ID: 1172574259

View in Genome Browser
Species Human (GRCh38)
Location 20:35995161-35995183
Sequence CCCTGCTGTCAGACAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 393}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172574259 Original CRISPR CCCTGCTGTCAGACAGGCCA AGG (reversed) Intronic
900385058 1:2406718-2406740 ACCTGCGGTGAGACAGGCCGCGG + Exonic
900694270 1:4000379-4000401 CCCGGGTGTCAGACAGAGCAGGG - Intergenic
901731999 1:11286773-11286795 CCCTGCAGCAAGACAAGCCAAGG + Exonic
901923148 1:12550006-12550028 CCCTGCTGACACACACGCCCAGG - Intergenic
902531596 1:17094176-17094198 CCCTGCTTTAAGCCAGGTCAGGG + Intronic
902633673 1:17720722-17720744 CCCTGGTGTCAGACAGACTTGGG + Intergenic
902708591 1:18223286-18223308 CCTGGCTCTCAGACAGGGCAGGG - Intronic
903178710 1:21594960-21594982 CCAAGCTGTCAGGGAGGCCAAGG + Intergenic
903229540 1:21913497-21913519 ACCTGCCCTCAGACAGCCCACGG + Intronic
903461995 1:23526718-23526740 CTTTGCAGTCAGACAGGCCTGGG - Intronic
903577499 1:24347802-24347824 GGCTGCTGTCTGACAGGCCAGGG + Intronic
903687449 1:25142357-25142379 CTCTGCAATCAGACAGGCCTGGG - Intergenic
904058433 1:27687393-27687415 TGCTTCTGTCAGACTGGCCAGGG - Intergenic
904283655 1:29439267-29439289 CCCTGCTGTCATCCAGCCCAGGG + Intergenic
904504209 1:30937348-30937370 CCCTGCTGCCAAGCAGGGCATGG + Intronic
905295850 1:36953968-36953990 CCCTGCAGTCAGACTGCCCTTGG + Intronic
905891771 1:41522502-41522524 CCCTGCTGTCCTGAAGGCCAGGG - Intronic
905914218 1:41674012-41674034 CCCTGGTGTCAGAGAGGCAGGGG - Intronic
907159519 1:52360283-52360305 CCCTGCTCCAAGACAGGCCAGGG + Intronic
907243760 1:53094513-53094535 CTCTGGTGTCCCACAGGCCAGGG - Intronic
907340445 1:53731542-53731564 CTCTGCTGTCAGACAGACCTGGG + Intronic
908115225 1:60934062-60934084 CCCTGCAGTCAGAAAGACCTGGG - Intronic
908162949 1:61429384-61429406 CCTTGCTGTCAGACAGAACTGGG - Intronic
908758640 1:67491970-67491992 CCCTGCAGTCAGACAGCCCTAGG + Intergenic
909692397 1:78423450-78423472 CCCTGCTGGGAGACAGCCCAAGG - Intronic
910746847 1:90583457-90583479 CCAGGCTGTCAGACAGGAAAGGG + Intergenic
911327471 1:96485193-96485215 CTCTGCAGTCAGACAGTCCAGGG + Intergenic
912529769 1:110311923-110311945 CCATGCTGTCAGTCTGGGCAGGG - Intergenic
912616445 1:111105049-111105071 CACTGTTGTCACACAGGCTAGGG + Intergenic
912682537 1:111738583-111738605 CCCTGCTGGCAGACAAGCCCAGG + Intronic
915022701 1:152796653-152796675 CCCAGCTGTGAGACAGGGCCTGG - Intronic
915033516 1:152903890-152903912 CTTTGCTGTCAGACAGGCCTGGG - Intergenic
915455622 1:156038755-156038777 CCCAGCAGTTAGAGAGGCCAAGG - Intronic
915597813 1:156905390-156905412 CCCTGCTCTCATAGAAGCCATGG - Exonic
915945197 1:160144986-160145008 CCCTGGAGTCAGACTGGCCTAGG - Intergenic
916983725 1:170167595-170167617 CACTGCTGTCAGAGAGATCAAGG - Exonic
919986840 1:202681443-202681465 CCCTGCTGCCAGCGGGGCCATGG - Intronic
922236535 1:223726592-223726614 CCCTTCTGGCAGATAGGGCAGGG + Intronic
923254139 1:232205432-232205454 CCCAGCAGTCTGAGAGGCCAAGG - Intergenic
923965961 1:239139569-239139591 CCCTGATGTCAGTCTGGCTATGG + Intergenic
1062835960 10:635760-635782 CCCTGCAGTCAGGGAGGCGAGGG + Intronic
1062952607 10:1516063-1516085 CCCTACTGTCAATCAGACCAGGG + Intronic
1062952622 10:1516119-1516141 CCCTGCTGTGATACAGACCGGGG + Intronic
1063385078 10:5611319-5611341 CCCTGCTGTGTGCCAGGCCTGGG - Intergenic
1064155625 10:12901040-12901062 CCCTGGTGTCAGCCAGTCCTTGG - Intronic
1066016051 10:31244978-31245000 CCCTACTGTTAGAATGGCCAAGG - Intergenic
1066592596 10:37011731-37011753 CTCTGCTGACATCCAGGCCAAGG + Intergenic
1067688186 10:48480514-48480536 CCCTACTGGCAGATAGTCCAGGG - Intronic
1069722482 10:70558572-70558594 CCCCGCTGTCCAACAGACCACGG - Intronic
1069830245 10:71278608-71278630 CCCTACAGTCAGAGGGGCCAAGG - Intronic
1069844481 10:71361741-71361763 CCGCGCTGGCAGGCAGGCCAGGG + Intronic
1071733093 10:88268586-88268608 TCCTACAGGCAGACAGGCCAGGG + Intergenic
1072425202 10:95324234-95324256 CCCTGGAGTCAGGCAGGACAGGG + Intronic
1073102812 10:101015771-101015793 CCCTGCTGTCTGCCAGGTCTGGG - Intronic
1073352174 10:102827791-102827813 CCCTGGTGCCAGCCAGACCAGGG - Intergenic
1073467073 10:103700515-103700537 CCATGATGACAGACAGGCCTGGG + Intronic
1074472142 10:113737062-113737084 CCCTGGTGTCAGATAGCCCCAGG + Intergenic
1075676466 10:124299271-124299293 CTCTGGGGTCAGACAGGCTAGGG + Intergenic
1075780936 10:125016657-125016679 GACTGCTGTCCGGCAGGCCAAGG + Intronic
1076049260 10:127319733-127319755 CTCTGCTTTCAGACAGGGCACGG - Intronic
1076056964 10:127383743-127383765 CCCTGTTTTCAGCCAGGCCAGGG - Intronic
1076406905 10:130218549-130218571 CCCTCCTCTCAGCCAGGCCCTGG - Intergenic
1077202424 11:1317720-1317742 AGCAGCTGTCAGACTGGCCAGGG - Intergenic
1077331091 11:1984074-1984096 CCCGGCCCTCAGGCAGGCCAGGG - Intronic
1077748841 11:4940615-4940637 CCCTGCTGTTAGGCATCCCAAGG - Intronic
1078070078 11:8102636-8102658 CACTGCTGTCAGCCAAGTCATGG + Exonic
1080028978 11:27641139-27641161 CCTGGCTGTCAGACAGACCTGGG - Intergenic
1080552356 11:33383629-33383651 CCCTGCTCTCAGGCAGCCCGTGG + Intergenic
1082030472 11:47599884-47599906 CCCTGCTGGGAAAAAGGCCAGGG - Intergenic
1083301184 11:61740323-61740345 CCCTGCTGCCAGGCAGGCCAGGG + Intronic
1083302108 11:61744800-61744822 CCCTGCTCCAGGACAGGCCATGG + Exonic
1083484951 11:62977373-62977395 CCCTGCAGGCAGACAGGCATGGG - Exonic
1085033915 11:73288935-73288957 CCCAGCAGGCAGGCAGGCCAAGG + Intronic
1085895757 11:80637667-80637689 CTCTGCTGACATCCAGGCCAAGG - Intergenic
1086926314 11:92644138-92644160 TCCTTTTGTCAGGCAGGCCAGGG + Intronic
1086958017 11:92953891-92953913 CCATGCTGGGAGAGAGGCCATGG + Intergenic
1087534826 11:99429909-99429931 CCTAGCTGTCACACAGACCATGG + Intronic
1087789533 11:102391850-102391872 TGCTGCTGTCTGCCAGGCCAGGG - Intergenic
1089395499 11:118134135-118134157 CCCTGATGTTAGAGAGGCCTGGG - Exonic
1089540500 11:119186752-119186774 CCCTGCTGCCATACTGCCCAGGG - Intronic
1091287372 11:134415175-134415197 TCCTGCTGAAAGAGAGGCCAGGG - Intergenic
1202814072 11_KI270721v1_random:39250-39272 CCCGGCCCTCAGGCAGGCCAGGG - Intergenic
1091603977 12:1935020-1935042 CCCTGCTGGCAGCCAGGCCCGGG + Intergenic
1095485946 12:42684835-42684857 CCATGCTGTGAGAAAGCCCAAGG + Intergenic
1096609599 12:52792168-52792190 CCCAGCTGTCCAATAGGCCATGG + Intronic
1100392320 12:94154581-94154603 CCATGCTGACAGACTGTCCATGG - Intronic
1100587875 12:95996163-95996185 ACCTGCTGCCAGAAAGGCCTGGG + Exonic
1100615383 12:96227559-96227581 CCATGCTGTCAGGAAGGCCCCGG + Intronic
1100615396 12:96227601-96227623 CCATGCGGTCAGAAAGGCCCCGG + Intronic
1101534117 12:105601846-105601868 CCCTGCTGTTAGGCAGGGGAAGG - Intergenic
1101879239 12:108615047-108615069 CCCTGCTCTCACACATGCCTTGG + Intergenic
1102030989 12:109740010-109740032 CCCTGCAGCCAGACAGGCGAGGG + Intronic
1102278648 12:111601018-111601040 CCCGGCTGTGGTACAGGCCAGGG + Intergenic
1103738384 12:123075423-123075445 CCATGCTGCAAGCCAGGCCAGGG + Intronic
1104636995 12:130443994-130444016 TCCTGCTGTCACACAGACAATGG + Intronic
1104644922 12:130490471-130490493 CCCAGCTGTCAGACAATCCCGGG + Intronic
1105645453 13:22313046-22313068 CCCCACTGGCAGACAGGCCCTGG + Intergenic
1105792028 13:23811032-23811054 CCCTGGTGTCAGAAAGCCCCAGG - Intronic
1105931677 13:25058224-25058246 TCCTGCTGAGAGACTGGCCAGGG - Intergenic
1108269924 13:48749372-48749394 TACTGATGTCAGACAGGCCTGGG + Intergenic
1112442554 13:99434793-99434815 CCCTGCTGAAAGACAGCCAATGG - Intergenic
1115029121 14:28773978-28774000 CCCTGGTGTGACCCAGGCCAAGG - Intronic
1118483786 14:66195310-66195332 CCCTGCTGTAAGTCTGGCAAAGG - Intergenic
1119354356 14:73993084-73993106 CCCGGCAGTTCGACAGGCCAAGG + Intronic
1120692112 14:87604228-87604250 CCTTGGAGTCAGACAGTCCAGGG + Intergenic
1121120869 14:91375169-91375191 CCCTGCTGTGTGCCAGGCCCTGG - Intronic
1122701218 14:103590408-103590430 CCCTGCCCCCAAACAGGCCATGG - Exonic
1202924115 14_KI270724v1_random:8406-8428 GCCTGATGTCAGGAAGGCCAGGG - Intergenic
1123812778 15:23945686-23945708 CCTTGCTGTCAGGTAGGCCCTGG + Intergenic
1124008014 15:25810231-25810253 ATCTGCTGTCAGAAAGCCCAAGG + Intronic
1124680045 15:31722888-31722910 CCAGGCAATCAGACAGGCCAGGG - Intronic
1127871204 15:63075532-63075554 CCCTGCTCACAGACCGGCCCAGG + Intergenic
1128356511 15:66931218-66931240 CCCAGCTCTCTGAGAGGCCAAGG + Intergenic
1128371486 15:67042817-67042839 CCCTGCAGAGAGCCAGGCCATGG + Intergenic
1129669111 15:77597336-77597358 CCCTGGAGTGAGACAGACCAGGG + Intergenic
1129825317 15:78631031-78631053 GCCTGGTGACAGCCAGGCCAGGG - Intronic
1130306548 15:82715483-82715505 TGCTGCTGTCAGACTGGCCTGGG - Intergenic
1130563142 15:84974372-84974394 CTTTGGTGTCAGGCAGGCCACGG + Intergenic
1131156753 15:90080412-90080434 CCCAGCTGTCCTGCAGGCCAGGG - Exonic
1132537304 16:488860-488882 CCGTGATGACAGACTGGCCATGG - Exonic
1132585288 16:703524-703546 CCCAGCTGTCAGCCAGGCTCTGG - Intronic
1133431739 16:5742925-5742947 CCCTGCTGTGATACACACCATGG - Intergenic
1133684093 16:8149398-8149420 ACCTGCTCTCAGCCAAGCCAGGG + Intergenic
1133724056 16:8521074-8521096 TGCTGGTGTCTGACAGGCCAAGG - Intergenic
1134378782 16:13704475-13704497 CGCAGGTGTCAGACAGGCCAAGG + Intergenic
1134640334 16:15824880-15824902 CCCTCCTGTCAAACAGGCGGTGG - Intronic
1136656315 16:31711395-31711417 GCCTGAGGGCAGACAGGCCAGGG - Intergenic
1137639913 16:50019891-50019913 CCCTGCAGTTTGAGAGGCCAAGG - Intergenic
1137724932 16:50650729-50650751 CCCTGCAGCCAGACACCCCAGGG - Intergenic
1138680617 16:58681282-58681304 CCCTATGGTCAGACAGGCCTGGG - Intronic
1138914979 16:61452675-61452697 CCCTGCCCTCTGACAGGCCCCGG - Intergenic
1139244865 16:65431852-65431874 CCCTTCTGTCTGGCAGGACAGGG + Intergenic
1139434538 16:66928439-66928461 CCTTCCTGGCAGCCAGGCCATGG - Intergenic
1139767892 16:69247604-69247626 CTCTGCAGTCAGACAGACCTTGG + Intronic
1140922357 16:79550982-79551004 CTCTGCTGTCTGTGAGGCCACGG - Intergenic
1141190003 16:81817735-81817757 CCCAGCTCTCTGAGAGGCCAAGG - Intronic
1141519824 16:84571346-84571368 CCCTGCTGTCTATGAGGCCATGG - Intronic
1142734085 17:1883683-1883705 CCCAGCTTTCACACAGGTCACGG - Intronic
1142780423 17:2177159-2177181 CCCTGCTCTCAGAGGGGCCATGG + Intronic
1142863841 17:2778655-2778677 CCCTGCTGTCACTCAGACCTGGG + Intronic
1143109397 17:4544936-4544958 CCCAGCGGTCAGCCAGGCCTCGG + Intronic
1143441296 17:6976398-6976420 CCCAGCTGTCTGGGAGGCCAAGG + Intronic
1143508633 17:7383462-7383484 CCCTGCCCTCGGACAGCCCACGG + Exonic
1143917050 17:10301812-10301834 CCCTGATGGCAGAGAGGGCAGGG + Intronic
1143978591 17:10848297-10848319 CCCTGCTTTCTGAAAAGCCATGG - Intergenic
1145908263 17:28528129-28528151 CCCTGATCTCAGCCAAGCCAGGG + Intronic
1146907429 17:36626820-36626842 CCCGGCAGTCAGAAAGGCCTGGG - Intergenic
1147148757 17:38500897-38500919 CTCTGCAGTCAGACAGTCCTGGG + Intronic
1147964837 17:44189028-44189050 CCCTGCCAGCAGCCAGGCCATGG + Exonic
1148772099 17:50073299-50073321 CCCTGCTGTGAGACAGCCCTGGG + Intronic
1151139169 17:71975431-71975453 CCATGATGTCAGAGAGGCGATGG + Intergenic
1151678609 17:75612743-75612765 ACCAGCTATCAGACAGCCCAGGG - Intergenic
1151698754 17:75731458-75731480 CCCTGGAGTCAGGCAGGCCTGGG + Intronic
1151827131 17:76529805-76529827 CCCAGGTCTCAGGCAGGCCAGGG + Intronic
1151941593 17:77295734-77295756 CCCTGCTGTTAGACAGGAAGAGG + Intronic
1151954186 17:77372617-77372639 CACGGCTGTCAGAGAAGCCAGGG - Intronic
1152274426 17:79347935-79347957 CCCACCTCTCAGACAGGGCAGGG - Intronic
1152960945 18:79869-79891 CCCTCTTCTCAGAGAGGCCAGGG + Intergenic
1153356729 18:4144475-4144497 CCCTGCTGGGAGACAGGGAAGGG + Intronic
1153583802 18:6601169-6601191 CACTGCTGTCAGTGAGGCCATGG - Intergenic
1153914341 18:9732546-9732568 CTCTGGTGTCAGACAAGCCTGGG - Intronic
1153956366 18:10099772-10099794 ACCTCCTGTCAGATCGGCCACGG - Intergenic
1154195134 18:12259957-12259979 CCCTGATGTCATCCTGGCCAAGG + Intronic
1154337574 18:13477803-13477825 CCCTGCTGACAGGCAGTCAAGGG + Intronic
1154451233 18:14475800-14475822 CCCTGCTGTGCCACAGTCCAGGG - Intergenic
1157356512 18:46940157-46940179 CTCTGGAGTCATACAGGCCAGGG - Intronic
1159441467 18:68485870-68485892 CCCTGATGCAAGAAAGGCCAAGG - Intergenic
1160909330 19:1467597-1467619 CACCTCTGCCAGACAGGCCATGG + Exonic
1161383678 19:3979885-3979907 CCCTGTTGTCAGAGTGGCCGTGG - Exonic
1161476083 19:4486273-4486295 CCCTGCTGTCAGGGAGCTCATGG - Intronic
1161482302 19:4517174-4517196 CCCTGGGGTCACACAGCCCAGGG - Intronic
1161575031 19:5050427-5050449 CCCTTCTGTCACCCAGGCCGGGG + Intronic
1161977652 19:7615353-7615375 CCGCGGTGGCAGACAGGCCAAGG - Intronic
1162031612 19:7919976-7919998 CTCTGGGGTCAGACAGGCCTGGG - Intergenic
1162338075 19:10073832-10073854 GCAGGCTGTCAGACAGGGCAGGG + Intergenic
1162851657 19:13435734-13435756 CCCTGCAGTCAGACAGTCATGGG - Intronic
1162857827 19:13482620-13482642 CCCTGCAGTCAGATGGACCATGG + Intronic
1163195699 19:15718015-15718037 CCCTGCAGCCACAGAGGCCAAGG - Intergenic
1163225181 19:15955596-15955618 CCCTTCTCTCAGACAGCGCAAGG - Intergenic
1164434516 19:28218072-28218094 CCCAGCAGTTAGAGAGGCCAAGG + Intergenic
1165065562 19:33226091-33226113 CCCTGCTCTCAGGGAGGCCGAGG + Intergenic
1165725513 19:38110100-38110122 CCCTGCTCACACACAGCCCAAGG - Intronic
1166074953 19:40408564-40408586 CTCTGCTGCCAGACAGGCCTCGG - Intronic
1166978623 19:46619957-46619979 CCCTGCCCTCAGAGAGGCCCAGG - Intergenic
1167792358 19:51690047-51690069 CTGGGCTGCCAGACAGGCCAGGG + Intergenic
925273005 2:2627973-2627995 CCCTGCTCTCTGACAGACCCTGG + Intergenic
925753297 2:7109358-7109380 CCCTGCTTTCACACAGACCACGG + Intergenic
925836019 2:7947709-7947731 CCCTGGAGTCACACAGGCCAGGG + Intergenic
926156073 2:10454650-10454672 CCCTGCTGTCAGCCAGGATTTGG - Intergenic
927547901 2:23970977-23970999 ACCTGGTTTCTGACAGGCCATGG + Intronic
927731279 2:25474195-25474217 CCAGGCTGTCAGACAGGCTCTGG + Intronic
928459552 2:31457863-31457885 CCCTGCTGTGAGTCTGGCAAAGG - Intergenic
929594555 2:43168166-43168188 CCCTGGTGTCAGACAGGACCTGG + Intergenic
929790071 2:45015685-45015707 CTTTGGTGTCAGACAGGCCTGGG + Intergenic
930339775 2:50097887-50097909 CCCAGCAGTCTGAGAGGCCAAGG - Intronic
932571511 2:72940837-72940859 CCCTTCTCTCACTCAGGCCACGG - Intergenic
932771737 2:74504185-74504207 CCGTGGAGTCAGACCGGCCAGGG + Intergenic
933849019 2:86350437-86350459 CACTGCTTGCAGAGAGGCCAGGG - Intergenic
934519708 2:95012296-95012318 CCCTGCTGCCAGAGTGGCCCAGG + Intergenic
934579869 2:95429329-95429351 CCCTGTTGACACTCAGGCCAAGG - Intergenic
934599578 2:95647396-95647418 CCCTGTTGACACTCAGGCCAAGG + Intergenic
936339132 2:111616008-111616030 CCCTGCTGTCATTCAAGGCATGG - Intergenic
936532914 2:113289404-113289426 CCCTGTTGACACTCAGGCCAAGG + Intergenic
937235617 2:120430361-120430383 CTCTGGAGTCAGACAGACCAAGG - Intergenic
937354219 2:121187909-121187931 CCCTGCAGTCATAAAGGCCCTGG - Intergenic
937629659 2:124086451-124086473 CCCAGCAGTTAGAGAGGCCAAGG - Intronic
938597724 2:132805304-132805326 CTCTGCAGTCAGACTGTCCAGGG - Intronic
944060006 2:195562678-195562700 CCCTGCTTTCAGAGAGATCAGGG + Intergenic
944541800 2:200761188-200761210 CCCTGCTTTCAGAAAGGCAAAGG + Intergenic
945000328 2:205343680-205343702 CACAGCTGTGAGCCAGGCCAGGG - Intronic
945073181 2:206011617-206011639 CCCGGCTGTCAGGCAGAACATGG - Intronic
947745751 2:232506523-232506545 CCCTGCGCTCACACAGGGCAAGG + Intergenic
948286787 2:236792396-236792418 ACCTGCTATCACACAGGGCAGGG + Intergenic
948825967 2:240573590-240573612 CCCTGCTGTGGGAAGGGCCAGGG + Intronic
1168790204 20:571138-571160 CCCTGCTGTCTGGAAGGCTAAGG - Intergenic
1168906299 20:1406542-1406564 CCTTGCTGTCAGAGTGGCCCAGG - Intergenic
1170146534 20:13181192-13181214 CCCTGGTGGCAAAGAGGCCAAGG - Intergenic
1170569444 20:17624725-17624747 AGCTGGTGTCAGACAGGACAGGG + Intronic
1171292392 20:23989778-23989800 CCCTGCTGCCATGCAGGCGAGGG + Intergenic
1171292591 20:23990705-23990727 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
1171455710 20:25271009-25271031 CCCTGCTGTCAGAACAGCCTGGG + Intronic
1172227379 20:33314321-33314343 CTCTGCAGCCAGACAGGCCTGGG - Intergenic
1172245999 20:33445264-33445286 CACTGGTGTCAAACAGGCCTGGG - Intergenic
1172271581 20:33658414-33658436 CCCTGGAGTGAGTCAGGCCAGGG - Intronic
1172450426 20:35018812-35018834 CTCTGCAGTCAGACAGCCCTGGG + Intronic
1172574259 20:35995161-35995183 CCCTGCTGTCAGACAGGCCAAGG - Intronic
1172657771 20:36547530-36547552 CTTTGCTGTCAGACAGGCCTGGG - Intronic
1174717044 20:52770679-52770701 GGCTGGTGTCAGAGAGGCCAGGG + Intergenic
1174860472 20:54086502-54086524 CCCTGGAATCAGACAGGCCTGGG + Intergenic
1175913772 20:62416347-62416369 CCCTGCTGCCTGCCAGGCCCTGG - Intronic
1175988919 20:62777942-62777964 CCATGCCATCAGACAGGCCGGGG - Intergenic
1176277136 20:64278862-64278884 CCCTCTTCTCAGAGAGGCCAGGG - Intronic
1176298387 21:5086518-5086540 CCCTGCAGACAGCCAGGCCTCGG + Intergenic
1176390194 21:6159239-6159261 CCTGACTGTCAGGCAGGCCAAGG + Intergenic
1176444909 21:6814435-6814457 CCCTGCTGTGCCACAGTCCAGGG + Intergenic
1176823074 21:13679468-13679490 CCCTGCTGTGCCACAGTCCAGGG + Intergenic
1176910938 21:14564525-14564547 CAGTGGTGTCAGACAGGCCTGGG - Intronic
1178424692 21:32470049-32470071 CCCAGCTGTGAAACAGCCCAAGG + Intronic
1178557061 21:33601373-33601395 CTTTACTGTCAGACAGGCCTGGG + Intronic
1179733272 21:43379001-43379023 CCTGACTGTCAGGCAGGCCAAGG - Intergenic
1179858639 21:44175431-44175453 CCCTGCAGACAGCCAGGCCTCGG - Intergenic
1179909379 21:44439835-44439857 CCCTGCTGCCTGGGAGGCCAAGG - Intronic
1180823459 22:18847539-18847561 CCCTGCTGCCACGCAGGCGAGGG + Exonic
1180823659 22:18848469-18848491 CCCTGCTGCCACGCAGGCGAGGG + Intronic
1180835850 22:18929009-18929031 CCCTCCTGTCACAAGGGCCATGG - Intronic
1180944157 22:19680523-19680545 CTGTGGTGTCAGAGAGGCCAAGG + Intergenic
1180955442 22:19739302-19739324 CCCTGCTGGCAGACAGTCGGGGG - Intergenic
1180996880 22:19970263-19970285 CCCTGCAGGCAGGCAGACCACGG - Exonic
1181123885 22:20690638-20690660 CCCTGCTGCCACACAGGCGAGGG + Intergenic
1181124081 22:20691567-20691589 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
1181134101 22:20752127-20752149 CCCTGGGGTAAGACAGGCCATGG + Intronic
1181189080 22:21126077-21126099 CCCTGCTGCCACGCAGGCGAGGG - Exonic
1181189283 22:21127007-21127029 CCCTGCTGCCACGCAGGCGAGGG - Exonic
1181209915 22:21283488-21283510 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
1181210120 22:21284418-21284440 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
1181399404 22:22642527-22642549 CCCTGCTGCCACGCAGGCGAGGG - Intergenic
1181399600 22:22643456-22643478 CCCTGCTGCCATGCAGGCGAGGG - Intergenic
1181649816 22:24252612-24252634 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
1181650013 22:24253541-24253563 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
1181707362 22:24657205-24657227 CCCTGCTGCCACGCAGGCGAGGG - Intergenic
1181707558 22:24658134-24658156 CCCTGCTGCCACGCAGGCGAGGG - Intergenic
1182988234 22:34741589-34741611 CTCTGCAGACAGACAGGCCTGGG - Intergenic
1183950236 22:41348650-41348672 GCCTGCAGTCAGACAGACCTGGG + Intronic
1184310039 22:43635291-43635313 CCCTGCTGTGAGCCAGCACAGGG - Intronic
1184644459 22:45888695-45888717 CCCTGCTGTGAGAGCGCCCAGGG - Intergenic
1185281117 22:49970316-49970338 TCCTGCTGTGAGACAGGACTGGG + Intergenic
1203216828 22_KI270731v1_random:11015-11037 CCCTGCTGCCACGCAGGCGAGGG - Intergenic
1203217031 22_KI270731v1_random:11945-11967 CCCTGCTGCCACGCAGGCGAGGG - Intergenic
1203273600 22_KI270734v1_random:73445-73467 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
1203273801 22_KI270734v1_random:74375-74397 CCCTGCTGCCACGCAGGCAAGGG + Intergenic
1203285941 22_KI270734v1_random:154308-154330 CCCTCCTGTCACAAGGGCCATGG - Intergenic
950128820 3:10527895-10527917 CCCTGCTGGCAGCCAGGCCTCGG - Intronic
952150460 3:30583755-30583777 CCATGCTTTCTCACAGGCCAGGG - Intergenic
953004657 3:38967143-38967165 CCCTATTGTCAGAGATGCCATGG + Intergenic
954839416 3:53497255-53497277 CGATGCTGCTAGACAGGCCAAGG + Exonic
955045636 3:55357362-55357384 TCCTGCTGTGTGGCAGGCCATGG - Intergenic
955397539 3:58567597-58567619 CTCTGCAGTCAAACAGGCCTGGG - Intronic
955779119 3:62464468-62464490 ACCTGCTGTCAGAAATGGCAGGG + Intronic
956891912 3:73622253-73622275 TGCAGCTGACAGACAGGCCAGGG + Intronic
957837347 3:85613826-85613848 CTCTGAAGTCTGACAGGCCAGGG + Intronic
961357674 3:126349330-126349352 CCCTGCTGCCAGCCATGCCCCGG - Intronic
961723185 3:128909275-128909297 CCGGGCTGTGAGACAGGACAGGG + Intronic
961988904 3:131166750-131166772 ACCTGCTGACTGAAAGGCCATGG + Intronic
963432319 3:145224242-145224264 CCCAGCTCTCTGACAGGCCCTGG + Intergenic
964946348 3:162230622-162230644 CCTTGCTGTAAGACAGGAGAAGG + Intergenic
965310031 3:167116202-167116224 CACTCCTGACAGCCAGGCCAGGG - Intergenic
966390456 3:179447647-179447669 TCCTGCAGTCATCCAGGCCAGGG + Intronic
967862120 3:194160199-194160221 CACTCCTGTGAGCCAGGCCAGGG - Intergenic
968080886 3:195846305-195846327 CCCTGCTCCCTCACAGGCCAGGG - Intergenic
968680951 4:1919131-1919153 CTCTGCTGTCACCCAGGCTACGG - Intronic
969354754 4:6618897-6618919 ACCTGCTCTCAGGCAGGCCAGGG - Intronic
969538552 4:7771679-7771701 CTCTGGGGTCACACAGGCCAGGG - Intronic
969633873 4:8353948-8353970 CCCTGCTGGCCGGCAGCCCAGGG + Intergenic
969708858 4:8831351-8831373 TCCTGCTGTCAGAGAGCACATGG - Intergenic
970085468 4:12341147-12341169 CACCTCTGTTAGACAGGCCATGG - Intergenic
971153925 4:24062625-24062647 CCCTGGTGCCACACAGCCCATGG + Intergenic
971478141 4:27091148-27091170 CCCTGAGGTCAGAGAGGCCCCGG - Intergenic
972285233 4:37642011-37642033 CCCTGGAGTCAGACAGACCAGGG - Intronic
972408687 4:38770013-38770035 CCCTTCTGCCAGACAGACCATGG + Intergenic
976609373 4:87013876-87013898 CTCTGCTGTCTGTAAGGCCAGGG + Intronic
978825958 4:113023708-113023730 CCCCGCTGTCATACAGCCTATGG - Intronic
979784403 4:124697584-124697606 CCATGCTGTCACATAGCCCAAGG + Intronic
979853662 4:125605323-125605345 TCATGTTGTCTGACAGGCCAAGG + Intergenic
981011809 4:139933028-139933050 CACAGCAGACAGACAGGCCAAGG + Intronic
981582978 4:146269290-146269312 CAATGCTGTCAGACAGGTGAGGG - Intronic
982173304 4:152682273-152682295 TCCTGCTTTCAGACAGCCAATGG - Intergenic
982483942 4:155944813-155944835 CCATGCTGTCTCACAGTCCAAGG - Intronic
983265943 4:165507999-165508021 ACCTGATTTCAGACAAGCCAGGG - Intergenic
985433192 4:189901244-189901266 CCCCGCGGTCCTACAGGCCACGG + Intergenic
985866183 5:2516280-2516302 CCCTGCTGTCCCACAGTTCAGGG - Intergenic
986701105 5:10409508-10409530 CCCTGAAGTCAGAAAGGTCATGG + Intronic
987212372 5:15695792-15695814 CTCTGGATTCAGACAGGCCAGGG - Intronic
987708585 5:21483505-21483527 CCCTGCTGCCAAGCAGGCGAGGG - Intergenic
988406659 5:30832695-30832717 CCCTGAAGTCAGACAGACCTTGG + Intergenic
988751026 5:34190640-34190662 CCCTGCTGCCAAGCAGGCGAGGG + Intergenic
989696472 5:44207196-44207218 CACTGCGGTCAGTAAGGCCAAGG - Intergenic
990397840 5:55402367-55402389 CCCTGCTGTCAGTCCCTCCATGG + Intronic
990540354 5:56766344-56766366 CCCAGCACTCAGAGAGGCCAAGG - Intergenic
990902820 5:60771538-60771560 CTCTGATGTCAGACAGACCTGGG + Intronic
991613437 5:68471642-68471664 CCCTGCTGTCAGCCACGTCCGGG - Intergenic
991736168 5:69632564-69632586 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
991739298 5:69653852-69653874 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
991758900 5:69902579-69902601 CCCTGCTGCCACGCAGGCGAGGG - Intergenic
991788436 5:70215543-70215565 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
991790873 5:70233593-70233615 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
991812668 5:70488203-70488225 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
991815625 5:70508680-70508702 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
991818759 5:70529969-70529991 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
991838129 5:70777645-70777667 CCCTGCTGCCACGCAGGCGAGGG - Intergenic
991880883 5:71215907-71215929 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
991883320 5:71233928-71233950 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
992310362 5:75492091-75492113 CCCAGCTGTTCGAGAGGCCAAGG + Intronic
992478664 5:77128517-77128539 CTCTGGTGTCAGACAAGCCTTGG + Intergenic
993951485 5:94181630-94181652 TACTGCTGTAAGACATGCCATGG + Intronic
994420647 5:99524531-99524553 CCCTGCTGCCACGCAGGCGAGGG - Intergenic
994486394 5:100389783-100389805 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
995412068 5:111869599-111869621 CTCTACTGTCAGACAGGTCTGGG + Intronic
995629329 5:114116283-114116305 CTCTGCAGTCAGAGAGGCAAAGG + Intergenic
997574843 5:134966820-134966842 CCCAGCTACCAGAGAGGCCAAGG - Exonic
997632192 5:135377241-135377263 CCCAGCTGCCAGCCAGGCCTTGG - Intronic
998169346 5:139863496-139863518 CCCAGCTGGCAGAGAGGCCTTGG + Intronic
1000039659 5:157475875-157475897 CCCTGCTGTCAGCCAGTCTCTGG - Intronic
1000369270 5:160519421-160519443 CACAGCTGACAGACTGGCCATGG - Intergenic
1001702514 5:173717646-173717668 CCCAGCTGACAGACAAGCAAAGG + Intergenic
1001753083 5:174146385-174146407 CCCTGGAATCAGACAGGCCTAGG - Intronic
1003464573 6:6366236-6366258 CCCTGCACTCAGACACGCCTAGG - Intergenic
1005145926 6:22690098-22690120 CCCTACCCTCCGACAGGCCATGG - Intergenic
1005549174 6:26897269-26897291 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
1005622930 6:27636730-27636752 TCCTGCTGTGTAACAGGCCATGG - Intergenic
1005783004 6:29212875-29212897 CCATGGTGTCAGACAAGCCTTGG + Intergenic
1005821951 6:29605930-29605952 AGCTGCTGTCAGTCAGGCAAGGG + Intronic
1006457683 6:34141334-34141356 CCATGCTGACAGGCAGGCCGTGG - Intronic
1006467694 6:34205982-34206004 CCCTGCTGTTAGGCAGGCAAGGG - Intergenic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1009019916 6:57938379-57938401 CCCTGCTGCCACACAGGTGAGGG + Intergenic
1009279645 6:61731510-61731532 CTGTGCTGTCACTCAGGCCACGG + Intronic
1010564753 6:77396695-77396717 CCCTGCTACCTGACAGGCCCTGG + Intergenic
1012921384 6:105224060-105224082 CTGAGCTGTCAGACTGGCCAGGG + Intergenic
1013463155 6:110394804-110394826 CCATCCTGTGAGACAGGCAAGGG - Intronic
1015607159 6:134970073-134970095 CCCTGAAGTCAGACAGACCTGGG + Intronic
1015698926 6:136013181-136013203 CACTTCTCTAAGACAGGCCAAGG + Intronic
1015953717 6:138579115-138579137 ACCTCCTGTCAGACAGGCAGCGG - Intronic
1016426337 6:143939591-143939613 CCCAGCTGCCAGACAGACCTGGG - Intergenic
1016495680 6:144659359-144659381 CACTGCTGTCAGATCAGCCAGGG + Intronic
1016908564 6:149174995-149175017 CCATCCTGTCACCCAGGCCAGGG + Intergenic
1017313447 6:153001766-153001788 CGCTGGTGGCTGACAGGCCAGGG - Intronic
1017519557 6:155189884-155189906 CGCTGCAGTTGGACAGGCCATGG + Intronic
1018149911 6:160927712-160927734 CACTGCTCACAGACAGGCAAAGG - Intergenic
1019198787 6:170297146-170297168 CCCTGCAGCCAGACAGGCCCAGG - Intronic
1019276207 7:177303-177325 CCGTGATGTCAGCCAGGCCTCGG - Intergenic
1019653369 7:2172781-2172803 CCCTGCTGGCTGCCAGGTCAAGG + Intronic
1019950329 7:4367071-4367093 CCCAGCTGTCTGAGAGGCTAAGG + Intergenic
1020017960 7:4842486-4842508 CGCTGCTGGCAGAGAGGGCAGGG + Intronic
1021271263 7:18589273-18589295 CCCGGCAGTTAGAGAGGCCAAGG + Intronic
1022581151 7:31556378-31556400 CCATGCTACCACACAGGCCATGG - Intronic
1023526373 7:41107771-41107793 ACCTGCAGCCAGACAGGCCTGGG - Intergenic
1023754846 7:43407103-43407125 CCCTGCTGCCAGGGAGGGCAGGG - Intronic
1027194773 7:76022284-76022306 CCCTGGTGTCAGAGAAACCATGG + Intronic
1032439924 7:131934819-131934841 CCATGCTGTCAGGAAAGCCAGGG + Intergenic
1034245262 7:149639053-149639075 TCCTGCTGCCAGGGAGGCCAGGG - Intergenic
1035042690 7:155941865-155941887 CCCTGCTGTGCTTCAGGCCAGGG - Intergenic
1036159147 8:6370337-6370359 CCCAGCACTCTGACAGGCCAAGG + Intergenic
1037508850 8:19561575-19561597 ACCTGCTGCAGGACAGGCCAAGG - Intronic
1038915691 8:32019346-32019368 CCCTGCTGTTTGGGAGGCCAAGG - Intronic
1039578402 8:38644083-38644105 CCCTGCTCTTTGAGAGGCCAAGG - Intergenic
1040987741 8:53314871-53314893 CTCTGCAGCCAGGCAGGCCAGGG + Intergenic
1041444597 8:57936769-57936791 CACTGCTGACAGACAGGAAATGG - Intergenic
1042490715 8:69394333-69394355 CCATGCTGTGAGGCAGCCCAAGG + Intergenic
1042875679 8:73438295-73438317 CCCTGCTGGGACACATGCCATGG - Intronic
1044727882 8:95207950-95207972 CCCTGCTAAGAGACAGGCCTGGG + Intergenic
1044930686 8:97248858-97248880 GCCTGCTCTGAGGCAGGCCAGGG - Intergenic
1045672536 8:104571901-104571923 CCCTGGTGTCAGAAAGGCTGGGG + Intronic
1047763262 8:127969839-127969861 CCTCTATGTCAGACAGGCCAGGG - Intergenic
1049450722 8:142660071-142660093 CCCTGCGGACAGCCAGGCCTGGG + Intronic
1053123171 9:35560891-35560913 GCCTGCTGTAAGCCAGGGCACGG + Intronic
1053350731 9:37411791-37411813 CCCTGATTTAGGACAGGCCAAGG - Intergenic
1055790829 9:79921398-79921420 CCCTGCCGCCAAACAGGCCCTGG - Intergenic
1057126390 9:92619339-92619361 CCATGATGTCACATAGGCCAAGG + Exonic
1057147574 9:92768491-92768513 CCCTGCTGTGAGAGAAGCCTAGG - Intergenic
1057260120 9:93578202-93578224 CCCTGCTGTTAGAAGGGCCTGGG + Intronic
1059413364 9:114148342-114148364 CCCAGCTGCCTGAGAGGCCAAGG - Intergenic
1059416218 9:114164020-114164042 CCCTGCTTTCCGACAAGCCTGGG + Intronic
1059485898 9:114626611-114626633 CCCTGGAGTCAGACAGCCCTGGG - Intronic
1059670098 9:116483180-116483202 CCCTGCTGTCAGACCTTCCTGGG + Intronic
1060736663 9:126070536-126070558 GCCAGCAGACAGACAGGCCAGGG - Intergenic
1061201949 9:129143127-129143149 CCCTGCTGGCAGGCAGCCGAGGG + Intronic
1061303926 9:129721982-129722004 CCCTGCTGTCAGGAAGCTCATGG + Intronic
1061752860 9:132792802-132792824 CCCTGCTGGCCGGCAGCCCATGG + Intronic
1062029508 9:134355919-134355941 CCCAGGTGTCAGACAAGCCCTGG + Intronic
1062196570 9:135277337-135277359 GCATGCTTTCAGCCAGGCCAGGG - Intergenic
1062283769 9:135763914-135763936 CTCTGCTGTCAGACACCCCAGGG - Intronic
1062331835 9:136048267-136048289 CCCTGCTGACAGCCACCCCAGGG - Intronic
1062371672 9:136242449-136242471 CCCTGGGGGCACACAGGCCATGG - Intronic
1203524288 Un_GL000213v1:70090-70112 CCCTGCTGTGCCACAGTCCAGGG - Intergenic
1185939105 X:4294364-4294386 CCCTGCTGTCATAGAGACTATGG - Intergenic
1186846452 X:13535516-13535538 CCATGCTGTGACCCAGGCCAGGG + Intergenic
1189248396 X:39581032-39581054 GCCAGCTGTCAGTCAGGGCAGGG - Intergenic
1189471327 X:41316484-41316506 CACTGCAGTCAGACCAGCCAGGG - Intergenic
1189920692 X:45900573-45900595 CCCTGCTCTTTGACAGGCCGAGG - Intergenic
1190301254 X:49058897-49058919 TCCTGGTGGCAGACAGGCAAGGG + Intronic
1191108520 X:56787736-56787758 CTCTGCTTTCACACAGGCAAGGG - Intergenic
1191821302 X:65311981-65312003 CCCTACTCCCAGACAGGCCCTGG - Intergenic
1192600189 X:72454270-72454292 CCCTGGTGGCAGACAGGAAATGG + Intronic
1193268916 X:79506752-79506774 CCCTGCTTTCCTCCAGGCCAGGG + Intergenic
1193424734 X:81328166-81328188 CCCAGCAGTTAGAAAGGCCAAGG + Intergenic
1195717835 X:107834824-107834846 CCCTGGAGTCAGACAGACCTGGG + Intronic
1196805400 X:119579656-119579678 CTCTGCAGTCAGACAGGTCTGGG - Intronic
1201722542 Y:17116395-17116417 CCCTGCTGTCATAGAGACTATGG - Intergenic