ID: 1172570712

View in Genome Browser
Species Human (GRCh38)
Location 20:35968188-35968210
Sequence GGGCAGGTTAATGCAAATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172570701_1172570712 30 Left 1172570701 20:35968135-35968157 CCTACCCACTTTCAATCACATGC No data
Right 1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG No data
1172570703_1172570712 25 Left 1172570703 20:35968140-35968162 CCACTTTCAATCACATGCAAATT No data
Right 1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG No data
1172570702_1172570712 26 Left 1172570702 20:35968139-35968161 CCCACTTTCAATCACATGCAAAT No data
Right 1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172570712 Original CRISPR GGGCAGGTTAATGCAAATTA AGG Intronic