ID: 1172583169

View in Genome Browser
Species Human (GRCh38)
Location 20:36064532-36064554
Sequence CAGAGTCCCCGCTACGGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172583169_1172583181 30 Left 1172583169 20:36064532-36064554 CCGACCCCGTAGCGGGGACTCTG 0: 1
1: 0
2: 0
3: 6
4: 148
Right 1172583181 20:36064585-36064607 ACTGGCCGCTTCTAGAGAGTCGG No data
1172583169_1172583175 -10 Left 1172583169 20:36064532-36064554 CCGACCCCGTAGCGGGGACTCTG 0: 1
1: 0
2: 0
3: 6
4: 148
Right 1172583175 20:36064545-36064567 GGGGACTCTGCTGCTGTGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 229
1172583169_1172583176 -5 Left 1172583169 20:36064532-36064554 CCGACCCCGTAGCGGGGACTCTG 0: 1
1: 0
2: 0
3: 6
4: 148
Right 1172583176 20:36064550-36064572 CTCTGCTGCTGTGCGGGGCGCGG 0: 1
1: 0
2: 6
3: 14
4: 274
1172583169_1172583177 12 Left 1172583169 20:36064532-36064554 CCGACCCCGTAGCGGGGACTCTG 0: 1
1: 0
2: 0
3: 6
4: 148
Right 1172583177 20:36064567-36064589 GCGCGGTTCGCCGAACCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172583169 Original CRISPR CAGAGTCCCCGCTACGGGGT CGG (reversed) Intergenic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
902318199 1:15639884-15639906 TATAGTCCCAGCTACGGGGGAGG + Intronic
903433893 1:23331710-23331732 CATAGTCCCAGCTACTGGGGAGG + Intronic
905411562 1:37773181-37773203 CATAGTCCCAGCTACTGGGGAGG + Intergenic
906254219 1:44335219-44335241 CATAGTCCCAGCTACTTGGTAGG + Intronic
910928061 1:92416573-92416595 CATAGTCCCAGCTACTTGGTAGG - Intergenic
911470265 1:98309557-98309579 CATAGTCCCAGCTACTGGGGAGG - Intergenic
913335524 1:117706272-117706294 CAGAGTCCCGGCTATGTGGTGGG + Intergenic
913426304 1:118734974-118734996 CAGAGGCTCCGCTACCAGGTGGG - Intergenic
917348050 1:174049396-174049418 CATAGTCCCAGCTACCGGGGAGG - Intergenic
924065711 1:240219774-240219796 TAGAGTCCCAGCTACGTGGGAGG - Intronic
1062835641 10:633827-633849 CCGGGGCCCCGCTATGGGGTAGG - Intronic
1063466066 10:6245536-6245558 TATAGTCCCAGCTACGGGGGAGG - Intergenic
1065028750 10:21564203-21564225 CATAGTCCCAGCTACGCGGAGGG - Intronic
1065825972 10:29571925-29571947 CAGAGTCCCTGCTCCTAGGTGGG - Intronic
1065951331 10:30654424-30654446 CAGAGTCCCTGCTCCTAGGTGGG + Intergenic
1067110714 10:43397484-43397506 CAGAGTGCCAGCCACGGGGAAGG + Intronic
1067366374 10:45633446-45633468 CATAGTCCCAGCTACGTGGGAGG + Intronic
1068913516 10:62404180-62404202 CAGTGTCCCCATTACAGGGTGGG - Intronic
1069844417 10:71361258-71361280 CATAGTCCCAGCTACTGGGGAGG - Intronic
1072888131 10:99298112-99298134 CAGTGTCTCTGCTACTGGGTAGG + Intergenic
1076686091 10:132199086-132199108 CTGAGTCCCTGCATCGGGGTGGG + Intronic
1077942201 11:6855127-6855149 CATAGTCCCAGCTACTGGGGAGG - Intergenic
1079511716 11:21217895-21217917 CAGAGTCACTGTTACAGGGTTGG + Intronic
1082728392 11:56765277-56765299 CAGAATGCCTGCTACGGAGTAGG - Intergenic
1083108039 11:60377387-60377409 CATAGTCCCAGCTACTGGGGAGG + Intronic
1083846576 11:65337924-65337946 CATAATCCCAGCTACGGGGGAGG - Intronic
1083954399 11:65975526-65975548 CATAGTCCCAGCTACTGGGGAGG - Intronic
1084783126 11:71424468-71424490 CATAGTCCCAGCTACTGGGGAGG - Intergenic
1085392010 11:76187027-76187049 CAGAGTCCTCGCTCCTGCGTGGG + Exonic
1094245966 12:28293848-28293870 CAGTGTCCCAGCTACTGGGAAGG - Intronic
1096056425 12:48656393-48656415 CATAGTCCCAGCTACTGGGGAGG - Intronic
1096958050 12:55546856-55546878 CAGAGTCCCCACCATGGGGCTGG - Intergenic
1098605417 12:72383496-72383518 TATAGTCCCAGCTACTGGGTAGG - Intronic
1102146869 12:110661016-110661038 CAGGGTCCCCGGCACGTGGTAGG + Intronic
1105328568 13:19393126-19393148 CACAGTCCCAGCTACTGGGGAGG + Intergenic
1108356002 13:49629139-49629161 CATAGTCCCAGCTACTGGGGAGG + Intronic
1108872160 13:55001045-55001067 CCTAGTCCCCGCCACGGGGCCGG + Intergenic
1116614649 14:47119185-47119207 TGTAGTCCCAGCTACGGGGTGGG - Intronic
1117307695 14:54492516-54492538 CATAGTCCCAGCTACTGGGGAGG + Intergenic
1121100892 14:91249465-91249487 CTGAGTCCCAGCTACTGGGGAGG - Intronic
1121396860 14:93632575-93632597 CATAGTCCCAGCTACTGGGGAGG + Intronic
1125980459 15:43995975-43995997 CAGAGGCTCCCCTACAGGGTGGG + Intronic
1128109278 15:65066746-65066768 CAGAGTCCCCTCTCTGGGGGTGG + Intronic
1130119228 15:81032666-81032688 CATAGTCCCCGCTACTTGGGAGG + Intronic
1130270672 15:82445349-82445371 CACAGTCCCCGCTACCGCCTGGG - Intergenic
1130489658 15:84422116-84422138 CACAGTCCCCGCTACCGCCTGGG + Intergenic
1130501249 15:84500878-84500900 CACAGTCCCCGCTACCGCCTGGG + Intergenic
1132521403 16:391495-391517 GATAGTCCCCGCTACTGGGGAGG + Intergenic
1132927887 16:2441110-2441132 TAGAGTCCCAGCTACGCGGGAGG + Intronic
1133946534 16:10353769-10353791 CATAGTCCCAGCTACTGGGGAGG - Intronic
1137035145 16:35563934-35563956 CAGAATCCCAGCTACTTGGTAGG - Intergenic
1137354803 16:47750823-47750845 CAGAGTCCCAGCTACTTGGGAGG + Intergenic
1137655159 16:50153219-50153241 CAGAGGCCCCGCCCCGGGGCCGG + Intronic
1141004209 16:80337050-80337072 CAGACTCCCTGTTACGGGATGGG + Intergenic
1141797597 16:86285634-86285656 CAAAGTCCCCCCTCCGGGCTGGG + Intergenic
1142323995 16:89402558-89402580 CAGAGTCCCAGCTACTCGGGAGG + Intronic
1142354327 16:89595170-89595192 CAGAGTGCCCGCCACGGAGGGGG + Intronic
1142546950 17:711086-711108 CATAGTCCCAGCTACGTGGGAGG + Intronic
1142778224 17:2158793-2158815 CATAGTCCCAGCTACTGGGGAGG + Intronic
1144660619 17:17066876-17066898 CAGAGGCCCAGCTACGTGGGAGG - Intronic
1145012730 17:19378828-19378850 CAGTGTCCCCTCTGCGGGCTGGG - Intronic
1151272723 17:73009245-73009267 TGTAGTCCCCGCTACGGGGGAGG + Intronic
1151926126 17:77198694-77198716 CTGAGTCCCAGCTACTGGGGAGG - Intronic
1152012484 17:77727015-77727037 CAGAGACCCTGCTTCTGGGTGGG - Intergenic
1152640898 17:81448796-81448818 CAGAGTCCCTGCTTCTGGGTGGG + Intronic
1155064607 18:22257632-22257654 CAGAGTGCCTGCCACAGGGTTGG - Intergenic
1158351148 18:56566021-56566043 CAGAGTCCCCCCTGAGGGGCAGG + Intergenic
1160368281 18:78348604-78348626 CAGAGTCCCAGCTACTCGGGAGG - Intergenic
1161219098 19:3109800-3109822 CACAGTCCCAGCTGCGGGGCCGG + Intronic
1165200294 19:34138091-34138113 CATAGTCCCAGCTACTGGGGAGG + Intergenic
1165227298 19:34364143-34364165 CAGAGTCCCAGCTACTCGGGAGG - Intronic
1165909185 19:39213927-39213949 CATAGTCCCAGCTACTGGGAAGG - Intergenic
1167847447 19:52176215-52176237 CAGAGTCCCAGCTACTTGGCAGG - Intergenic
927417424 2:22893425-22893447 CAGAGTCCCAGCTACTGGGGAGG + Intergenic
929567541 2:42999279-42999301 CAGAGTCCCACCTGCTGGGTGGG + Intergenic
931353315 2:61511878-61511900 CAGAATCCCAGCTACTCGGTAGG - Intronic
937420763 2:121753311-121753333 TATAGTCCCAGCTACTGGGTAGG + Intronic
937565118 2:123276002-123276024 CAGAGTCCTCACTATGGGATTGG + Intergenic
941634592 2:167923015-167923037 TATAGTCCCAGCTACGGGGGAGG + Intergenic
942642183 2:178072158-178072180 CACAGTCCCCGCCACCGGGAAGG + Exonic
944114224 2:196170894-196170916 CCGAGTCCCAGCTGCGGCGTGGG - Intronic
944221384 2:197308048-197308070 CATAGTCCCAGCTACTGGGGAGG + Intronic
944534732 2:200697441-200697463 CATAGTCCCAGCTACTGGGGAGG + Intergenic
1171962248 20:31503257-31503279 GACAGTCCCCGCTACGTGGCCGG - Intergenic
1172583169 20:36064532-36064554 CAGAGTCCCCGCTACGGGGTCGG - Intergenic
1173582437 20:44157129-44157151 CAGAGTCACCACTACAGTGTCGG - Intronic
1173980714 20:47221786-47221808 CTGAGTCCCAGCTACTTGGTGGG - Intronic
1174210540 20:48874753-48874775 TATAGTCCCAGCTACGGGGGAGG + Intergenic
1174510102 20:51044871-51044893 CATAGTCCCAGCTACTGGGGAGG - Intergenic
1175676779 20:60953024-60953046 CAGAGTCCCGGCCAAGGGGAGGG - Intergenic
1176221704 20:63972347-63972369 CAGAGGCACTGCTAGGGGGTTGG + Intronic
1177157718 21:17515324-17515346 CATAGTCCCAGCTACGCGGGAGG + Intronic
1177394069 21:20510755-20510777 CAGAGTCCCCACTGCGGTCTAGG - Intergenic
1178527152 21:33340478-33340500 CACAGTCCTAGCTACTGGGTAGG - Intronic
1179910769 21:44446816-44446838 CATAGTCCCAGCTACTGGGGAGG + Intergenic
1180173410 21:46073871-46073893 TAGAGTCCCAGCTACTGGGGAGG - Intergenic
1181459596 22:23078387-23078409 CTGTGTCCCAGCCACGGGGTGGG - Intronic
1181521409 22:23450616-23450638 CACAGTCCCAGCCCCGGGGTTGG - Intergenic
1182275658 22:29186986-29187008 CATAGTCCCAGCTACGTGGGAGG + Intergenic
1184125006 22:42480792-42480814 CATAGTCCCAGCTACTGGGGAGG + Intergenic
1184515072 22:44956803-44956825 CAGAGGCCCCTCCACGCGGTGGG + Intronic
950144957 3:10642362-10642384 CAGAGTCCCAGCCAGGGGCTAGG + Intronic
950222988 3:11210669-11210691 CACAGTCCCAGCTACCGGGGAGG + Intronic
953731816 3:45456459-45456481 TAGAGTCCCCGCTACTCGGGAGG + Intronic
954354546 3:50073969-50073991 CATAGTCCCAGCTACTGGGGAGG - Intronic
956203983 3:66737185-66737207 CATAGTCCCCGCTACATGGGAGG - Intergenic
960602126 3:119468982-119469004 CAGATTCCCCGCTGCGGCGCTGG - Exonic
962106577 3:132396355-132396377 CAGAGGCCCCTCTATGGGGCTGG + Intergenic
962399768 3:135048389-135048411 CATAGTCCCAGCTACTGGGGAGG - Intronic
964568655 3:158088458-158088480 CATAGTCCCAGCTACGCGGGAGG + Intergenic
969537381 4:7764982-7765004 CATAGTCCCAGCTACTCGGTAGG + Intronic
977760106 4:100723838-100723860 CATAGTCCCAGCTACTCGGTAGG + Intronic
978427975 4:108602191-108602213 CAGAGTCCCAGCTACTGGGGAGG + Intergenic
982257585 4:153466071-153466093 CAGAGTGCGCGCTGCGGGGCGGG + Intergenic
983766195 4:171488273-171488295 CATAGTCCCAGCTACTGGGGAGG - Intergenic
992312060 5:75511308-75511330 AAGAGTGCCCGCTCCGGTGTGGG + Exonic
992858447 5:80888163-80888185 CTGAGTCCCAGCTACCGGGGAGG + Intergenic
995423507 5:111993035-111993057 TATAGTCCCAGCTACGGGGTTGG - Intronic
999674020 5:153981197-153981219 TATAGTCCCAGCTACTGGGTCGG - Intergenic
1001024003 5:168207749-168207771 CAGAGGCTCAGCTCCGGGGTGGG - Intronic
1004515903 6:16322100-16322122 CATAGTCCCAGCTACTGGGGAGG + Intronic
1004962068 6:20801037-20801059 CATAGTCCCAGCTACTTGGTAGG - Intronic
1005987719 6:30884656-30884678 AAGAGGCCCCGCTCCCGGGTCGG + Intronic
1006458317 6:34144328-34144350 GGGGGTCCCCGCTCCGGGGTCGG - Intronic
1006615638 6:35324648-35324670 TAGAGTCCCAGCTACTGGGGAGG + Intergenic
1006722283 6:36164090-36164112 CATAGTCCCAGCTACTGGGGAGG - Intergenic
1007576602 6:42929242-42929264 CAGAGCCTCCGTTAGGGGGTGGG + Exonic
1007752021 6:44076597-44076619 CAGAGTCCCCGCCACGCCGCCGG - Intergenic
1014241361 6:119021556-119021578 TAGAGTCCCAGCTACTGGGAAGG + Intronic
1016019948 6:139226903-139226925 CATAGTCCCAGCTACGCGGGAGG + Intergenic
1019589921 7:1825832-1825854 CACAGTCCCAGCCCCGGGGTTGG + Intronic
1020474061 7:8574368-8574390 CAGAGTCCCAGCTACTTGGGAGG - Intronic
1021563842 7:21997207-21997229 CAGAGTCCCAGCTACTTGGGAGG - Intergenic
1021611256 7:22460192-22460214 CATAGTCCTAGCTATGGGGTAGG + Intronic
1026049538 7:66933289-66933311 CATAGTCCCAGCTACGTGGGGGG - Intronic
1027201716 7:76068180-76068202 CATAGTCCCAGCTACTGGGGAGG - Intergenic
1029451133 7:100642273-100642295 CAGAGTCCCCGCCAAGGTGTGGG + Intronic
1034540913 7:151757448-151757470 CACAGTGCCCGCTCCAGGGTGGG + Intronic
1035518236 8:255009-255031 CAGTGTCTCTGCTACGGGATAGG - Intergenic
1036553644 8:9838101-9838123 CACAGTCCCAGCTACTGGGGAGG - Intergenic
1037529660 8:19760214-19760236 CATAGTCCCAGCTACGTGGGAGG + Intergenic
1039539170 8:38348781-38348803 CTGAGTCCCAGCTACTGGGGAGG - Intronic
1039857266 8:41426299-41426321 CAGAGTCCCAGCTACTTGGGAGG + Intergenic
1046609598 8:116409251-116409273 CAGAGTCCCAGCTACTCGGGAGG + Intergenic
1048053920 8:130846200-130846222 CAGAGTCCTAGGTATGGGGTTGG + Intronic
1048301185 8:133252568-133252590 CAGAGGCCCCACTCCGGAGTTGG - Intronic
1048301194 8:133252608-133252630 CAGAGGCCCCACTCCGGAGTTGG - Intronic
1049821813 8:144639202-144639224 CTGAGTCCCCGCTACTTGGGAGG + Intergenic
1060986348 9:127821307-127821329 CATAGTCCCAGCTACTGGGAAGG + Intronic
1189131901 X:38507928-38507950 CAGAGTCCCAGCTAAGGTTTAGG - Intronic
1190754820 X:53392268-53392290 CATAGTCCCAGCTACGTGGGAGG + Intronic
1194154914 X:90375824-90375846 CATAGTCCCAGCTACTGGGGAGG + Intergenic
1197842359 X:130762458-130762480 CATAGTCCCAGCTACTGGGGAGG + Intronic
1202603315 Y:26616456-26616478 CATAGTCCCAGCTACTGGGGAGG - Intergenic