTGGTGGTGGG + Intronic
1071856318 10:89628065-89628087 GCATTTCCACTAGTGGTGTGAGG - Intronic
1075860082 10:125667636-125667658 TCATGTCCAAGGGTGGTGTTGGG - Intronic
1076032814 10:127173988-127174010 GCCTCTCCACTGCTGGAGCTGGG + Intronic
1076705169 10:132297414-132297436 GCGTGGCCCCTGGTGGGGCTGGG - Intronic
1076817211 10:132920841-132920863 GCATGTCCACTGCTGGCTGTGGG - Intronic
1077192532 11:1261409-1261431 GCAGGTGCACTGGTGCTGCATGG - Exonic
1078014242 11:7599537-7599559 GCCTCTCCCCAGGTGGTGCTGGG - Intronic
1078976284 11:16481696-16481718 GCATGTTCAATGATGGTGGTTGG + Intronic
1079293216 11:19207606-19207628 GCAAGTGAATTGGTGGTGCTGGG + Intronic
1081326346 11:41749996-41750018 GCTTGATCACTGTTGGTGCTTGG + Intergenic
1085442516 11:76577492-76577514 GCATGTCTGCTGCTGATGCTTGG - Intergenic
1088345359 11:108818137-108818159 GCATGTCCACTGGTGAGGGCAGG - Intronic
1098692344 12:73504103-73504125 GCATTTCCAATGGAGGTACTGGG - Intergenic
1103798572 12:123522339-123522361 GCAGGGCCTCTGCTGGTGCTGGG - Intronic
1104106149 12:125661493-125661515 GCATGTGAACTGGTGGCTCTGGG - Exonic
1105292414 13:19061435-19061457 GCCTGGCAGCTGGTGGTGCTGGG - Intergenic
1109000185 13:56791485-56791507 GTGTGTCCACTGCTGTTGCTTGG - Intergenic
1109407863 13:61924421-61924443 GCTTGTCCACTGTTGGTGTATGG + Intergenic
1109618723 13:64872170-64872192 GCACGGGCACTGGTGGTGGTGGG - Intergenic
1111160229 13:84384691-84384713 GTGTGTTCACTGGTGGTGGTGGG - Intergenic
1115789806 14:36866084-36866106 GCATGTTTTCTGGTGGTGCTGGG - Intronic
1122273568 14:100579555-100579577 GCCTGGCCTCTGGTGCTGCTTGG + Intronic
1122771273 14:104099007-104099029 GCCTGCCCAGTGCTGGTGCTGGG + Intronic
1124472850 15:30003546-30003568 CCATCTCCACTGGTGTAGCTCGG - Intergenic
1125489310 15:40135274-40135296 GCATGTTCACTAGAGGTTCTGGG - Intergenic
1126066495 15:44830011-44830033 GCATTTCCACTGTTGATGGTGGG - Intergenic
1126680305 15:51195947-51195969 GCATGTCCCCTGGGTGTCCTTGG + Intergenic
1128978278 15:72168733-72168755 GCTTGTCTCCTGGTGCTGCTAGG + Intronic
1129206245 15:74038624-74038646 GAATTTGCAGTGGTGGTGCTGGG - Intronic
1130005001 15:80087263-80087285 ACATGCCCACTAGTCGTGCTTGG + Intronic
1130323969 15:82863858-82863880 GCATGTCTCCTGGCTGTGCTGGG - Intronic
1133665642 16:7965186-7965208 GTATGTCCACTGTGAGTGCTGGG - Intergenic
1138417775 16:56881069-56881091 GCATGGCCACTGCCCGTGCTTGG - Intronic
1138712675 16:58986844-58986866 ACATGGGCACTGGTGGTGATGGG - Intergenic
1138729777 16:59182316-59182338 ACATGTGCACTGTTGGTGGTGGG + Intergenic
1140900987 16:79367510-79367532 GCTTGTCAAGTGGTGGTTCTTGG + Intergenic
1141592188 16:85076703-85076725 GCCTGCCCACTGGTGAGGCTGGG - Intronic
1142414099 16:89932055-89932077 CCATGTCCAGTGATGGTGCCAGG - Intronic
1142597929 17:1038634-1038656 GCGTGGACATTGGTGGTGCTGGG - Intronic
1142901707 17:3016262-3016284 GCATATCCACTGGGTGCGCTGGG - Intronic
1144137766 17:12314678-12314700 GCTTTTGCACTGGTGGTGGTGGG + Intergenic
1144207880 17:12992057-12992079 GCAAGTCTTCTGGTGGTTCTGGG - Intergenic
1146793264 17:35764768-35764790 GAAGGCCCACTGTTGGTGCTTGG + Exonic
1147909971 17:43849540-43849562 GCAGGTCCACTTGGGGTTCTGGG - Intronic
1152931839 17:83113951-83113973 GCAGGTCCGCTGGTGGTGGGGGG + Intergenic
1157160691 18:45311601-45311623 GAATGTCCAGTGGTGGGGCCAGG - Intronic
1163690400 19:18735510-18735532 GCGTGTCCCCTGGGAGTGCTGGG + Intronic
1163793880 19:19324426-19324448 GCACATCCACTGGAGATGCTGGG - Intronic
925862750 2:8196211-8196233 ACATGTTCAGTGGAGGTGCTGGG - Intergenic
925989451 2:9242319-9242341 GCCAGCACACTGGTGGTGCTTGG + Intronic
926406567 2:12559036-12559058 GTTTGGCCACTGGTGGGGCTCGG - Intergenic
927082005 2:19639741-19639763 TCATCTCCACTTCTGGTGCTGGG - Intergenic
927982737 2:27384784-27384806 GCATTCCCACTGGTGAGGCTGGG - Exonic
928208800 2:29307931-29307953 GAATGTCCACTGGTGTTCCCTGG - Intronic
928802664 2:35112906-35112928 GCATTTCCATTGGAGGTACTGGG - Intergenic
929038735 2:37722554-37722576 GCATCTCTACTGGTGGAGCAAGG + Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936323818 2:111488131-111488153 ACATGTCCACTGGGCATGCTGGG + Intergenic
937361608 2:121233664-121233686 CCATGGCCACTGGGAGTGCTCGG + Intronic
943016064 2:182511986-182512008 GCCTGTGCACTGGTGGTGGTGGG - Intronic
943876411 2:193072766-193072788 CCAGGCCCACAGGTGGTGCTTGG + Intergenic
946209492 2:218135949-218135971 TCATGTCCACTGGTTCTTCTTGG + Exonic
947351004 2:229245051-229245073 ACATGTCTACTGGTGGAGATGGG - Intronic
1169221591 20:3826313-3826335 ACATTTCCACTGGTGGGACTTGG - Exonic
1171823650 20:29876355-29876377 GCGCGGCGACTGGTGGTGCTTGG + Intergenic
1171896442 20:30813990-30814012 GCGCGGCGACTGGTGGTGCTTGG - Intergenic
1172564778 20:35920709-35920731 GCATGTCCACTGGTGGTGCTGGG - Intronic
1173330872 20:42075385-42075407 TCATGTCAACAGGTTGTGCTGGG - Exonic
1173671222 20:44800316-44800338 GGATGTCCTCTGGTGCTGTTCGG + Intronic
1174831786 20:53820219-53820241 GCATGTCCACAGGTGCTGTTCGG + Intergenic
1179936898 21:44611804-44611826 GCGTGTCTGCTGGTGGAGCTGGG - Intronic
1180046806 21:45310347-45310369 GCATGTCCACAGGTGGAGGTGGG + Intergenic
1182636877 22:31735099-31735121 GAATATACACTGGTGGAGCTGGG + Intronic
1183121895 22:35736511-35736533 TCATGTCCACTGTTGTTACTAGG + Intergenic
1183588545 22:38767124-38767146 GGATGGCCACTGCTGGTCCTGGG + Intronic
1185229897 22:49673798-49673820 CCATGTCCACTCCTTGTGCTGGG - Intergenic
952608479 3:35179098-35179120 GCATGTGCACTAGTGGTAGTAGG + Intergenic
954409264 3:50363234-50363256 CCATGCCCACTGCTGGTGCCAGG - Intronic
955570410 3:60299011-60299033 GCATGTGCACTGGTCTTGCATGG + Intronic
957867041 3:86039165-86039187 GCATGTCCAACTGTGGTACTGGG + Intronic
967981639 3:195069513-195069535 GCCTGTGCACTGCTGGTGCTTGG - Exonic
968317620 3:197737301-197737323 TAATGTCCGCTGGTGGTGTTTGG + Intronic
968900192 4:3427278-3427300 GCAAGTCCTGTGGTGGAGCTTGG + Intronic
969512997 4:7630224-7630246 CCATGTCCACAGGTGAGGCTGGG + Intronic
975857638 4:78641535-78641557 GCAGGTCGCCTGATGGTGCTAGG - Intergenic
976846881 4:89499052-89499074 GGATGACCAATGGTAGTGCTTGG + Intergenic
978622878 4:110651770-110651792 GGATGTGAACTGGTGGTGGTGGG + Intergenic
980548196 4:134297373-134297395 GCAGGGACACTGATGGTGCTGGG + Intergenic
981472706 4:145154824-145154846 GAATGTTCAATGGTGGTGGTGGG + Intronic
981558722 4:146023869-146023891 ACATGGCCACTGCTGGGGCTGGG + Intergenic
983760367 4:171397825-171397847 GCATGCCCACTGGCTATGCTGGG + Intergenic
984852664 4:184167823-184167845 GCATATCAACAGATGGTGCTGGG + Intronic
985774062 5:1831589-1831611 GCATCTTCCCTGGTGCTGCTGGG + Intergenic
991085699 5:62646789-62646811 CCTGGTCAACTGGTGGTGCTGGG + Intergenic
991318339 5:65338538-65338560 GCATGTCTGCTGGTGGTGGAAGG - Intronic
992416206 5:76554113-76554135 TCTTTTCAACTGGTGGTGCTGGG + Intronic
997701053 5:135899681-135899703 CCATGGCCACTGGTGTTCCTTGG + Intergenic
998910927 5:146959549-146959571 GCATGCACTGTGGTGGTGCTGGG + Intronic
1005316052 6:24603923-24603945 GCATGGCCAGTGATGGTGTTAGG - Intronic
1007514494 6:42400549-42400571 GCATGGGCCCTGGTGGTGGTGGG - Intronic
1007728252 6:43929853-43929875 GCATGTCCCCTGTTGGTGAGGGG + Intergenic
1011353359 6:86447059-86447081 GCAAGTCCATTGGTGGGGCCTGG + Intergenic
1012692184 6:102327959-102327981 GCATGAGCACTGGTGGTGGGTGG + Intergenic
1012807213 6:103909222-103909244 GCATGGCCACTGGAGATGATGGG + Intergenic
1014898098 6:126928609-126928631 GCCTACCCACTGGTGGTGCCTGG + Intergenic
1018206951 6:161445279-161445301 GCATGTGACCTGCTGGTGCTCGG + Intronic
1018716370 6:166535806-166535828 GCAGGGCCATGGGTGGTGCTTGG - Intronic
1018847271 6:167564520-167564542 CCATGTGCACTGGTGGTTCCGGG + Intergenic
1019727716 7:2612215-2612237 CCATGTCCTCTGGTGCAGCTGGG + Exonic
1021989252 7:26126161-26126183 GCATGGCTACTGGTATTGCTTGG + Intergenic
1022271494 7:28812102-28812124 AAATGTCCCCTGGTGGTGGTTGG + Intronic
1024242068 7:47443300-47443322 GCATGGCCACTGCCCGTGCTGGG + Intronic
1026760369 7:73121932-73121954 GCCTCCCCACTGGGGGTGCTGGG - Intergenic
1027036711 7:74930753-74930775 GCCTCCCCACTGGGGGTGCTGGG - Intergenic
1027086852 7:75270706-75270728 GCCTCCCCACTGGGGGTGCTGGG + Intergenic
1029111560 7:98215234-98215256 GCTTCTCCACTGGTGGGGATGGG - Exonic
1029393152 7:100288704-100288726 GCCTCCCCACTGGGGGTGCTGGG + Intergenic
1029595677 7:101536409-101536431 GCATGGCCTCTGGTGCCGCTGGG - Intronic
1031672174 7:124563292-124563314 GCATCTCCTCTGTTGTTGCTTGG - Intergenic
1032855727 7:135832223-135832245 GCATCTCCAGTGGTGGAGATAGG + Intergenic
1037644818 8:20783662-20783684 GCAGGTGCATAGGTGGTGCTTGG - Intergenic
1186422931 X:9440653-9440675 ACTTGTCAACTGGTTGTGCTGGG + Intergenic
1193049965 X:77089358-77089380 GCATTTCCAATGGAGGTACTGGG + Intergenic
1198150631 X:133905059-133905081 ACATGTAAACTGTTGGTGCTTGG - Intronic
1199411903 X:147534033-147534055 ACCTGTCTACTGGTGGAGCTTGG + Intergenic