ID: 1172583428

View in Genome Browser
Species Human (GRCh38)
Location 20:36065697-36065719
Sequence CCCTCCGGGGCTCTGTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172583419_1172583428 9 Left 1172583419 20:36065665-36065687 CCAGCTGTCCAGCGAGGGCTTCT No data
Right 1172583428 20:36065697-36065719 CCCTCCGGGGCTCTGTGGCCTGG No data
1172583422_1172583428 1 Left 1172583422 20:36065673-36065695 CCAGCGAGGGCTTCTGAGGTGGT No data
Right 1172583428 20:36065697-36065719 CCCTCCGGGGCTCTGTGGCCTGG No data
1172583416_1172583428 17 Left 1172583416 20:36065657-36065679 CCTTCTCTCCAGCTGTCCAGCGA No data
Right 1172583428 20:36065697-36065719 CCCTCCGGGGCTCTGTGGCCTGG No data
1172583415_1172583428 20 Left 1172583415 20:36065654-36065676 CCACCTTCTCTCCAGCTGTCCAG No data
Right 1172583428 20:36065697-36065719 CCCTCCGGGGCTCTGTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172583428 Original CRISPR CCCTCCGGGGCTCTGTGGCC TGG Intergenic