ID: 1172586814

View in Genome Browser
Species Human (GRCh38)
Location 20:36091493-36091515
Sequence CAGTGAAGAACCAGAATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172586808_1172586814 13 Left 1172586808 20:36091457-36091479 CCTGCTCTTAGTATCCTATACCT No data
Right 1172586814 20:36091493-36091515 CAGTGAAGAACCAGAATTGTTGG 0: 1
1: 0
2: 1
3: 21
4: 177
1172586812_1172586814 -7 Left 1172586812 20:36091477-36091499 CCTGAGGCATGGACCACAGTGAA No data
Right 1172586814 20:36091493-36091515 CAGTGAAGAACCAGAATTGTTGG 0: 1
1: 0
2: 1
3: 21
4: 177
1172586811_1172586814 -1 Left 1172586811 20:36091471-36091493 CCTATACCTGAGGCATGGACCAC No data
Right 1172586814 20:36091493-36091515 CAGTGAAGAACCAGAATTGTTGG 0: 1
1: 0
2: 1
3: 21
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172586814 Original CRISPR CAGTGAAGAACCAGAATTGT TGG Intronic
900905512 1:5554383-5554405 CGGAGGAGAACCAGAATTCTGGG + Intergenic
901646301 1:10718555-10718577 CAGGGCAGAACCAGAAGTGGGGG - Intronic
904873783 1:33637825-33637847 GAGGGAAGAACCAGAATAGAAGG + Intronic
905468613 1:38175190-38175212 CAGTGTGGGACCAGAATTGCAGG - Intergenic
907615153 1:55916626-55916648 AAGTGAAGAAAAGGAATTGTTGG - Intergenic
911455222 1:98113849-98113871 CAGTCAAGAAATAGAAATGTGGG - Intergenic
911869432 1:103075964-103075986 AAGTGAAGACCCAGATTTCTTGG - Intronic
913167831 1:116205242-116205264 CAGTCAAGAAACAGATATGTTGG + Intergenic
913421235 1:118671980-118672002 CAGTGATGATACAGATTTGTTGG - Intergenic
921922792 1:220687575-220687597 CAGTGAACAAGCAGAATTTAAGG - Intergenic
924676743 1:246186096-246186118 CAGTAAAAAACCACAATTCTGGG - Intronic
1064555109 10:16540239-16540261 CAGTGAAAGAACAAAATTGTTGG + Intergenic
1064579183 10:16776580-16776602 CAGTGAAGACCTGAAATTGTAGG + Intronic
1067187483 10:44043225-44043247 CAGTGAAGACCCCAAAATGTGGG - Intergenic
1067787555 10:49261526-49261548 CAGTGCAGAAGCAGAATCCTTGG + Intergenic
1068084111 10:52353150-52353172 CAGTGAATGATCAGATTTGTTGG - Intergenic
1070337721 10:75469998-75470020 CATCCAAGAACCAGAAGTGTGGG - Intronic
1074349245 10:112718927-112718949 CAGTTATCAACCAGAATTCTAGG + Intronic
1075147494 10:119894654-119894676 TGGTGAAGAACCAGCATGGTTGG + Intronic
1075279164 10:121124604-121124626 CAGTAAAAAACCAGAAATGCAGG + Intergenic
1075718796 10:124572927-124572949 CATTGAGGAACCAGGATTGGTGG - Intronic
1076548659 10:131263050-131263072 CAGTTTAGAAGCACAATTGTTGG + Intronic
1080091629 11:28355452-28355474 CAATGAAGAAACAGAGGTGTAGG - Intergenic
1080307655 11:30854089-30854111 TAGTCAAGAAGCAGAGTTGTGGG + Intronic
1080317764 11:30969936-30969958 CAAAGAAGAACCAAAATAGTGGG + Intronic
1080756710 11:35207275-35207297 CAGTGAAGCACCAGAATACTGGG - Intronic
1084870143 11:72093179-72093201 AAACTAAGAACCAGAATTGTTGG - Intronic
1085861842 11:80244358-80244380 CAGTGAAGAAAGGAAATTGTGGG + Intergenic
1089173838 11:116534524-116534546 CAGTGAAGGAGCTTAATTGTGGG + Intergenic
1090810122 11:130231921-130231943 CAGTGAAGAAGCATAAATGGTGG + Exonic
1092436656 12:8452724-8452746 CAGAGCAAAAGCAGAATTGTGGG - Intergenic
1094178600 12:27567195-27567217 CACTGAAGAACCTGAGTTATTGG - Intronic
1095812045 12:46382442-46382464 CATCTAAGAACCAGAATTGCAGG - Intergenic
1096479995 12:51933752-51933774 GAGTGAAGAACCTGAATGGGGGG - Intergenic
1097038905 12:56142646-56142668 GAGTGAAGAACCAGAGCTCTCGG + Exonic
1097250509 12:57630090-57630112 CAGAGAAGAACCAGAAAGGCTGG - Intronic
1097657819 12:62389886-62389908 AAGTGAAGAACCAGTATGGTGGG - Exonic
1102019689 12:109673660-109673682 AAATGAAGAAGCAGAAATGTTGG - Intergenic
1102445888 12:113002554-113002576 CAGGGAAGGACCAGAGGTGTAGG + Intronic
1106203664 13:27567743-27567765 CAGTTAGGAATCAGCATTGTGGG - Exonic
1106748674 13:32733621-32733643 CACTGAACACCAAGAATTGTAGG - Intronic
1108248853 13:48544866-48544888 GAGTGAAGAGCCAGTTTTGTAGG - Intergenic
1109259737 13:60130159-60130181 CAGTGTAGAAAGAGCATTGTTGG - Intronic
1109379031 13:61534479-61534501 AAATGAAGAACCACAATTTTAGG + Intergenic
1112188564 13:97151810-97151832 CCCTGAAGAACCTGAATGGTTGG + Intergenic
1112954865 13:105044327-105044349 CAGTGAAGTACCAAAACTGAAGG - Intergenic
1113100139 13:106708495-106708517 TAGTGAATATGCAGAATTGTTGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114862845 14:26547216-26547238 CTGTGAAAGGCCAGAATTGTGGG - Intronic
1116465780 14:45230993-45231015 TAGTGAAGAAGCAGGAATGTGGG + Intronic
1117924481 14:60763653-60763675 CAGTGAAAACTCAGAATTTTTGG + Intronic
1118834511 14:69467433-69467455 CACTGAATAGCCAGAAATGTAGG + Intergenic
1118886113 14:69867242-69867264 CACTGGAGAACCAGAATTCACGG - Intronic
1119462999 14:74826755-74826777 CAGGGAAGAACCAGTCTGGTGGG - Intronic
1120128964 14:80782415-80782437 CATTGAAGAACAAAGATTGTGGG - Intronic
1120180094 14:81334505-81334527 AGGTGAAGAACTAGAATTTTAGG + Intronic
1121565910 14:94908872-94908894 CAGGGAAGAACCAGCGTTGCTGG + Intergenic
1121953959 14:98197447-98197469 ATGTGAAGATCCAGAACTGTGGG - Intergenic
1124704422 15:31951148-31951170 CAGAGAAAAATTAGAATTGTTGG - Intergenic
1124934043 15:34152832-34152854 CTGTGAAGAACCAGAATCACTGG + Exonic
1130365802 15:83237168-83237190 CAGTGAACTACCAGAATATTTGG + Intergenic
1131697637 15:94895922-94895944 CAGTGAAGACCTGGAATGGTGGG - Intergenic
1131728450 15:95252890-95252912 CACTGAAGAACCAAGATGGTAGG + Intergenic
1133640136 16:7708770-7708792 CAGTGTAGAAACAGTATTATGGG + Intronic
1134567404 16:15263372-15263394 CAGTTGAGAACCAGTGTTGTAGG + Intergenic
1134735088 16:16493328-16493350 CAGTTGAGAACCAGTGTTGTAGG - Intergenic
1138741543 16:59316592-59316614 CAGTGAGGAACTGGAATTGGGGG + Intergenic
1141269115 16:82522833-82522855 CATGGAAGAACAAGAAGTGTGGG - Intergenic
1146663991 17:34684383-34684405 CAGGGCAGAACCAGGATTGATGG + Intergenic
1146980216 17:37153528-37153550 CAATGAAGAACAAGAAATGTGGG + Intronic
1147787689 17:42991470-42991492 CAGTGCAGACTCAGAATTGAAGG + Exonic
1149114617 17:53077699-53077721 TAGTGAAGAAAGAGAATTGTGGG - Intergenic
1151108222 17:71643898-71643920 CAGTGAAGATCCAGATTCTTAGG - Intergenic
1156546116 18:37965307-37965329 CAGTGCAGATCCAGAACTCTAGG + Intergenic
1159318399 18:66812075-66812097 CAGTTAAGAAACATAATTGCTGG - Intergenic
1159744195 18:72210995-72211017 CAGTGAAGATGCAGAACAGTTGG + Intergenic
1160060821 18:75527321-75527343 CAGTGAAGAACCAGAGTGTTCGG - Intergenic
1163201805 19:15775056-15775078 CAGAGAAGAACCAGAAAGGCTGG + Intergenic
1164219008 19:23176729-23176751 CTGTGAAATACCAGAACTGTGGG - Intergenic
1168435838 19:56316134-56316156 CAGTAAAGAACCATGATTGACGG - Intronic
1168634503 19:57985280-57985302 CACTGAAGTACCAGAAGTGGGGG - Intronic
927580268 2:24237596-24237618 CAGTGAAGAATTAGAGTTGGGGG - Intronic
928299927 2:30116099-30116121 CAGGTAAAAACCAGAATGGTTGG - Intergenic
930609789 2:53528979-53529001 CAGTGCAGACCCAAAATTCTAGG + Intergenic
935558397 2:104535752-104535774 CATTGCAGAACCAGGATTTTGGG + Intergenic
935966915 2:108487854-108487876 TGGTGAAGAACCTGCATTGTGGG - Intronic
937026790 2:118705542-118705564 CAGTGGAGAAACAGATTTGAAGG + Intergenic
937130613 2:119509628-119509650 CAGTTAAAAAAAAGAATTGTTGG - Intronic
938608936 2:132926043-132926065 CATTGAAGACCCAAAATGGTGGG - Intronic
939282086 2:140076849-140076871 CATTTAAGAACCACAATAGTGGG + Intergenic
944944909 2:204672705-204672727 AAGAGAAGCACCAGAATGGTAGG - Intronic
944951361 2:204753528-204753550 CAGTCAAGTACCAGATTTGGGGG - Intronic
947764346 2:232626883-232626905 CAGAGAAAAACTAGAATTTTGGG + Intronic
1169281371 20:4269778-4269800 CAGTGAACATCCAGACTTGCAGG + Intergenic
1169525397 20:6419196-6419218 CAGTGAAGCACCAAAGCTGTTGG - Intergenic
1170195472 20:13684870-13684892 CAAAGAAGCACCAGAAATGTGGG + Intergenic
1171318022 20:24212637-24212659 CAGGGAAGAAAATGAATTGTCGG + Intergenic
1171335682 20:24383407-24383429 CAGTTAAGAGACAGAAGTGTTGG - Intergenic
1172439345 20:34954785-34954807 CAGAGAAGAAGCAGATTTGTGGG - Intronic
1172586814 20:36091493-36091515 CAGTGAAGAACCAGAATTGTTGG + Intronic
1173103329 20:40107841-40107863 CAGCCAAGAAGCAGCATTGTAGG - Intergenic
1174602681 20:51737605-51737627 GAGTGAAAAAAGAGAATTGTTGG + Intronic
1175227005 20:57450559-57450581 GAGTGAAGAAACAGGCTTGTGGG - Intergenic
1178797282 21:35756571-35756593 CAGTGGAGAAACACACTTGTGGG - Intronic
1183795953 22:40117982-40118004 CAGTGAAAATGAAGAATTGTGGG + Intronic
1183857967 22:40649025-40649047 CAGTGAAGACCCAGGATAGACGG - Intergenic
1184577982 22:45389136-45389158 CAGTCAAGACCCTGAATTGCAGG - Intronic
949821951 3:8125304-8125326 GAGTGATGAACCAGAATAGCTGG - Intergenic
951052807 3:18113657-18113679 CTGTCAAGATACAGAATTGTGGG - Intronic
952139490 3:30462348-30462370 CAGAGAAGAAGGAGAAATGTGGG + Intergenic
952159599 3:30680520-30680542 TAGTGAAGAGCCAGTATTTTAGG + Intronic
952186485 3:30975194-30975216 CAGTAAAGGACCAGTACTGTAGG + Intergenic
953230965 3:41064741-41064763 CAATGAAGCACGAGAATTGCTGG - Intergenic
955550310 3:60077538-60077560 CAAAGAAAAACCAAAATTGTGGG + Intronic
956285585 3:67606427-67606449 CAGTGAAGCACTAGCATTGCAGG - Intronic
960906083 3:122603066-122603088 CATTGAAGACCCAGACTTTTTGG - Intronic
964413889 3:156427673-156427695 CAATGAAGAGACAGAATTGTGGG + Intronic
965303321 3:167031596-167031618 GAGAGGAGAACCAGATTTGTGGG - Intergenic
970632074 4:17958232-17958254 CAGGAAAAAAACAGAATTGTGGG + Intronic
971262150 4:25066898-25066920 AAGTTTACAACCAGAATTGTGGG - Intergenic
974626896 4:64437340-64437362 CAATCGAGAACCTGAATTGTTGG - Intergenic
975465558 4:74705253-74705275 CAGTGAACAAGCAGAGTTGTGGG + Intergenic
981800532 4:148650179-148650201 CAGTGATAAACCAGCACTGTTGG + Intergenic
981942736 4:150302373-150302395 CAATGAAGAACTAGAATTTTTGG + Intronic
982114563 4:152086979-152087001 GGGGGAAGAACCAGAATTATTGG + Intergenic
983801900 4:171941702-171941724 GAGTGAAGAACCATAAAAGTAGG - Intronic
984741950 4:183173528-183173550 GAGTGAAGAGCCAGAATGGTTGG - Intronic
986610358 5:9561106-9561128 GAGCGAAGAGCCAGAACTGTTGG + Intergenic
987826666 5:23038710-23038732 AAGTGAGGAAGCAGCATTGTAGG - Intergenic
988796765 5:34658368-34658390 AAGTGAAGAAGCAGATTTGGAGG + Intronic
991237422 5:64416024-64416046 CAGTGTAGAAATAGAATTGGGGG - Intergenic
992655010 5:78900447-78900469 CAGTGTAAAAACAGAATTGAGGG + Intronic
993839057 5:92853510-92853532 CATTGAAGAAGCAAAATTGTAGG + Intergenic
994099671 5:95879378-95879400 CAGTGAGGAGCCAGAAGTGAAGG - Intergenic
994368755 5:98945988-98946010 CAGTGAAGAACAAGATTTAAAGG - Intergenic
994621902 5:102173422-102173444 CAGTGAAGAAGCAGAAATGTAGG + Intergenic
995130674 5:108627093-108627115 CACTGAAGGACAAAAATTGTTGG - Intergenic
995901550 5:117073646-117073668 CAAAGAATAATCAGAATTGTTGG - Intergenic
996015507 5:118529758-118529780 AATTGAAGAAACAGACTTGTTGG - Intergenic
996430152 5:123366505-123366527 TAGTAAAGAACTAGAATTGTAGG - Intronic
996857002 5:128019591-128019613 GAGGGAAGAACCAGACATGTGGG - Intergenic
996892695 5:128441076-128441098 AAGTGAAGAAACAGAAATGAAGG + Intronic
999733667 5:154495889-154495911 CAGTGAAGAACCAGAGTATTTGG - Intergenic
999762605 5:154714003-154714025 CAGTGCAGAACCAGAACTGCAGG - Intronic
1000174774 5:158740956-158740978 TAGTTAATAAACAGAATTGTTGG - Intronic
1000291940 5:159878783-159878805 CACTCAAGAACCAGAACTGTGGG + Intergenic
1003117163 6:3290707-3290729 CAGGGAAGATTCAGAATGGTGGG + Intronic
1003615922 6:7655263-7655285 CAGTGAAGCACCAGCATGCTGGG + Intergenic
1006185668 6:32180356-32180378 CAGAGAAGAATCAGTATTGAGGG + Exonic
1006967693 6:38005908-38005930 AAGAGAAGGACCAGAATTATTGG - Intronic
1008006181 6:46411995-46412017 CTGTGAAGAGCCTGGATTGTAGG + Intronic
1008048801 6:46878981-46879003 CAGTGGAGAACCAGAAAATTTGG + Intronic
1008840372 6:55895694-55895716 CAGTGAGCAACTAGAAATGTGGG - Intergenic
1009498314 6:64378184-64378206 CAGTGAAGAACAAGATTTCATGG + Intronic
1009672130 6:66768893-66768915 CAGTAAAATACCAGAAATGTAGG - Intergenic
1014204294 6:118640167-118640189 CAGTGTAGTTCCAGATTTGTTGG - Intronic
1014236751 6:118965714-118965736 CAGGGAAGAGCCAGGATTGTAGG - Intronic
1015371924 6:132463780-132463802 CAGGGTTGAACCAGAATTGTTGG - Intronic
1016011823 6:139144762-139144784 CATTGAAAAACCACAATTGAGGG - Intronic
1016678709 6:146803312-146803334 CTGTGAAGAACCAGAATCACTGG + Intronic
1018584956 6:165347703-165347725 AACTGAAGAACCTGAAATGTGGG - Intronic
1021285896 7:18780512-18780534 CAGTGAAGAAGCATCATTGTAGG + Intronic
1023018502 7:35988519-35988541 TATAGAAGAACCAGAATTGAGGG + Intergenic
1024434489 7:49334239-49334261 CAGTGATCAATCAGATTTGTGGG + Intergenic
1025864691 7:65370220-65370242 CTGTGAAGTAACAGAACTGTGGG - Intergenic
1030524374 7:110635923-110635945 GAGTGAAGAATCTGAGTTGTAGG + Intergenic
1031034514 7:116773657-116773679 CAGTGAAGTACCTGAAATGTTGG - Intronic
1031304651 7:120111052-120111074 CACTGAAGACTCAGAATGGTGGG - Intergenic
1032549609 7:132772104-132772126 CAGTTAAGAGCCAGACTTCTAGG + Intergenic
1033870035 7:145741937-145741959 CAGTGAATAATGAGAATGGTTGG + Intergenic
1034787992 7:153942795-153942817 CAGGGAAGAGGCAGAATGGTAGG - Intronic
1035121092 7:156567646-156567668 CAGTGATGAAACAGAAGTGGGGG + Intergenic
1035476777 7:159149500-159149522 CAGTGAATGCCCAGCATTGTGGG + Intergenic
1037996694 8:23357690-23357712 CAGTGAAGACCCAGCCTTCTTGG - Intronic
1038473053 8:27841706-27841728 CAGCCAAGAGTCAGAATTGTGGG - Intergenic
1038506660 8:28090656-28090678 CAGAGAACAACCAGAAAGGTGGG + Intronic
1038594488 8:28874643-28874665 CAGTAAAGAATAAGAATTATGGG - Intronic
1039537933 8:38335919-38335941 AAGTGAAAAACCAGCATTGTTGG - Intronic
1041285271 8:56254112-56254134 AAGTAAAGAGCCAGAATTGGTGG - Intergenic
1043536149 8:81206785-81206807 CTGAGAAGAACCAGAACTCTAGG + Intergenic
1044605109 8:94041570-94041592 CAGAGAAGCACCATAATTGTGGG + Intergenic
1052289373 9:26824396-26824418 CAGGGAAGAACTAGAAGTTTTGG - Intergenic
1052402846 9:28022839-28022861 CAGAGAACATCCAGAGTTGTAGG - Intronic
1053590594 9:39510667-39510689 CAGTGGGGACTCAGAATTGTGGG + Intergenic
1053848455 9:42266056-42266078 CAGTGGGGACTCAGAATTGTGGG + Intergenic
1054575708 9:66854622-66854644 CAGTGGGGACTCAGAATTGTGGG - Intergenic
1055122268 9:72675193-72675215 CCTTGAAGAACCAGAAGTGAGGG + Intronic
1056680590 9:88714327-88714349 CAGGGAGGACCCAGAAATGTAGG - Intergenic
1058809767 9:108628086-108628108 CAATGATGAAAAAGAATTGTAGG - Intergenic
1185479535 X:435725-435747 CAGTGAAGGACCAGAACTCACGG + Intergenic
1185588410 X:1257565-1257587 CTGTGTAGAAGCAGAATTGGTGG - Intergenic
1186305049 X:8247342-8247364 CTGTGAAGATACAGAATTGCAGG + Intergenic
1191671895 X:63755535-63755557 TAATGAAGAAAGAGAATTGTGGG + Intronic
1192632615 X:72789150-72789172 GTGTGAAGAGGCAGAATTGTGGG + Intronic
1192649094 X:72931651-72931673 GTGTGAAGAGGCAGAATTGTGGG - Intronic
1192659800 X:73030320-73030342 CACTGAAGAACCAGAATATCAGG + Intergenic
1195347479 X:103964525-103964547 GAGTGATAAACCAGACTTGTCGG + Exonic
1195359963 X:104074316-104074338 GAGTGATAAACCAGACTTGTCGG - Intergenic
1199541474 X:148962692-148962714 CTGTGAAAAACAAGAAGTGTAGG - Intronic
1202102108 Y:21320886-21320908 CAGTGTAGTACCAGATTTTTGGG + Intergenic