ID: 1172576753

View in Genome Browser
Species Human (GRCh38)
Location 20:36015062-36015084
Sequence GGTATGACTCAACATCTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172576750_1172576753 23 Left 1172576750 20:36015016-36015038 CCAACATTTGTCATATTTTGTCT 0: 1
1: 4
2: 80
3: 529
4: 2039
Right 1172576753 20:36015062-36015084 GGTATGACTCAACATCTCATTGG 0: 1
1: 0
2: 0
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172576753 Original CRISPR GGTATGACTCAACATCTCAT TGG Intronic
904540525 1:31229852-31229874 GGTTGGACTCATCATCTCAAAGG - Intronic
905401542 1:37707190-37707212 GGTAAGAGTCAAAATCTCTTGGG - Intronic
909319436 1:74264751-74264773 TTTATGACTAAACATCTCTTGGG + Intronic
913992051 1:143622431-143622453 GGAATGACTGTCCATCTCATTGG + Intergenic
915779026 1:158524857-158524879 GCTTTGTCACAACATCTCATGGG - Intergenic
918837001 1:189479402-189479424 GCTTTGACTCTACATTTCATGGG - Intergenic
923314542 1:232767081-232767103 GGAAAGACCCAACATCTTATTGG + Intergenic
1066066105 10:31762030-31762052 GCTCTGCCTCAACATCACATTGG - Intergenic
1066691847 10:38036705-38036727 ACTCTTACTCAACATCTCATTGG + Intronic
1067000861 10:42611969-42611991 ACTCTTACTCAACATCTCATTGG - Intronic
1071487078 10:86109448-86109470 GGCCTGCCTCAACATCTCAGTGG + Intronic
1073821429 10:107268692-107268714 CATATGACTAAACATCTAATTGG - Intergenic
1078952322 11:16148196-16148218 GGTCTAACTCAACAACTGATTGG - Intronic
1084218637 11:67664888-67664910 CGTATGACTCAGCAGCTCATGGG - Intronic
1085825179 11:79839858-79839880 AGAAAGACTCAACATCTCCTGGG - Intergenic
1090799685 11:130162464-130162486 GGTAAGACTCAGCATCCCTTAGG + Intronic
1102428926 12:112866560-112866582 GGAATGACTCAAGTTCTTATTGG + Intronic
1103018766 12:117516801-117516823 GGTATGAGTCTATTTCTCATGGG + Intronic
1110817139 13:79874572-79874594 GCTGTGACTCAACAACACATCGG - Intergenic
1114129416 14:19772681-19772703 GGCATGAGGCAATATCTCATTGG + Intronic
1115072276 14:29338369-29338391 GGTAAGACACAACATTTGATGGG + Intergenic
1123572374 15:21626909-21626931 GGCATGAGGCAATATCTCATTGG + Intergenic
1123608989 15:22069496-22069518 GGCATGAGGCAATATCTCATTGG + Intergenic
1124351780 15:28961088-28961110 GGTGTGACTCATCATCTCCCTGG - Intronic
1127338257 15:58012596-58012618 AGTATGAATAAACACCTCATTGG + Intronic
1127480767 15:59374946-59374968 AGTCTGACTCCATATCTCATAGG + Intronic
1130887322 15:88104760-88104782 GGCATTCCTAAACATCTCATTGG + Intronic
1202981230 15_KI270727v1_random:361296-361318 GGCATGAGGCAATATCTCATTGG + Intergenic
1134745387 16:16584049-16584071 GTAATAACTCAACATCTCACTGG - Intergenic
1134762953 16:16730236-16730258 GGACTGACTCAGCATCTCACGGG - Intergenic
1134983099 16:18628913-18628935 GGACTGACTCAGCATCTCACGGG + Intergenic
1135000085 16:18769716-18769738 GTAATAACTCAACATCTCACTGG + Intergenic
1146111171 17:30090997-30091019 GGTATCACTATTCATCTCATAGG - Intronic
1151019463 17:70597966-70597988 GGTATGATCCAACATCTTATGGG - Intergenic
1159447805 18:68561507-68561529 GGGATGAAGCAATATCTCATTGG - Intergenic
1163484563 19:17578119-17578141 GTTATGACTCTAGATCTCATCGG + Intronic
1165171643 19:33896183-33896205 GGTGTGTCTCAACATCTAGTTGG + Intergenic
1168506120 19:56936549-56936571 GGTAAAACTGAACATCACATTGG - Intergenic
933133738 2:78704770-78704792 GGTTTTACTCCACATCTTATAGG + Intergenic
933849890 2:86357636-86357658 GGAAGGAATAAACATCTCATGGG - Intergenic
937678869 2:124622667-124622689 GGTGTGACACGATATCTCATTGG + Intronic
939061526 2:137428246-137428268 GGTATGAATTAGTATCTCATTGG - Intronic
942105042 2:172625164-172625186 GTTATGACTCAAAATCTCAGTGG - Intergenic
943390233 2:187257716-187257738 ACAATGACTGAACATCTCATTGG - Intergenic
943494286 2:188600544-188600566 AGTATTACTCAACATGTCAAAGG - Intergenic
945165473 2:206938414-206938436 GGTATGATTGATCATATCATTGG - Intergenic
945621150 2:212138855-212138877 GATATGATTGAACATGTCATGGG + Intronic
945930625 2:215851483-215851505 GGTATTACTGAACAGCTAATGGG + Intergenic
1170869133 20:20188475-20188497 GGTCAGACTCATCATCTCATAGG - Intronic
1172576753 20:36015062-36015084 GGTATGACTCAACATCTCATTGG + Intronic
1172807643 20:37624095-37624117 GGTAAGAATCATCATCTCCTAGG - Intergenic
1174658324 20:52190627-52190649 GTTATGACTCAGTATCTCCTAGG - Intronic
1177384436 21:20390636-20390658 GGAATGACTCAACATATAAAGGG + Intergenic
952834646 3:37592588-37592610 GGAATGACTCCACATATCAGTGG + Intronic
954982454 3:54758810-54758832 GGAAAGACTCAACAACTCAAAGG + Intronic
955751358 3:62188050-62188072 TGTTTTACTCAACAACTCATGGG - Intronic
957618505 3:82565296-82565318 TGTAGGACTCAACAATTCATGGG - Intergenic
963487750 3:145957563-145957585 GATATAACTCAACATCTCCGTGG - Intergenic
964697122 3:159521743-159521765 GATATGACTCACCAACTCAGGGG - Intronic
969185406 4:5470712-5470734 GTCATGAATCAACTTCTCATAGG - Intronic
970922339 4:21409809-21409831 GATATGAGTCAACTTTTCATGGG + Intronic
972153341 4:36123991-36124013 AGTTTGTCTCAACATCTCACAGG + Intronic
975825204 4:78312431-78312453 AGTATGTCTCAATATCTGATTGG + Intronic
976922342 4:90455682-90455704 GGTATGCCTCCCCACCTCATGGG - Intronic
980475949 4:133316569-133316591 GGAATGACTACACATCTGATTGG - Intergenic
980762244 4:137250834-137250856 ACTTTGACTCACCATCTCATTGG - Intergenic
990913195 5:60874985-60875007 GGTATTTCTCAACAACTCTTTGG + Intronic
992567396 5:78012113-78012135 GGAATCATTCAAAATCTCATAGG + Intronic
993342320 5:86739850-86739872 GGTAGGATTCAATATCTCTTAGG + Intergenic
994395487 5:99223058-99223080 GATATGACTCAAAATATCTTAGG - Intergenic
996288143 5:121819630-121819652 GGTATGCCACAACCTCACATAGG - Intergenic
996598831 5:125237321-125237343 GGCTTGACTCAGCATCTCAATGG - Intergenic
1002179623 5:177424313-177424335 GGTCTGCCTCCACATCTCATAGG + Intronic
1008256390 6:49305967-49305989 GCTATGACTAAACATTTCAGGGG + Intergenic
1012371538 6:98513341-98513363 GGTATGATTGATCTTCTCATCGG - Intergenic
1013419043 6:109949587-109949609 GCTATGACTCCTCATCTGATAGG - Intergenic
1017621698 6:156306224-156306246 GGTACGAGTCACCATCTCCTTGG + Intergenic
1020887413 7:13835359-13835381 GGGTTGACTCAACAGCTCAAGGG + Intergenic
1029137996 7:98388642-98388664 GGTATGTCTCATCATAGCATGGG - Intronic
1035369142 7:158367777-158367799 GGAATGACTGAGCATCTGATGGG - Intronic
1039415435 8:37389967-37389989 AGTATGACCGAACATCTCTTGGG + Intergenic
1047002693 8:120588757-120588779 GGTATTTCTCAAAATTTCATTGG + Intronic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1049785444 8:144448553-144448575 GCTATGGCTCTACATCTCTTTGG - Intergenic
1054727194 9:68664521-68664543 GGTATGACTCACTGACTCATGGG + Intergenic
1057639793 9:96807851-96807873 GGTGTGAGGCAATATCTCATTGG - Intergenic
1062535452 9:137019237-137019259 GGTCTGGCTCAACATCTCGGCGG - Exonic