ID: 1172570708

View in Genome Browser
Species Human (GRCh38)
Location 20:35968166-35968188
Sequence GGGCAGGCTAATGCAAATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 1, 2: 8, 3: 23, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172570702_1172570708 4 Left 1172570702 20:35968139-35968161 CCCACTTTCAATCACATGCAAAT 0: 2
1: 30
2: 127
3: 232
4: 514
Right 1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG 0: 1
1: 1
2: 8
3: 23
4: 132
1172570701_1172570708 8 Left 1172570701 20:35968135-35968157 CCTACCCACTTTCAATCACATGC 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG 0: 1
1: 1
2: 8
3: 23
4: 132
1172570703_1172570708 3 Left 1172570703 20:35968140-35968162 CCACTTTCAATCACATGCAAATT 0: 3
1: 29
2: 108
3: 256
4: 526
Right 1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG 0: 1
1: 1
2: 8
3: 23
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172570708 Original CRISPR GGGCAGGCTAATGCAAATTA AGG Intronic
901074921 1:6548074-6548096 GGCCACGCCAATGCAAATTTTGG - Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905093029 1:35444982-35445004 GGGCAGGCTACTAAAAATTAAGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906499874 1:46333820-46333842 AAGCAGGCTAATGCAAATTGAGG - Intergenic
908217606 1:61970397-61970419 GTGAATTCTAATGCAAATTATGG - Intronic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
913455561 1:119027002-119027024 GGGGAGGCTACTGCAAACTCAGG + Intergenic
914719899 1:150281394-150281416 GGGCAGCCCAATTCTAATTAGGG - Intergenic
915096898 1:153469526-153469548 GGGCAGGCTAATGGAGAGGAAGG - Intergenic
918423130 1:184384245-184384267 GGAGAGGCTAATGTAAATGAAGG - Intergenic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
923995896 1:239494090-239494112 AGGCAGGTTAATTCAAATTGAGG + Intronic
924813423 1:247422899-247422921 GGGCAGGCAAAAGCAAACGAGGG + Intronic
1062778517 10:177814-177836 AGGGAGGCTATTGTAAATTAAGG - Intronic
1063478600 10:6350418-6350440 CTACAGGCTCATGCAAATTAAGG + Intergenic
1063610235 10:7555510-7555532 GGGAAGGCAAAAGCAATTTAAGG - Intergenic
1063966825 10:11352513-11352535 GGCCAGGTTAATGCAAACTGAGG + Intergenic
1064800469 10:19064954-19064976 GAGCAGATTAATGCAAATTGAGG + Intronic
1065228869 10:23576185-23576207 GGGAATGCTAATGAAAATTTTGG - Intergenic
1068868042 10:61915686-61915708 CGGCAAGCTAAGGCAAACTAAGG + Intronic
1071910138 10:90222289-90222311 GTGCACTCTAATGTAAATTATGG - Intergenic
1077466309 11:2735315-2735337 GGACAGGCTAATGGCAATTGAGG + Intronic
1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG + Intronic
1078940566 11:16000425-16000447 AGGTAGGCAAATGCAAAATATGG + Intronic
1079633644 11:22709035-22709057 GTGCAGGCTAATACAAACCATGG + Intronic
1080313322 11:30920179-30920201 GGGCATGGGAATGCAAATGAGGG + Intronic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1080584938 11:33673304-33673326 GGTCAGACTTTTGCAAATTATGG + Exonic
1087729983 11:101767895-101767917 GGGCACGCTGATGCAAGATATGG + Intronic
1088706332 11:112467652-112467674 ATTCAAGCTAATGCAAATTATGG - Intergenic
1090159931 11:124481997-124482019 CGGGAGGTTAATGGAAATTAAGG + Intergenic
1092653260 12:10656982-10657004 GGGATGGCTAATGGAAGTTATGG + Intronic
1093051692 12:14511830-14511852 GGGGAGGCTACTGCAGATCAAGG - Intronic
1099940426 12:89181352-89181374 GTGAACCCTAATGCAAATTATGG + Intergenic
1100060208 12:90566074-90566096 GGGCATGCTGATGCAAAATGTGG + Intergenic
1101987073 12:109455719-109455741 GGGCAGGCAAATTCAATTAAGGG + Intronic
1102482745 12:113234999-113235021 GAGCAGACTACTTCAAATTAAGG + Intronic
1102817764 12:115881812-115881834 TGGCAGCCTGATGCAAATTTTGG - Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1104395007 12:128425138-128425160 GGCCTGGCTAATGGAGATTATGG - Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1108048451 13:46405723-46405745 AGGTGGGCTAATGCAAATTTAGG - Intronic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1112582487 13:100688435-100688457 GGGCAGATTAATGCACATTGGGG + Intergenic
1112966093 13:105196055-105196077 GGTCAGGCTAATACAAATTGAGG + Intergenic
1115301838 14:31893633-31893655 CTGCAGGCCAATGCAAATAAAGG - Intergenic
1115510825 14:34136424-34136446 GGGCAGGATCAGGCAAAGTAGGG + Intronic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1121513993 14:94536843-94536865 GGGCAGTTTAGTGCAAATTGAGG + Intergenic
1123128190 14:105964774-105964796 GGGCATGCTTATGCAAAGTGGGG - Intergenic
1123408713 15:20040930-20040952 GGGCATGCTTATGCAAAGTGGGG - Intergenic
1123428481 15:20193217-20193239 GGGCAGGCTAACGCTAACTTCGG + Intergenic
1123518044 15:21047640-21047662 GGGCATGCTTATGCAAAGTGGGG - Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1130216861 15:81979812-81979834 CAGCAGACAAATGCAAATTAAGG - Intergenic
1132436825 15:101812997-101813019 AGGAAGGCTAAAGCAAATTGAGG + Intronic
1134203203 16:12215856-12215878 GGGCAGCCAGATGCAAATGAGGG - Intronic
1134226259 16:12393082-12393104 GGGCAGGCTATTTGAAAATAGGG + Intronic
1135051518 16:19196747-19196769 GAGCATCCTAATGTAAATTATGG - Intronic
1136855837 16:33656545-33656567 GGGCAGGCTAACGCTAACTTTGG - Intergenic
1137238633 16:46636181-46636203 GTGAACCCTAATGCAAATTATGG + Intergenic
1137577825 16:49615257-49615279 CGGCAGGCAAATGCAAATTTCGG + Intronic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1203117422 16_KI270728v1_random:1505024-1505046 GGGCAGGCTAACGCTAACTTTGG - Intergenic
1145747435 17:27330848-27330870 GGGCAGGACAATTCAAAGTAGGG + Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1151321402 17:73354722-73354744 GGGCAGGCTAGGGGAAGTTAAGG - Intronic
1152648402 17:81481010-81481032 GGGGAGACTAATGGAAACTAGGG + Intergenic
1156732571 18:40212158-40212180 AGGCAAGATAATGCAAATGAAGG - Intergenic
1157163444 18:45336369-45336391 TGGCAGGCTGATGTTAATTAGGG - Intronic
1159184449 18:64950445-64950467 GTGTAGGTTAATGCCAATTAAGG + Intergenic
1165134738 19:33660703-33660725 AGGCAGGTTAATGCAAATCAAGG - Intronic
928731529 2:34237944-34237966 GGTCAGGCTAATGCAACAGATGG - Intergenic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
931061731 2:58536984-58537006 GGACATGCTACTGCAAAATATGG - Intergenic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
933070960 2:77857475-77857497 GGGCAAGCTAATGCAAGAGATGG - Intergenic
935120316 2:100178395-100178417 GGGTGGGCCAATGCAAATCAAGG - Intergenic
937310682 2:120901179-120901201 GTGCAGACTATTGTAAATTAAGG + Intronic
940748452 2:157597212-157597234 GGGCAGGTTAATGCACATGCAGG - Intronic
941660390 2:168190573-168190595 TGGCAGGCTAATATAAACTAGGG + Intronic
942111962 2:172691430-172691452 GGGAACTCTAATGTAAATTATGG - Intergenic
943493363 2:188585165-188585187 GGGCATGCTAATGCAAGGGATGG + Intronic
948583008 2:239000690-239000712 GGGGAGGGGAATGCAAATCAGGG - Intergenic
1168909418 20:1435227-1435249 GGGCAAGCCAATGCAAACTGAGG - Intergenic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1170326043 20:15155431-15155453 GGGCAGGCTAAGGAAAGTCATGG - Intronic
1171306760 20:24113255-24113277 GGGCAGCCTAATTCAAATCGTGG + Intergenic
1171325011 20:24283460-24283482 GGGCAGGTCAATACAAATTAAGG + Intergenic
1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG + Intronic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1177254567 21:18644324-18644346 GGGAAAGCTAATGCAAGATAAGG - Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1179669015 21:42932485-42932507 GGGCAGGCTAAAGCCACCTAAGG - Intergenic
1180936674 22:19629959-19629981 TGCCATGCTAATGCAACTTAAGG - Intergenic
950779379 3:15378222-15378244 GGGCAAGCTGATGCAAATTGAGG + Intergenic
953261157 3:41340309-41340331 GGCCAAGCTAATGCAAATACAGG + Intronic
957223101 3:77410441-77410463 GGAGAGGATATTGCAAATTATGG - Intronic
959171773 3:102852819-102852841 GTACAGGTTGATGCAAATTAAGG + Intergenic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
960045142 3:113189894-113189916 GGGCAGGGGAAGGCAACTTATGG + Intergenic
960535862 3:118813689-118813711 GGGCAGGCAAATGGAAATGGGGG - Intergenic
961335609 3:126177683-126177705 GGGAATTCTAATGTAAATTATGG + Intronic
963406625 3:144872010-144872032 GGACAGTATAATGCACATTAAGG - Intergenic
965976482 3:174630008-174630030 GGGCAGGTTTATGTATATTATGG + Intronic
966902430 3:184496407-184496429 GGGCAGGCTCATGCAATTGCTGG - Intronic
970522943 4:16903735-16903757 AGGCAGGTAAATGGAAATTAGGG - Intergenic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
976453585 4:85219795-85219817 GGGCAGACTAATGCAAGAAATGG - Intergenic
980733942 4:136857931-136857953 GGGCAGGTTACTGGAAATGAGGG - Intergenic
981176803 4:141691694-141691716 GGGCAGGCTAATGCAAAGGGTGG + Intronic
983657119 4:170094162-170094184 GGGCAGGCTAATGGAATGCAGGG + Intergenic
985046738 4:185948352-185948374 GGGAGGGCTAATGTATATTAGGG - Intronic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985700465 5:1368840-1368862 GGACAGGTCAATGCAAATTAAGG - Intergenic
988936640 5:36090059-36090081 GGGTGGCCCAATGCAAATTAAGG + Intergenic
990410939 5:55540467-55540489 GACCAGGGAAATGCAAATTAAGG - Intergenic
991046008 5:62223565-62223587 GGGCAGGCTAACGCTAACTTCGG + Intergenic
993162249 5:84307249-84307271 CTGCAGGCTAATGAAAATTGGGG + Intronic
996057829 5:119000150-119000172 GGGCTGGCTAATGGAAGTTATGG - Intergenic
1001429609 5:171648721-171648743 GGGCTGGGTAATTCACATTAAGG + Intergenic
1009763496 6:68038630-68038652 GGGCAGGCTAATGCAAGGGGTGG + Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG + Intergenic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1022746620 7:33179414-33179436 GCTCAGGCTAATGCAAGTGATGG - Intronic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1026076809 7:67179167-67179189 GGGCAGGCCAATGCAAATAAAGG + Intronic
1026143058 7:67722557-67722579 GGGCAGGTTGAGGCAAATAAGGG - Intergenic
1026700053 7:72633172-72633194 GGGCAGGCCAATGCAAATAAAGG - Intronic
1028835328 7:95368368-95368390 GGGCACTTTGATGCAAATTAAGG + Intronic
1030050582 7:105533450-105533472 TGGCAGGTTATTGCAAATCAAGG + Intronic
1031559105 7:123216149-123216171 AGGCAGAGTAATGCAGATTATGG - Intergenic
1038164538 8:25072582-25072604 GAGCAGTCTAATGAAAAATAAGG + Intergenic
1038518941 8:28212627-28212649 GGGAAGGATTATACAAATTATGG + Intergenic
1041144772 8:54862383-54862405 AATCAGGGTAATGCAAATTAGGG - Intergenic
1042598583 8:70475354-70475376 GGGCAGGCTTATTCATTTTATGG + Intergenic
1056049219 9:82750647-82750669 GCCCATGCAAATGCAAATTAAGG + Intergenic
1058310618 9:103497056-103497078 GGTCAGGCCAATGCAAATCAAGG + Intergenic
1058333294 9:103792299-103792321 AGTCAGGGAAATGCAAATTAAGG - Intergenic
1059753989 9:117275323-117275345 GGGCAGACTAATACAGATTTTGG - Intronic
1186558920 X:10589776-10589798 GGGCAGGCTAAAGCCACCTAAGG + Intronic
1187293190 X:17975008-17975030 AGGAAGGCTGATGGAAATTACGG + Intergenic
1187361915 X:18636449-18636471 GGGCAGGTTAATGTCAAGTATGG - Intronic
1188609454 X:32078038-32078060 GGGCTGGCAGATGCACATTAAGG - Intronic
1190137651 X:47811893-47811915 GGGCTGGCTAATGGCAGTTATGG - Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1193054808 X:77138483-77138505 GAGGAGGGTAATGCAAGTTAAGG - Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1196256091 X:113521126-113521148 GGGCAGGAGAATGGAACTTAGGG - Intergenic
1196738243 X:118999762-118999784 GGGCAGGATAAGGGAAATGATGG - Intronic
1198660586 X:138964233-138964255 GGGAAAGCCAATGCAAATAAAGG + Intronic
1199561899 X:149172194-149172216 GGGCATGATAATGCAAATGGTGG + Intergenic