ID: 1172570712

View in Genome Browser
Species Human (GRCh38)
Location 20:35968188-35968210
Sequence GGGCAGGTTAATGCAAATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 7, 2: 14, 3: 36, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172570701_1172570712 30 Left 1172570701 20:35968135-35968157 CCTACCCACTTTCAATCACATGC 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG 0: 1
1: 7
2: 14
3: 36
4: 164
1172570703_1172570712 25 Left 1172570703 20:35968140-35968162 CCACTTTCAATCACATGCAAATT 0: 3
1: 29
2: 108
3: 256
4: 526
Right 1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG 0: 1
1: 7
2: 14
3: 36
4: 164
1172570702_1172570712 26 Left 1172570702 20:35968139-35968161 CCCACTTTCAATCACATGCAAAT 0: 2
1: 30
2: 127
3: 232
4: 514
Right 1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG 0: 1
1: 7
2: 14
3: 36
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172570712 Original CRISPR GGGCAGGTTAATGCAAATTA AGG Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905093029 1:35444982-35445004 GGGCAGGCTACTAAAAATTAAGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906244440 1:44263113-44263135 GGGAAGGTTAATGGAACTTCTGG - Intronic
906499874 1:46333820-46333842 AAGCAGGCTAATGCAAATTGAGG - Intergenic
908027391 1:59967419-59967441 GGCCATGTTAATGCAGCTTAAGG - Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
916472565 1:165138291-165138313 GGGCAGCTAAGTGCAAATCAGGG + Intergenic
920636741 1:207711584-207711606 GGGCACATCAATGCAAATTGAGG - Intronic
920941535 1:210487923-210487945 GGGATGGTGAAGGCAAATTATGG - Intronic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
923995896 1:239494090-239494112 AGGCAGGTTAATTCAAATTGAGG + Intronic
924272042 1:242343996-242344018 GGGCTGGTTATTGCAGATAAGGG - Intronic
1063966825 10:11352513-11352535 GGCCAGGTTAATGCAAACTGAGG + Intergenic
1064757353 10:18583257-18583279 GGGTAGGTAATGGCAAATTACGG - Intronic
1064800469 10:19064954-19064976 GAGCAGATTAATGCAAATTGAGG + Intronic
1065827616 10:29586210-29586232 AGGCTGGTTAATGCAATTTGAGG + Intronic
1065950257 10:30645079-30645101 AGGCTGGTTAATGCAATTTGAGG - Intergenic
1066712627 10:38252134-38252156 GGGCTGGTTATTGCAGATAAGGG + Intergenic
1068917125 10:62444563-62444585 GGGCAGGTTAAGGAAAAGTTAGG - Intronic
1073221843 10:101881067-101881089 GAGTAGGTTAAAGAAAATTAAGG - Intronic
1073281153 10:102355108-102355130 AGGCAGGTATATGCAGATTAGGG - Intronic
1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG + Intronic
1080313322 11:30920179-30920201 GGGCATGGGAATGCAAATGAGGG + Intronic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1080956076 11:37097497-37097519 GGGCTGATTAATGCATATTCTGG + Intergenic
1081368269 11:42264065-42264087 AGGCAGATTAATGCCAATTGTGG - Intergenic
1090109052 11:123885160-123885182 GGTGAGATTAATGCAAGTTAAGG + Intronic
1090159931 11:124481997-124482019 CGGGAGGTTAATGGAAATTAAGG + Intergenic
1092984494 12:13832678-13832700 GGGCTGGTTAAATTAAATTATGG - Intronic
1093125627 12:15324534-15324556 TTGCAGGTAAATGTAAATTATGG + Intronic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1098756503 12:74370295-74370317 GGGCTCGTTAATGCAAAGTTGGG + Intergenic
1099370949 12:81829212-81829234 GAGCAGGTTAATCTTAATTAAGG - Intergenic
1103772293 12:123337430-123337452 CTACAGGTTAAGGCAAATTAAGG + Intronic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1107095828 13:36534044-36534066 GGGCAGGTTGCTGCAGATTGTGG + Intergenic
1107356268 13:39570968-39570990 GGTTAGATTAATGGAAATTAAGG - Intronic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1109256963 13:60095430-60095452 GGGTGGGTCAATGTAAATTAAGG + Intronic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1111508886 13:89233754-89233776 GGACAGGTGAAGGCAAATTCTGG - Intergenic
1111657548 13:91173026-91173048 GGAAAAGTGAATGCAAATTAAGG + Intergenic
1111663843 13:91243233-91243255 GGGTAGGTTGATACAAATTGAGG + Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112582487 13:100688435-100688457 GGGCAGATTAATGCACATTGGGG + Intergenic
1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1112966093 13:105196055-105196077 GGTCAGGCTAATACAAATTGAGG + Intergenic
1114948929 14:27722415-27722437 GTGAAGCTTAAAGCAAATTATGG + Intergenic
1115452302 14:33561796-33561818 AAGCAGGTAAATGCTAATTAGGG + Intronic
1115510825 14:34136424-34136446 GGGCAGGATCAGGCAAAGTAGGG + Intronic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1116331820 14:43606145-43606167 GTGCATGTAAATGCAAATCATGG - Intergenic
1120539878 14:85738331-85738353 GGGTAGGTAAAGGAAAATTACGG + Intergenic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1121513993 14:94536843-94536865 GGGCAGTTTAGTGCAAATTGAGG + Intergenic
1123835205 15:24182977-24182999 GGGCAAGTCAAGGCAAATTGAGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1124822337 15:33058737-33058759 ATGCAGGTTATTACAAATTACGG - Intronic
1126942386 15:53780869-53780891 GGGCACGTTAATGCAAAAGGCGG + Intergenic
1127163110 15:56212480-56212502 GTGAAGCTTAATGTAAATTATGG + Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1133475235 16:6114968-6114990 GGACAAGTTAATGCAAACTGAGG + Intronic
1133512583 16:6474053-6474075 GGGCTGGTTACTGCAAACTGTGG + Intronic
1135995288 16:27243486-27243508 GGGCAGGTTGATGTAGATTTTGG - Intronic
1136245522 16:28973794-28973816 GGGGGGGTTAAAGCCAATTATGG + Intergenic
1136928988 16:34402030-34402052 GATCAGATAAATGCAAATTAAGG - Intergenic
1136975586 16:35009774-35009796 GATCAGATAAATGCAAATTAAGG + Intergenic
1137577825 16:49615257-49615279 CGGCAGGCAAATGCAAATTTCGG + Intronic
1138721641 16:59089148-59089170 TGGTAGATTAATTCAAATTATGG - Intergenic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1140871826 16:79113644-79113666 GAGCAGTTTAGTGCAACTTATGG - Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1145285642 17:21504140-21504162 GGGCTGGTTGCTGCAGATTATGG + Intergenic
1145391882 17:22461559-22461581 GGGCTGGTTGCTGCAGATTATGG - Intergenic
1145747435 17:27330848-27330870 GGGCAGGACAATTCAAAGTAGGG + Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1148544177 17:48504292-48504314 GGCCAGGTTAGGGCCAATTAAGG + Intergenic
1152035536 17:77869956-77869978 GGGGAGCTAAATGCAAATAAGGG - Intergenic
1155284356 18:24272572-24272594 GTTCAGGTTAATGAAATTTATGG + Intronic
1155851248 18:30777286-30777308 GAGCAGGTAAATGCAAAGCAAGG + Intergenic
1156732571 18:40212158-40212180 AGGCAAGATAATGCAAATGAAGG - Intergenic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159184449 18:64950445-64950467 GTGTAGGTTAATGCCAATTAAGG + Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1164739017 19:30563172-30563194 GGGCAGGTTATTATAAATCATGG + Intronic
1165134738 19:33660703-33660725 AGGCAGGTTAATGCAAATCAAGG - Intronic
1166513337 19:43426206-43426228 GTGTGGATTAATGCAAATTAAGG - Intergenic
925082236 2:1079306-1079328 GGGCATATTACTGCATATTACGG + Intronic
927209768 2:20631914-20631936 GGGCAGGTTACTGCAGACTGTGG - Intronic
930576209 2:53152167-53152189 GAACAGGTTAATGAAAACTAGGG - Intergenic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
934771306 2:96909332-96909354 GGGCAGGTTTTGGCAAAATATGG - Intronic
935152329 2:100449310-100449332 GGGAAGGTGAAGGGAAATTAAGG - Intergenic
935444498 2:103141831-103141853 GGGCAGATTGCTGCAGATTATGG - Intergenic
935930424 2:108118115-108118137 GGGCAGGTTATTGTAGATAATGG + Intergenic
937066451 2:119021421-119021443 GGGCAAGTTGTTGCACATTAGGG + Intergenic
939699031 2:145366295-145366317 TGGCAATTTAAAGCAAATTAGGG - Intergenic
940748452 2:157597212-157597234 GGGCAGGTTAATGCACATGCAGG - Intronic
941353079 2:164459478-164459500 GGGTAGGTAAAGGAAAATTACGG - Intergenic
942216421 2:173724312-173724334 GGCCAGGTAAATGTAAATTTTGG - Intergenic
948583008 2:239000690-239000712 GGGGAGGGGAATGCAAATCAGGG - Intergenic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1171325011 20:24283460-24283482 GGGCAGGTCAATACAAATTAAGG + Intergenic
1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG + Intronic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1173308103 20:41871170-41871192 GAACAGGTCAATGCAAATTGAGG - Intergenic
1173702287 20:45083369-45083391 GGGCAGGTTACTGCAGGTTGTGG + Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
949263974 3:2135659-2135681 GGGCTGGTCAATGCAGATGAAGG + Intronic
949604589 3:5639136-5639158 GGGCAGGTTGCTGCAAGTTCTGG + Intergenic
949981456 3:9504411-9504433 GTGGAGGTATATGCAAATTATGG - Intronic
950157217 3:10730725-10730747 GGGTAGGTAAAGGAAAATTACGG - Intergenic
950779379 3:15378222-15378244 GGGCAAGCTGATGCAAATTGAGG + Intergenic
951984811 3:28607179-28607201 TGGCTGGTTAATGCTACTTAGGG + Intergenic
952521377 3:34161497-34161519 TGGCAAGTGAATGCAAATGATGG + Intergenic
956919790 3:73914922-73914944 GGGCGGGTAAATAAAAATTAAGG - Intergenic
957223101 3:77410441-77410463 GGAGAGGATATTGCAAATTATGG - Intronic
959171773 3:102852819-102852841 GTACAGGTTGATGCAAATTAAGG + Intergenic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
960045142 3:113189894-113189916 GGGCAGGGGAAGGCAACTTATGG + Intergenic
963336745 3:143984038-143984060 AGGCTGGTTAATGCAGTTTAAGG - Intronic
963406625 3:144872010-144872032 GGACAGTATAATGCACATTAAGG - Intergenic
965976482 3:174630008-174630030 GGGCAGGTTTATGTATATTATGG + Intronic
967507817 3:190272936-190272958 GGGCAGGTTGCTGCAAATCGTGG + Intergenic
969218466 4:5743014-5743036 GGGCAGTTCATTGCAAATTGAGG + Intronic
970522943 4:16903735-16903757 AGGCAGGTAAATGGAAATTAGGG - Intergenic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
976775609 4:88702926-88702948 GGGCAGGTTGCTGCAGATTGTGG - Intronic
976985155 4:91285443-91285465 GGTAAGTTTAATTCAAATTAAGG - Intronic
977059925 4:92244816-92244838 AGCCAGGTAAATGCAATTTATGG - Intergenic
978873502 4:113608939-113608961 GTTAAGGTTAATTCAAATTAAGG + Intronic
980733942 4:136857931-136857953 GGGCAGGTTACTGGAAATGAGGG - Intergenic
981176803 4:141691694-141691716 GGGCAGGCTAATGCAAAGGGTGG + Intronic
981376145 4:144018237-144018259 GGGAACATTAAGGCAAATTAAGG - Intronic
983811829 4:172072083-172072105 GGGCAGGTTGCTGCAGATTGTGG + Intronic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985700465 5:1368840-1368862 GGACAGGTCAATGCAAATTAAGG - Intergenic
985820550 5:2157288-2157310 GGGCAGGTGAATGGATATAAGGG - Intergenic
986677548 5:10200241-10200263 GGGCATATTAATGCAAGGTAGGG - Intergenic
989311324 5:40022121-40022143 AGGCATGTCAATGCAAATTTAGG + Intergenic
990410939 5:55540467-55540489 GACCAGGGAAATGCAAATTAAGG - Intergenic
994834546 5:104832508-104832530 GGGAAGGTTTATGCAAAGAAAGG - Intergenic
994990021 5:106983923-106983945 GGGTAGGTAAAGGAAAATTACGG - Intergenic
996057829 5:119000150-119000172 GGGCTGGCTAATGGAAGTTATGG - Intergenic
996870519 5:128187178-128187200 GGGCAGGTTAATCAAAAATGGGG + Exonic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
999874412 5:155786588-155786610 AGTCAGGTTAAGGCAAAATATGG + Intergenic
1000575470 5:162970198-162970220 GGGCATGTTAATGCAAGGGATGG - Intergenic
1001347082 5:170913342-170913364 GGGTGGGTGAATGCAAATGATGG + Intronic
1001429609 5:171648721-171648743 GGGCTGGGTAATTCACATTAAGG + Intergenic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1003726109 6:8766346-8766368 GGTGACTTTAATGCAAATTATGG + Intergenic
1006090548 6:31626157-31626179 GGGCAGGTAAGTGGATATTAAGG + Exonic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1007085688 6:39143122-39143144 GGGAACGTTAATTCTAATTAAGG + Intergenic
1010616605 6:78020566-78020588 GGGCAGGTTAATATGAATTGAGG - Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG + Intergenic
1012475329 6:99610207-99610229 GAGCGGATTTATGCAAATTAAGG + Intronic
1014480363 6:121928372-121928394 GGGCTGATTAATGCTAATTGTGG - Intergenic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1017779691 6:157706227-157706249 GGGTAGGTAAAGGAAAATTACGG + Intronic
1018553537 6:165026393-165026415 GGGCATGTTCATGCAAAGAATGG + Intergenic
1018623260 6:165751802-165751824 GGACAGGTGCATGCAAATTGAGG - Intronic
1020264144 7:6549211-6549233 TGGCAGGTTCCTGCAAATCAGGG + Intronic
1022084337 7:27051767-27051789 AGGAATGTTAAAGCAAATTATGG + Intergenic
1022677672 7:32514772-32514794 GGGTAGGTAAAGGAAAATTACGG - Intronic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1026076809 7:67179167-67179189 GGGCAGGCCAATGCAAATAAAGG + Intronic
1026143058 7:67722557-67722579 GGGCAGGTTGAGGCAAATAAGGG - Intergenic
1026700053 7:72633172-72633194 GGGCAGGCCAATGCAAATAAAGG - Intronic
1026901523 7:74040023-74040045 GGGCAGGTGAGTGCAAAGGAAGG + Intronic
1028035407 7:85975474-85975496 GGGCAGCTCAATGCAAAGTGAGG + Intergenic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1028835328 7:95368368-95368390 GGGCACTTTGATGCAAATTAAGG + Intronic
1030050582 7:105533450-105533472 TGGCAGGTTATTGCAAATCAAGG + Intronic
1030136028 7:106249623-106249645 GGGCAGGTTAATAAACATTTTGG + Exonic
1031559105 7:123216149-123216171 AGGCAGAGTAATGCAGATTATGG - Intergenic
1036155145 8:6334850-6334872 GGGTAGGTTGCTGCAAATAAGGG - Intergenic
1038259680 8:25981910-25981932 TGACAGTTAAATGCAAATTAAGG + Intronic
1038518941 8:28212627-28212649 GGGAAGGATTATACAAATTATGG + Intergenic
1039072016 8:33657455-33657477 GGGTAGGTATATGCAAAATAGGG - Intergenic
1041144772 8:54862383-54862405 AATCAGGGTAATGCAAATTAGGG - Intergenic
1041777243 8:61536830-61536852 GGGCAGGTTACTGCAGGTTGTGG + Intronic
1042389439 8:68216390-68216412 AGGGAGGTAAATGCAAAATAAGG + Intronic
1043043262 8:75288883-75288905 GGGCTGGTTAATGTAGATAATGG - Intergenic
1045288943 8:100815584-100815606 GGGCAGTTTAATGTAAGTTGGGG - Intergenic
1047829063 8:128612042-128612064 GGGTAGGTAAAGGAAAATTACGG + Intergenic
1048145760 8:131841447-131841469 GGGCTGGTAAGTACAAATTAGGG - Intergenic
1049345904 8:142138479-142138501 GCCCAAATTAATGCAAATTAAGG - Intergenic
1050584132 9:7092450-7092472 GGTCAGATTAATGCAAAATGAGG - Intergenic
1051011160 9:12416231-12416253 GGGCGAGTCAAAGCAAATTAAGG + Intergenic
1052245434 9:26328603-26328625 GGGGTGGTTAATTCAAATTTGGG - Intergenic
1053852240 9:42300799-42300821 GGGGAGGTACAAGCAAATTATGG + Intergenic
1056618663 9:88191445-88191467 GGGTGAATTAATGCAAATTAAGG + Intergenic
1058310618 9:103497056-103497078 GGTCAGGCCAATGCAAATCAAGG + Intergenic
1058333294 9:103792299-103792321 AGTCAGGGAAATGCAAATTAAGG - Intergenic
1187361915 X:18636449-18636471 GGGCAGGTTAATGTCAAGTATGG - Intronic
1188342793 X:29025798-29025820 TGGCAGGTTATTCTAAATTATGG + Intronic
1188970398 X:36608177-36608199 GGGCAAGTTAATGAGTATTATGG + Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1193054808 X:77138483-77138505 GAGGAGGGTAATGCAAGTTAAGG - Intergenic
1193515653 X:82459259-82459281 GGGAAGCTTGATGCTAATTAAGG + Intergenic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1194307545 X:92267156-92267178 GTTCAGGTTAATGCTAAATAAGG - Intronic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1196256091 X:113521126-113521148 GGGCAGGAGAATGGAACTTAGGG - Intergenic
1196738243 X:118999762-118999784 GGGCAGGATAAGGGAAATGATGG - Intronic
1198606160 X:138340310-138340332 GGGTAGATAAATTCAAATTAAGG - Intergenic
1199561899 X:149172194-149172216 GGGCATGATAATGCAAATGGTGG + Intergenic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic