ID: 1172576753

View in Genome Browser
Species Human (GRCh38)
Location 20:36015062-36015084
Sequence GGTATGACTCAACATCTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172576750_1172576753 23 Left 1172576750 20:36015016-36015038 CCAACATTTGTCATATTTTGTCT No data
Right 1172576753 20:36015062-36015084 GGTATGACTCAACATCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172576753 Original CRISPR GGTATGACTCAACATCTCAT TGG Intronic