ID: 1172583422

View in Genome Browser
Species Human (GRCh38)
Location 20:36065673-36065695
Sequence ACCACCTCAGAAGCCCTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172583422_1172583426 -4 Left 1172583422 20:36065673-36065695 CCAGCGAGGGCTTCTGAGGTGGT No data
Right 1172583426 20:36065692-36065714 TGGTGCCCTCCGGGGCTCTGTGG No data
1172583422_1172583428 1 Left 1172583422 20:36065673-36065695 CCAGCGAGGGCTTCTGAGGTGGT No data
Right 1172583428 20:36065697-36065719 CCCTCCGGGGCTCTGTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172583422 Original CRISPR ACCACCTCAGAAGCCCTCGC TGG (reversed) Intergenic