ID: 1172578925

View in Genome Browser
Species Human (GRCh38)
Location 20:36031393-36031415
Sequence CAGCTACTCACTCCTCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172578925_1172578930 3 Left 1172578925 20:36031393-36031415 CCAGGATGAGGAGTGAGTAGCTG No data
Right 1172578930 20:36031419-36031441 TAGAGGAGGTGGAGACAAGGAGG No data
1172578925_1172578929 0 Left 1172578925 20:36031393-36031415 CCAGGATGAGGAGTGAGTAGCTG No data
Right 1172578929 20:36031416-36031438 TGATAGAGGAGGTGGAGACAAGG No data
1172578925_1172578931 26 Left 1172578925 20:36031393-36031415 CCAGGATGAGGAGTGAGTAGCTG No data
Right 1172578931 20:36031442-36031464 CTGCAGAGTCTGAACGAAAGAGG No data
1172578925_1172578928 -8 Left 1172578925 20:36031393-36031415 CCAGGATGAGGAGTGAGTAGCTG No data
Right 1172578928 20:36031408-36031430 AGTAGCTGTGATAGAGGAGGTGG No data
1172578925_1172578932 27 Left 1172578925 20:36031393-36031415 CCAGGATGAGGAGTGAGTAGCTG No data
Right 1172578932 20:36031443-36031465 TGCAGAGTCTGAACGAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172578925 Original CRISPR CAGCTACTCACTCCTCATCC TGG (reversed) Intergenic
No off target data available for this crispr