ID: 1172568974

View in Genome Browser
Species Human (GRCh38)
Location 20:35954218-35954240
Sequence GGCGGTGCCACCGGAGAAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172568974_1172568978 -7 Left 1172568974 20:35954218-35954240 CCAGTTTCTCCGGTGGCACCGCC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1172568978 20:35954234-35954256 CACCGCCGCGGGACTCCCAGTGG 0: 1
1: 0
2: 0
3: 4
4: 107
1172568974_1172568981 6 Left 1172568974 20:35954218-35954240 CCAGTTTCTCCGGTGGCACCGCC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1172568981 20:35954247-35954269 CTCCCAGTGGCCGCCAAGATCGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172568974 Original CRISPR GGCGGTGCCACCGGAGAAAC TGG (reversed) Exonic