ID: 1172587212

View in Genome Browser
Species Human (GRCh38)
Location 20:36093086-36093108
Sequence GCGCGCGTGCGTGTGTGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 1, 2: 5, 3: 61, 4: 389}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172587209_1172587212 10 Left 1172587209 20:36093053-36093075 CCGTGGATCCGTGCGAGCGGCTG 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1172587212 20:36093086-36093108 GCGCGCGTGCGTGTGTGCGCCGG 0: 1
1: 1
2: 5
3: 61
4: 389
1172587211_1172587212 2 Left 1172587211 20:36093061-36093083 CCGTGCGAGCGGCTGCTCGGTGT 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1172587212 20:36093086-36093108 GCGCGCGTGCGTGTGTGCGCCGG 0: 1
1: 1
2: 5
3: 61
4: 389
1172587208_1172587212 11 Left 1172587208 20:36093052-36093074 CCCGTGGATCCGTGCGAGCGGCT 0: 1
1: 0
2: 1
3: 2
4: 18
Right 1172587212 20:36093086-36093108 GCGCGCGTGCGTGTGTGCGCCGG 0: 1
1: 1
2: 5
3: 61
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172587212 Original CRISPR GCGCGCGTGCGTGTGTGCGC CGG Intronic
900177358 1:1296750-1296772 GCGCGTGTACGTGCGTGTGCGGG - Intronic
900177372 1:1296814-1296836 GTGCGCGTGTGTGCGTGTGCGGG - Intronic
900374801 1:2348638-2348660 GCGTGTGTGCGTGCCTGCGCAGG - Intronic
900545272 1:3225398-3225420 TAGTGCGTGCCTGTGTGCGCTGG + Intronic
901453514 1:9350602-9350624 GCGTGCATGCGTGTGTGTGGTGG + Intronic
901815429 1:11790912-11790934 GCATGTGTGCGTGTGTGCGGGGG - Intronic
902237349 1:15065891-15065913 GTGCGTGTGCACGTGTGCGCTGG + Intronic
902250793 1:15153386-15153408 GCGCACGCGCGTGTGTGTGACGG - Intronic
902282222 1:15382999-15383021 GTGCGCGTGTGTGTGTGTGGTGG - Intronic
903194627 1:21676052-21676074 GCGCGCGTGTGTGTGTGTTTTGG + Intergenic
903281667 1:22253657-22253679 GAGGGCGTGGGTGTGTGTGCGGG + Intergenic
903776443 1:25797160-25797182 GCGCGTGTGTGTGTGTGTGTAGG + Intergenic
904291262 1:29487569-29487591 GGGCGTGTGTGTGTGTGTGCAGG - Intergenic
905685049 1:39901872-39901894 GCGCGCATGTGCGTGTGTGCTGG - Exonic
906048302 1:42850227-42850249 GCATGCATGCGTGTGTGGGCGGG + Intronic
906067183 1:42989832-42989854 GCGCGCGTGTGTGTGTATGAGGG + Intergenic
906521048 1:46467041-46467063 GCGCGCGTGCGCCCGTGGGCTGG - Intergenic
906678535 1:47709805-47709827 GCGCGCCCGCGTGTGTGGTCGGG - Intergenic
906693699 1:47810162-47810184 GCGCGCGCACGTGTGTGTGTTGG + Intronic
906697665 1:47834560-47834582 GTGCGCGTGTGTGTGTGTGTTGG - Intronic
908501103 1:64744889-64744911 GCGCGGGCGCGCCTGTGCGCCGG + Intergenic
909622375 1:77683047-77683069 GTGCGCGCGCACGTGTGCGCGGG - Intronic
910773339 1:90851424-90851446 GCGGGGGTGCTTGCGTGCGCGGG - Intergenic
912546618 1:110455939-110455961 GCGTGTGTGTGTGTGTGTGCAGG + Intronic
914732934 1:150388492-150388514 GTGTGTGTGTGTGTGTGCGCGGG - Intronic
915722154 1:157993527-157993549 GCGCGCGCGTGTGTGTGTGCAGG + Intronic
915722156 1:157993529-157993551 GCGCGCGTGTGTGTGTGCAGGGG + Intronic
916233402 1:162561845-162561867 GCGCGTGGCCGTGTGTGCGGTGG - Intronic
916945491 1:169722145-169722167 GCGTGTGTGCGTGTGTGTGTTGG + Intronic
921051691 1:211515727-211515749 GTGCGCGTGCGTGGCTGGGCCGG - Intergenic
922739416 1:228006995-228007017 GCGGGTGCGCGGGTGTGCGCGGG - Intergenic
922789683 1:228304514-228304536 GTACTCGTGCGTGTGTGGGCAGG + Exonic
922831531 1:228556784-228556806 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922832009 1:228608738-228608760 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922832570 1:228610979-228611001 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922833130 1:228613220-228613242 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922833691 1:228615461-228615483 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922834250 1:228617702-228617724 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922835359 1:228622158-228622180 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922835918 1:228624378-228624400 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922836477 1:228626620-228626642 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922837035 1:228628859-228628881 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922837594 1:228631101-228631123 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922838153 1:228633342-228633364 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922838712 1:228635581-228635603 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922839270 1:228637807-228637829 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922840392 1:228642279-228642301 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
924172642 1:241357428-241357450 CCGCGCGTGTGTACGTGCGCCGG + Intergenic
924191296 1:241555140-241555162 GCACGCGTGTGTGTGTGTGTTGG - Intronic
924706574 1:246507302-246507324 TCGGGCGTACGTGTGCGCGCAGG - Intronic
1062934086 10:1373331-1373353 ACGCGCGTGTGTGTGTGTGTGGG - Intronic
1064384760 10:14879613-14879635 GCGCGCGTGGGTGTGGGCGTCGG + Intronic
1066022876 10:31319942-31319964 GCGCGCGTGTGCGCGGGCGCCGG + Intronic
1066500210 10:35986095-35986117 GTGTGTGTGCGTGTGTGTGCAGG + Intergenic
1067783939 10:49229024-49229046 GTGTGTGTGTGTGTGTGCGCGGG + Intergenic
1068950132 10:62768489-62768511 GTGTGTGTGCGTGCGTGCGCTGG - Intergenic
1069899397 10:71698519-71698541 GTGGGCGTGGGTGTGTGCGGTGG - Intronic
1070387707 10:75940786-75940808 GCGCGCGTGTGTGTGTGTTGAGG + Intronic
1071515261 10:86292715-86292737 GGGTGGGTGCGAGTGTGCGCAGG + Intronic
1073147958 10:101292629-101292651 GCGCGCGTGCGTGTGCGCGGCGG - Intergenic
1073214896 10:101830765-101830787 GCGCGCGTGTGTGTGTGTATGGG - Intronic
1073378309 10:103056373-103056395 GGGCACCTGTGTGTGTGCGCTGG + Intronic
1073453870 10:103624997-103625019 GTGCGCGTGCATGCGTGCCCAGG - Intronic
1073463754 10:103681737-103681759 GGGCGCGTGTGTGTGTGTGATGG - Intronic
1073577989 10:104641216-104641238 GCGAGCGAGCGTGTGTGTGTAGG - Exonic
1074088640 10:110226987-110227009 GGGCGCGCGCGTGTGTGTGAGGG + Intronic
1074088642 10:110226991-110227013 GCGCGCGTGTGTGTGAGGGGAGG + Intronic
1075713886 10:124544895-124544917 GCGCGAGTGCATATGTGCGCAGG + Intronic
1075964564 10:126600103-126600125 GCGTGCATGCGTGTGCACGCAGG + Intronic
1076120595 10:127934019-127934041 GTGTGTGTGTGTGTGTGCGCGGG - Intronic
1076778798 10:132712582-132712604 GTGCGGGTGTATGTGTGCGCGGG + Intronic
1076900386 10:133335007-133335029 GCCAGCGTCCGTGTGTGTGCAGG + Intronic
1077124337 11:925813-925835 GCGTGCGTGCGCGTGCGTGCTGG + Intronic
1077201508 11:1309691-1309713 GCGCGCGTGCGCGCGAGAGCCGG - Intergenic
1077295457 11:1824341-1824363 GAGCGAGTACGTGTGTGCGTGGG + Intergenic
1080799560 11:35597796-35597818 GCGCGTGTGTGTGTGTGTGTAGG + Intergenic
1081750818 11:45509913-45509935 GCGCGCGTGTGTGTGTGTGCAGG + Intergenic
1082787489 11:57324827-57324849 GGGCGAGCGCGTGAGTGCGCGGG - Intronic
1083266092 11:61547529-61547551 GAGTGCGTGCGTGTGTGCATTGG - Intronic
1083742777 11:64719860-64719882 GTGCGCGTGTGTGTGCGTGCAGG + Intronic
1084265727 11:68004199-68004221 GCGCGCGCGCGCGTGTGTGCAGG + Intronic
1084265729 11:68004201-68004223 GCGCGCGCGCGTGTGTGCAGGGG + Intronic
1087251511 11:95905326-95905348 GTGTGTGTGTGTGTGTGCGCAGG - Intronic
1088969364 11:114759043-114759065 GCGCACGTGTGTGTGTGCTGTGG - Intergenic
1089374671 11:117986108-117986130 GCGCGCGTGTGTGCATGTGCTGG - Intergenic
1090185921 11:124739253-124739275 GTGTGCGTGCGTGAGCGCGCGGG + Intergenic
1090482588 11:127081278-127081300 GTGTGTGTGCGTGTGTGCACAGG + Intergenic
1090665959 11:128915014-128915036 GCGCACCTGTGTGGGTGCGCTGG + Intronic
1090807894 11:130213749-130213771 GTGCGCGTGTGTGTGTGTGTTGG + Intergenic
1090917146 11:131175473-131175495 GTGCGCGTGTGTGTGTGTGTTGG - Intergenic
1091227617 11:133967047-133967069 CTGCGTGTGAGTGTGTGCGCAGG - Intergenic
1091555210 12:1567870-1567892 GCGCGCGTGTGCGTGTGGGTGGG - Intronic
1092999371 12:13980949-13980971 GCGCGGGGGTGAGTGTGCGCGGG - Intergenic
1095752652 12:45729166-45729188 CCGCGCGTGAATGTGTGCGAGGG + Intergenic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096254956 12:50057347-50057369 GCGCGCGCGTGTGTGCGCGCAGG - Intergenic
1096994618 12:55830812-55830834 GCGCGCGCGCGTGCGCGCGGTGG - Intronic
1097190573 12:57217495-57217517 CCGTGTGTGCGTGTGTGCTCGGG - Intronic
1098161062 12:67648715-67648737 GCGCCTGTGTGTGAGTGCGCGGG + Exonic
1099603169 12:84767492-84767514 GCGTGTGTGTGTGTGTGTGCAGG - Intergenic
1100221145 12:92505743-92505765 GTGCGCGTGCGTGTGTGTTTTGG + Intergenic
1100728354 12:97434827-97434849 GCGTGCGTGTGTGTGTGTGCAGG - Intergenic
1102877554 12:116459618-116459640 GTGCGTGTGTGTGTGTACGCGGG - Intergenic
1102973626 12:117190485-117190507 GCGCGCGTGCGAGAGTGCCCGGG + Intronic
1103971716 12:124676666-124676688 GTGCGCTTGCGTGTGTGTGCGGG + Intergenic
1103971734 12:124676888-124676910 GTGTGTGTGCGTGCGTGCGCGGG + Intergenic
1103971746 12:124676990-124677012 GCGCGCGAGCATGTGTGGGGGGG + Intergenic
1103980952 12:124736638-124736660 GGGTGCGTGCGTGGGTGCGTGGG - Intergenic
1104655835 12:130573410-130573432 GTGCGTGTGAGTGTGTGCGTGGG + Intronic
1104655837 12:130573422-130573444 GTGTGCGTGGGTGTGTGCGTGGG + Intronic
1108051952 13:46453941-46453963 GCGCGCGTGTGTGTGTGTTGAGG - Intergenic
1111297512 13:86301674-86301696 GCGCAGGTGTGTGTGTGTGCAGG + Intergenic
1111762926 13:92488127-92488149 GTGCGCGTGTGTGTGTGTACAGG + Intronic
1112356173 13:98676335-98676357 GCGTGCGTGCGTGCGTGCGTGGG - Intergenic
1112503154 13:99957363-99957385 GCGCGTGAGCGTGTGTGTGGGGG + Intergenic
1112504569 13:99968438-99968460 GCGCGCGTGCGTGGGGTCGGGGG - Intronic
1112507039 13:99981601-99981623 GTGCGCGCGCGGGTGCGCGCAGG + Intergenic
1112865132 13:103886015-103886037 TCGTGTGTGTGTGTGTGCGCGGG - Intergenic
1112936244 13:104803285-104803307 TAGTGTGTGCGTGTGTGCGCAGG - Intergenic
1113082833 13:106535565-106535587 GCGCGCGGGCCTTTGTGTGCGGG + Intergenic
1113737643 13:112689919-112689941 GCGAGCGCGGGTGTGGGCGCGGG + Intergenic
1114242804 14:20884324-20884346 GCGCGCGCGTGTGTGTGTGTAGG + Intergenic
1117972024 14:61261186-61261208 GTGCATGTGCGTGTGTGCGTTGG - Intronic
1118807771 14:69252711-69252733 GGGCGGGTGCATGTGTGCACAGG - Intergenic
1119325785 14:73759067-73759089 GCGGGCGTGCGGGGGCGCGCGGG + Intronic
1119341939 14:73886776-73886798 GAGCGAGTGGGTGTGTGCGTGGG + Exonic
1119889361 14:78171344-78171366 GTGTGTGTGTGTGTGTGCGCGGG + Intergenic
1120088960 14:80309059-80309081 ATGCGTGTGCGTGTGTGCGGTGG - Intronic
1120497412 14:85254095-85254117 TCGCGCGCGCGTGTGTGTGTGGG - Intergenic
1120765341 14:88323241-88323263 GCGCCCGGGAGTGTGTGTGCGGG - Exonic
1120953041 14:90060480-90060502 CCGCGCGGGGCTGTGTGCGCGGG + Intergenic
1121546844 14:94769258-94769280 GCGGGCGTGCATGCGTGCGGTGG - Intronic
1122090159 14:99333315-99333337 GTGCGCTTGTGTGTGTGTGCTGG - Intergenic
1122419198 14:101564564-101564586 GCGCGCTTGGATGTGAGCGCGGG + Intergenic
1122855978 14:104560317-104560339 GTGTGCGTGTGTGTGTGCACCGG - Intronic
1123464695 15:20506414-20506436 GCGGGAGTGCGTGCGTGCGGCGG - Intergenic
1123743842 15:23303490-23303512 GCGGGAGTGCGTGCGTGCGGCGG + Intergenic
1124307284 15:28589220-28589242 GCGGGAGTGCGTGCGTGCGGCGG + Intergenic
1125270535 15:37934101-37934123 GCGCGCGCGCGTGTGTGTAGGGG - Intronic
1125270537 15:37934103-37934125 GCGCGCGCGCGCGTGTGTGTAGG - Intronic
1125894885 15:43293789-43293811 GCGTGCGGGTGTGTGTGTGCGGG + Intronic
1125894887 15:43293791-43293813 GTGCGGGTGTGTGTGTGCGGGGG + Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1127867044 15:63041897-63041919 GCATGTGTGCGTGTGTGTGCGGG - Intergenic
1129692941 15:77724024-77724046 CCGGGCGTGCGTGTCTGAGCTGG + Intronic
1129823761 15:78621016-78621038 GCGGGCGGGCGGGCGTGCGCGGG + Exonic
1132055545 15:98648487-98648509 GCGAGCGGGCGCGTGTGCGCGGG + Intergenic
1132350998 15:101139721-101139743 GTGCGCGTGTGTGTGTGTGGCGG + Intergenic
1132552811 16:560357-560379 GCGCGCGTGCGCCTGGGCTCCGG - Intergenic
1132881644 16:2164180-2164202 GCACGCGTGCGTGTGTGGTTGGG + Intronic
1133046086 16:3089102-3089124 TCTCGCGGGCGTGGGTGCGCAGG + Exonic
1133222194 16:4323560-4323582 GTGAGTGTGCGTGTGTGTGCCGG + Intronic
1133296031 16:4752768-4752790 GCTCGCCCGTGTGTGTGCGCTGG + Exonic
1133993684 16:10730451-10730473 GCACACGTGCGTGTGTCTGCAGG - Intergenic
1136399835 16:30011253-30011275 GGGCACGGGCGTGTGCGCGCGGG - Intronic
1136399842 16:30011293-30011315 GCGCGCCTGGGTGTGTGCAAGGG - Intronic
1136705992 16:32188324-32188346 GCGGGCGTGCGTGCGTGCCGCGG - Intergenic
1136761920 16:32741081-32741103 GCGGGCGTGCGTGCGTGCCGCGG + Intergenic
1136806180 16:33129307-33129329 GCGGGCGTGCGTGCGTGCCGCGG - Intergenic
1137591748 16:49698003-49698025 GTGCGTGTGTGTGTGTGTGCAGG + Intronic
1137830991 16:51543189-51543211 GCGCGCGTGTGTGTGTTTGCAGG - Intergenic
1137924338 16:52525688-52525710 GCGTGTGTGTGTGTGTACGCAGG - Intronic
1138234796 16:55373042-55373064 GCGCGCGTGCGTGTGTATGACGG - Intergenic
1140477918 16:75248263-75248285 GGGCGGGTGCATGTGTGCGTTGG - Intronic
1141651318 16:85394580-85394602 GAGTGCGTGTGTGTGTGCGCGGG - Intergenic
1141983431 16:87564012-87564034 GGGTGTGTGCGTGTGTGCACGGG + Intergenic
1142014614 16:87738338-87738360 GTGCACGTCCGTGTGTGCGCAGG - Intronic
1142335721 16:89489208-89489230 GCGCGTGTGTGTGTGTGTGTAGG - Intronic
1203064079 16_KI270728v1_random:1001397-1001419 GCGGGCGTGCGTGCGTGCCGCGG + Intergenic
1142812102 17:2400249-2400271 GTGTGCGTGCGTGTGTGCACGGG - Intronic
1142993476 17:3747266-3747288 ACGTGTGTGCGTGTGTGCGGGGG - Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143247798 17:5500779-5500801 GCGCGCGGGCGGGAGGGCGCAGG - Intronic
1144632728 17:16882246-16882268 GAGCGCGTGTGTGTGTGTGCTGG - Intergenic
1144638436 17:16925130-16925152 GCGCATGTGTGTGTGTGTGCTGG - Intergenic
1144754085 17:17668999-17669021 GCGTGTGCGTGTGTGTGCGCAGG - Intergenic
1145063461 17:19746727-19746749 GCGCGTGTGCGTGTGTGTGTGGG + Intronic
1145963865 17:28903095-28903117 GTGCGCGTGCGGGTGCGCGCCGG + Intergenic
1145977394 17:28992354-28992376 GTGCACGTGCGTGTGTGTGTGGG + Intronic
1146652083 17:34613196-34613218 GCGCGCGTGTGTGTGTGTGTGGG - Intronic
1146669935 17:34730197-34730219 GTGTGCGTGCGTGTGTGTGTGGG - Intergenic
1146669937 17:34730221-34730243 GGGCGTGTGTGTGTGTGTGCGGG - Intergenic
1146957046 17:36942068-36942090 GCGCGCTTGTGTGTGTGTGTAGG - Intronic
1147383437 17:40069024-40069046 GCACGTGTCCGTGTGTGTGCCGG + Intronic
1147588279 17:41665491-41665513 GCGTGCGTGTGTGTGTGTGTGGG - Intergenic
1147667980 17:42160644-42160666 TCGCGCGCGCGTGTGTGTGTAGG - Intronic
1147847993 17:43418830-43418852 GCGCGTGTGTGTGTGTGGGGAGG + Intergenic
1148225307 17:45894897-45894919 GTGCGCGCGTGTGTGTGTGCTGG + Intronic
1148437527 17:47695095-47695117 GCACGCGTGCGTGAGCGCGTGGG - Intronic
1149614581 17:57987821-57987843 GTGTGTGTGCGTGTGTGTGCTGG + Intronic
1151212306 17:72553775-72553797 GTGTGTGTGCGTGTGTGCCCAGG - Intergenic
1151709674 17:75796020-75796042 GTGCACGGGCGTGTGTGCCCAGG + Intronic
1152794005 17:82298057-82298079 GTGCGGGAGCGTGTGTGTGCAGG + Intergenic
1153457515 18:5296220-5296242 GCGCGTGCGCGCGCGTGCGCAGG - Intronic
1154194309 18:12254563-12254585 GGGCGGATGGGTGTGTGCGCGGG - Intronic
1155116569 18:22774148-22774170 GTGCGTGTGCGTGTGTGTGTGGG + Intergenic
1155947885 18:31876861-31876883 GCGGGCATGCCTGTGTGAGCTGG - Intronic
1156275701 18:35581422-35581444 GCGCGCATCCGGGTGAGCGCCGG + Intronic
1157409249 18:47449738-47449760 GCACGCGTGCGTGTATGTGGGGG - Intergenic
1157535741 18:48456089-48456111 GCGTGTGTGTGTGTGTGTGCTGG + Intergenic
1159991656 18:74915634-74915656 GTGTGCGTGCATGTGTGTGCTGG + Intronic
1159991681 18:74915918-74915940 GTGTGCGTGCATGTGTGTGCTGG + Intronic
1159991693 18:74916060-74916082 GTGTGCGTGCATGTGTGTGCTGG + Intronic
1159991716 18:74916352-74916374 GTGTGCGTGCATGTGTGTGCTGG + Intronic
1159991728 18:74916492-74916514 GTGTGCGTGCATGTGTGTGCTGG + Intronic
1160453072 18:78978933-78978955 GGGCGCGTGCGTGTGACCGCGGG + Intergenic
1160714976 19:572462-572484 GAGCGTGTGCGCGCGTGCGCAGG + Intronic
1160858950 19:1229563-1229585 GCGGGCGTGCGGGTGCGCGCGGG + Exonic
1160871763 19:1280992-1281014 GTGGGAGTGCGTGTGTGTGCGGG + Intergenic
1160905642 19:1450516-1450538 CCGTGAGTGGGTGTGTGCGCAGG - Intronic
1162314640 19:9930942-9930964 GGGCGCGTGCGTATGTGGGATGG - Intronic
1162584662 19:11551650-11551672 GGCTGCGTGCGTCTGTGCGCGGG - Intronic
1162778581 19:12995353-12995375 GTGTGCTTGTGTGTGTGCGCCGG + Intergenic
1162784052 19:13023233-13023255 GTGCGCGTGTGTGTGCGCACTGG - Intronic
1162798316 19:13097944-13097966 GCGTGCGTGCGTGCGGGCGCGGG - Intronic
1163126598 19:15247562-15247584 GTGCGCGTGCGTGCGTGTGTCGG + Intronic
1163446859 19:17352185-17352207 GCGCGGGTGCGGGTGTGAGAGGG + Exonic
1163525914 19:17821364-17821386 GCGCTAGTGCGCGTGTGCGGGGG - Exonic
1163592726 19:18203573-18203595 GCGCGCCTGCCTGTGTCAGCGGG - Intronic
1163679357 19:18671775-18671797 GAGCATGTGCGAGTGTGCGCAGG - Intergenic
1165320987 19:35084967-35084989 GTGTGTGTGTGTGTGTGCGCTGG - Intergenic
1165509081 19:36255822-36255844 GCGCGGGTGCGTGCGTGTGTTGG + Intergenic
1165924856 19:39320734-39320756 GGGGGCGCGGGTGTGTGCGCGGG - Intergenic
1166042907 19:40214020-40214042 GAGGGCGTGGGTGTGGGCGCGGG - Exonic
1166222953 19:41377239-41377261 GCATGTGTGCGTGTGTGCACAGG + Intronic
1166331432 19:42080145-42080167 GCTCCCCTGTGTGTGTGCGCAGG - Exonic
1166361710 19:42255244-42255266 GAGCGTGTGTGTGAGTGCGCGGG - Intergenic
1168011638 19:53538090-53538112 GTGCGCGTGCGCATGCGCGCTGG + Intronic
1168315047 19:55481355-55481377 GCTCGCCTGTGTGCGTGCGCTGG - Exonic
1168721037 19:58555162-58555184 GCGCGCGTGCGCCCGTGCCCCGG + Intergenic
925059179 2:878032-878054 GCGTGCGTGTGTGTGTGTGTAGG - Intergenic
925465886 2:4107068-4107090 GCGCGCGTGCATGTGTGTGTAGG + Intergenic
926236458 2:11048867-11048889 GTGCGTGTGTGTGTGTGTGCTGG + Intergenic
926268162 2:11344604-11344626 CCGCGCGGGAGTGTGTGCGCCGG - Intronic
926285369 2:11483173-11483195 TTGTGCGTGCGTGTGCGCGCGGG + Intergenic
926384904 2:12326488-12326510 GCGTGTGTGTGTGTGTGAGCAGG - Intergenic
927018172 2:18989776-18989798 GTGTGTGTGCGTGTGTGTGCAGG + Intergenic
927713750 2:25340745-25340767 GCGTGCGTGGGAGTGTGCGCGGG + Intronic
927779607 2:25928854-25928876 GTGCGTGTGCGTGTGTGCAGGGG - Exonic
928665784 2:33549363-33549385 GCGTGTGTGTGTGTGTGTGCAGG - Intronic
929313579 2:40452183-40452205 GCGGGCGGGCGAGTGTGCGCGGG - Intronic
929554813 2:42919545-42919567 GTGCATGTGCATGTGTGCGCCGG + Intergenic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
930278160 2:49338063-49338085 GTGCGTGTGCGTGTGTGTGTGGG + Intergenic
931869058 2:66440034-66440056 GCGCGCGTGTGTGTTGGCGAAGG - Intronic
931869059 2:66440040-66440062 GCGCGCGCGCGCGTGTGTGTTGG - Intronic
932101686 2:68907008-68907030 GTGCGTGTGTGTGTGTGTGCAGG + Intergenic
937084083 2:119159017-119159039 GGGCGCGTGAGTGTGGCCGCGGG - Intergenic
941158276 2:162004582-162004604 GCGTGTGTGTGTGTGTGTGCAGG - Intronic
941606784 2:167607519-167607541 GTGTGCGTGTGTGTGTGCACAGG + Intergenic
941686918 2:168456649-168456671 GCGCGCGTGTGTGTGCGCAGGGG - Intronic
941686920 2:168456651-168456673 GTGCGCGCGTGTGTGTGCGCAGG - Intronic
941821414 2:169847109-169847131 GTGTGTGTGTGTGTGTGCGCTGG + Intronic
943375874 2:187076100-187076122 GTGCGCGTGTGTGTGTGTGGTGG + Intergenic
945699433 2:213151796-213151818 GCGCGCGCGTGCGTGTGTGCGGG + Intronic
945699439 2:213151849-213151871 GCGCGTGTGCGCGCGCGCGCGGG + Intronic
945948316 2:216015191-216015213 GTGCGTGTGCGTGTGTGTGTTGG + Intronic
946524756 2:220506610-220506632 GCAGGCGTGTGTGTGTGTGCAGG + Intergenic
948205491 2:236160848-236160870 GTGAGTGTGCGTGTGTGGGCGGG - Intergenic
948460046 2:238124783-238124805 GAGTACGTGCGTGTGTGTGCAGG + Intronic
948640453 2:239372479-239372501 GTGTGCGCGCGTGTGTGCGCGGG - Intronic
1169132377 20:3173010-3173032 GTGCGCGCGTGTGTGTGCTCGGG - Intronic
1169171723 20:3470937-3470959 GCGCGCGTGCGCGAGTACGTGGG - Intergenic
1169288498 20:4329133-4329155 GCGCACGTGTGTGTGTGTGTAGG - Intergenic
1169849599 20:10035057-10035079 GCGCGCGGGCAGGTGAGCGCAGG - Exonic
1171396720 20:24839124-24839146 GTGCATGTGCGTGTGTGCGCAGG + Intergenic
1172526579 20:35603358-35603380 GCGCGCGTGTGCGTGTGCAGGGG - Intergenic
1172587212 20:36093086-36093108 GCGCGCGTGCGTGTGTGCGCCGG + Intronic
1172633899 20:36396318-36396340 GTGCGTGTGTGTGTGTGTGCTGG - Intronic
1173576228 20:44114594-44114616 GTGTGTGTGTGTGTGTGCGCTGG + Intronic
1173822636 20:46029182-46029204 GTGTGCGAGTGTGTGTGCGCCGG + Intronic
1175722596 20:61296259-61296281 GTGCGTGTGTGTGTGTGCGTGGG + Intronic
1175722598 20:61296281-61296303 GTGCGTGTGTGTGTGTGCGTGGG + Intronic
1175850422 20:62087954-62087976 GCACGTGTGCGTGCGTGTGCAGG - Intergenic
1175932755 20:62500499-62500521 GTGCGTGTGCGGGTGTGTGCAGG + Intergenic
1176550494 21:8218947-8218969 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176550496 21:8218949-8218971 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176577336 21:8446217-8446239 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176577338 21:8446219-8446241 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1177355985 21:20008373-20008395 GCGCGCATGTGTGTGTGTGTAGG - Intergenic
1178913072 21:36692211-36692233 GCGGTGGTGCGAGTGTGCGCAGG - Intergenic
1179133636 21:38660853-38660875 GCGCGTGTCCGTGTGCGCGTGGG + Intronic
1179565230 21:42243474-42243496 GTGTGTGTGTGTGTGTGCGCTGG + Intronic
1179717864 21:43299205-43299227 GCACGCGTGCGTGTATGAGGCGG - Intergenic
1181967524 22:26667428-26667450 GCGCGCGTGTGTGTGTATGTTGG + Intergenic
1182149504 22:28018287-28018309 GCGCGCGTGTGTGCGCGCGCGGG + Intronic
1183034868 22:35134019-35134041 GTGTGTGTGCGCGTGTGCGCAGG + Intergenic
1183504570 22:38202169-38202191 ACGCGCGTGTGTGAGCGCGCCGG + Exonic
1184164175 22:42717753-42717775 GCGTGCGTGGGTGTGTGTGTGGG - Intronic
1184239857 22:43206392-43206414 GCACGCGTGTGTGTGTGCGGGGG - Intronic
1184645250 22:45891714-45891736 GCGCGGGCGCGTGTGGGCACTGG - Intergenic
1185093776 22:48794095-48794117 GTCCGTGTGCGTGTGTGCGTGGG + Intronic
1185320196 22:50197186-50197208 GGGCGGGTGCGGGGGTGCGCTGG - Intronic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203255391 22_KI270733v1_random:135288-135310 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1203255393 22_KI270733v1_random:135290-135312 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
951908270 3:27724143-27724165 GCGCGCTCGCGTGTGTGTGGTGG + Intergenic
952185804 3:30967095-30967117 GCGCGTGTGTGTGTGTATGCAGG - Intergenic
953427151 3:42804556-42804578 GGACGCGTGCGTGTGCGCGGCGG + Intergenic
953925398 3:46980022-46980044 GCGCGCGGGCGCGCGCGCGCAGG + Intronic
954247030 3:49340091-49340113 GCACGCGAGCGTGCGTGCGTGGG - Intronic
954313839 3:49790200-49790222 GCGCGCGCGCATGTGTGTGAAGG - Intergenic
954422143 3:50424439-50424461 GAGCGCGTGCGTGTGTGTTGGGG - Intronic
954662256 3:52232361-52232383 GCGCACGTGTGTGTGTGTGGGGG - Intronic
954697733 3:52436527-52436549 GTGCACGTGCATGTGTGCGTGGG - Intronic
954870166 3:53761768-53761790 GCACACGTGCGTGTGTGCGTGGG + Intronic
956659456 3:71583653-71583675 GCGCGAGTGAGTGTGTGCGCGGG - Intronic
956681450 3:71785258-71785280 GCGGGCGCGCGTGTGCGCGTGGG - Intergenic
957188810 3:76979598-76979620 GTGTGTGTGTGTGTGTGCGCAGG + Intronic
957542524 3:81592149-81592171 GCGCGCGTGTGTGTGTGTTTAGG + Intronic
960465934 3:117996885-117996907 GCGCGCGCGCGTGTGAACGGGGG - Intergenic
961322219 3:126083982-126084004 GCGCCCGGGAGTGGGTGCGCGGG - Intronic
962263113 3:133927527-133927549 GCGTGCGTGCGTGCGTGCGGTGG + Intergenic
962366783 3:134792111-134792133 GAGCGTGTGTGTGTGTGTGCAGG + Intronic
962393032 3:134989476-134989498 GCACGCGCGCGTGCGTGTGCAGG - Intronic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
964626535 3:158765305-158765327 GCGTGTGTGTGTGTGTGCGAGGG - Intronic
964852049 3:161105291-161105313 GGGAGGCTGCGTGTGTGCGCAGG - Exonic
965892878 3:173536765-173536787 GCGTGTGTGTGTGTGTGCGTAGG + Intronic
966982733 3:185153058-185153080 GTGCGCGTGCGTGTGCGCGTGGG - Intergenic
968088921 3:195887846-195887868 GTGTGCGTGTCTGTGTGCGCAGG + Intronic
968556534 4:1248776-1248798 GTGCGAGTGCGCGTGCGCGCCGG - Intronic
969368590 4:6716125-6716147 GCGCGCGTGCGTGCGTGTGCGGG + Exonic
970617442 4:17781352-17781374 GTGCACGTGCGTGCGCGCGCGGG + Exonic
971195834 4:24471291-24471313 GCGCGCTCGCGTGTCTGGGCTGG - Intergenic
971196180 4:24472890-24472912 GCGGGCGGGCGTGTGCGCGCGGG + Intergenic
972091225 4:35287044-35287066 ACGCGCGCCCGTGTGTGCGTGGG - Intergenic
973754884 4:54064683-54064705 GGGCGCGTGCGTGGGCGCGTGGG + Exonic
975957094 4:79854225-79854247 GCGCGTGTGCATGTGTGAGTTGG - Intergenic
976475319 4:85475795-85475817 GCGCGCGCGCATGTTTGTGCCGG + Intronic
977243621 4:94603691-94603713 GCGCGCGTGTGTGAGTGTGCTGG + Intronic
978126842 4:105146191-105146213 GCGCGCGGGGGCGTGTGCGCGGG + Intronic
978645784 4:110929690-110929712 GCGCGTGTGTGTGTGTGTGTTGG - Intergenic
978648838 4:110975403-110975425 GTGCGTGTGTGTGTGTGTGCAGG - Intergenic
978885285 4:113761201-113761223 GCCCGCGAGGGAGTGTGCGCAGG + Intronic
980249255 4:130292888-130292910 GTGCGCGTGTGTGTGTGGGCAGG + Intergenic
981008684 4:139902222-139902244 GCGCGCCTGCGTGTGTGTCCAGG - Intronic
981550882 4:145939103-145939125 GCGCGCGTGCGGGGGTGGGATGG + Intergenic
982000301 4:151015746-151015768 GTGCGCGAGCGCGAGTGCGCGGG + Intergenic
983006987 4:162495321-162495343 GCGCGCGTGTGTGTGTGTGGTGG - Intergenic
984667945 4:182448662-182448684 GCGAGCGTGCGTGTGTGGAGGGG + Intronic
984816280 4:183840050-183840072 GCGCGTGTGTGTGTGTGTGTTGG + Intergenic
985923576 5:2998503-2998525 GTGCGCCTGCCTGTGTGTGCTGG - Intergenic
985988392 5:3536102-3536124 GCGCGGGTGAGCGTGCGCGCGGG - Intergenic
989523127 5:42423907-42423929 GCGCGGGTTCGCGTCTGCGCTGG - Intronic
989983098 5:50666613-50666635 CCGCGGGCGCGAGTGTGCGCGGG + Intronic
990210780 5:53480175-53480197 GCGCGCGCGCGAGTGTGAGAGGG - Intergenic
990872591 5:60449066-60449088 GTGTGTGTGTGTGTGTGCGCGGG - Intronic
992529378 5:77640367-77640389 GCGCGCGCACGTGTGTGTGCAGG - Intergenic
993901007 5:93584437-93584459 GTGCGAGTGTGTGTGTGCGCGGG + Exonic
996184958 5:120464206-120464228 GCGCGTGTGCGCGAGAGCGCCGG + Intergenic
996738354 5:126777231-126777253 TCCCGCGTGCGTGTGTGAGTGGG + Exonic
998083355 5:139294464-139294486 GCGCGCGCGCGCGTGTGGGCCGG - Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
999169534 5:149581615-149581637 GCGCGCGCGGGTGAGTCCGCTGG + Exonic
999330752 5:150672015-150672037 GCGCGCGTGCGCGTGTGTGTTGG - Intronic
999882846 5:155886506-155886528 GCGTGCGTGTGTGTGTGCGTGGG + Intronic
1000785457 5:165537608-165537630 GCGCGCGTGTGTGTGTGTGATGG - Intergenic
1001828477 5:174765758-174765780 GCGCATGTGTGTGTGTGCGTGGG - Intergenic
1002082502 5:176745874-176745896 ACGAGCCTGTGTGTGTGCGCGGG + Intergenic
1002095885 5:176830618-176830640 TGGCGTGTGTGTGTGTGCGCTGG + Intronic
1002095902 5:176830850-176830872 GCTGGCGTGTGTGTGTGCGCTGG + Intronic
1003107836 6:3228888-3228910 GCGCTCGTGCGAGTGCGCGTGGG - Intronic
1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG + Intronic
1006787944 6:36680284-36680306 GCGCGCGTGCGTGTCTGCGCGGG + Intronic
1007356120 6:41319046-41319068 GCGCGCACGCGTGTGCACGCTGG - Intergenic
1007707314 6:43798804-43798826 GTGCGTGTGTGTGTGTGTGCAGG + Intergenic
1008549651 6:52615620-52615642 GCGCACGTGTGTGTGTGTGTAGG + Intergenic
1009609844 6:65927309-65927331 GCGTGCGTGTGTGTGTGTGAAGG + Intergenic
1010141563 6:72620570-72620592 GCGGGCGTGGGTGTGTGTACAGG + Intergenic
1010703136 6:79077131-79077153 GCGCGCGTCCGTGCGGGCGCGGG - Intronic
1012704660 6:102506551-102506573 GCGCGCGCGTGTGTGTGTGTTGG + Intergenic
1012704662 6:102506553-102506575 GCGCGCGTGTGTGTGTGTTGGGG + Intergenic
1013836422 6:114341593-114341615 GCGCGCGCGCGCGTGTGTGTTGG + Intronic
1014635958 6:123846823-123846845 GCGCGCGTGCGTGTGTGTGGCGG - Intronic
1014724749 6:124961899-124961921 GTGTGCGTGTGTGTGTGCGCGGG + Intergenic
1015413899 6:132926746-132926768 GCGCGTGTGTGTGTGTGAGCGGG - Intergenic
1018906919 6:168080837-168080859 GCGCTGGTGTGTGTGGGCGCTGG + Intronic
1018906928 6:168080885-168080907 GCGCTGGTGTGTGTGGGCGCTGG + Intronic
1019135846 6:169907220-169907242 GCACGTGTGCATGTGTGTGCAGG - Intergenic
1019356644 7:583413-583435 GGGTGTGTGCGTGTGTGCGTGGG - Intronic
1019721975 7:2578053-2578075 GTGTGCGTGGCTGTGTGCGCGGG + Intronic
1019721989 7:2578155-2578177 GTGTGCGTGGCTGTGTGCGCGGG + Intronic
1020187954 7:5973176-5973198 GCGCTCGTGTGTGTGTGTCCAGG - Intergenic
1020281839 7:6653807-6653829 GCTCGCCGGTGTGTGTGCGCCGG - Exonic
1020294964 7:6751594-6751616 GCGCTCGTGTGTGTGTGTCCAGG + Intergenic
1020418158 7:7969273-7969295 GCGCGCGAGCGTGTGGGAGCCGG - Exonic
1021799010 7:24285294-24285316 GCTCGTGTGCCTGGGTGCGCTGG + Exonic
1022038063 7:26552707-26552729 GCGCGGGCGTGTGTGTGCACAGG - Intergenic
1023881980 7:44325832-44325854 GCGGGCGCGCGTGTGAGTGCAGG - Intronic
1027138321 7:75639591-75639613 GTGCGCCCGCGTGTGTGTGCAGG + Intronic
1029538192 7:101167983-101168005 ACGCGCGCGTGTGTGTGTGCTGG + Intergenic
1030115214 7:106057660-106057682 GGGTGTGTGCGTGTGTGCACGGG - Intergenic
1032013646 7:128361945-128361967 GCGCGTGTGGATGTGTGTGCTGG - Intergenic
1033253366 7:139778344-139778366 ACGCGCGCGCGTGTGTGCCCAGG + Exonic
1033422494 7:141216455-141216477 GCGCGCGCGTGTGTGTGTGTGGG + Intronic
1034222972 7:149460090-149460112 CCGCGCGTCCGTGCGCGCGCGGG + Intronic
1034342824 7:150369024-150369046 GCGACCGTGTGTGAGTGCGCGGG + Intronic
1034349722 7:150408037-150408059 GCATGCGCGCGTGGGTGCGCTGG - Intronic
1034376661 7:150650836-150650858 GCGCGCGTGTGTGTGTATGATGG - Intergenic
1034824624 7:154250401-154250423 GGGCGTGTGGGTGCGTGCGCTGG + Intronic
1034897101 7:154883681-154883703 GAGCACGTGTGTGTGTGAGCAGG - Intronic
1034928539 7:155142283-155142305 GTGCGTGTGTGTGTGTGTGCAGG - Intergenic
1035356171 7:158277128-158277150 GTGCGCGTGTGTGCGTGTGCGGG - Intronic
1035458971 7:159027746-159027768 GCGTGTGTGGGTGTGTGCGTGGG - Intergenic
1035580557 8:737307-737329 GCGCCGGCGCGTTTGTGCGCGGG - Intronic
1037340878 8:17843512-17843534 GTGTGCGTGCGTGTGTGTGTGGG + Intergenic
1037578023 8:20226145-20226167 GCGGGCGTGTGTGTGTGAGTGGG + Intronic
1037608917 8:20459865-20459887 GCGCGTGTGTGTGTGTGTGCAGG - Intergenic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1038267975 8:26050653-26050675 GTGCGAGTGCGTGTGTGTGTTGG - Intergenic
1040694552 8:49979822-49979844 CTGTGCGTGCGTGTGTGTGCAGG + Intronic
1042228574 8:66534676-66534698 GCGCGCGCGCATGTGTGTGTGGG + Intergenic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1047871955 8:129093798-129093820 GTGCACGTGCCTGTGTGTGCAGG + Intergenic
1048308294 8:133298477-133298499 GCGCGCGTGTGTGTCTGTGGAGG - Intronic
1048995671 8:139792406-139792428 GCGTGTGCGCGTGTGTGCGTGGG + Intronic
1049013021 8:139900194-139900216 GCCCGTGTGCGTGTGTGCCTGGG + Intronic
1049530315 8:143151271-143151293 GAGCACGCGTGTGTGTGCGCAGG - Intergenic
1050349042 9:4721937-4721959 GCACGCGTGCCTGTGTGCGAAGG + Intronic
1050964939 9:11788017-11788039 GTGCGCGCGCGTGTGTGTGCAGG + Intergenic
1051167268 9:14277316-14277338 GTGCGTGCACGTGTGTGCGCGGG - Intronic
1051752498 9:20357976-20357998 GTGTGTGTGTGTGTGTGCGCAGG - Intronic
1053137120 9:35658292-35658314 GCTCGCGTGCGCGTGCGCGTTGG + Exonic
1053299627 9:36939835-36939857 GCTCGCGTGCGGGTGCACGCTGG + Intronic
1053308978 9:37003253-37003275 GTGCGCGTGAGTTTGTGCTCAGG - Intronic
1055266478 9:74499562-74499584 GCACCCGTGTGTGTGCGCGCTGG + Intronic
1056126205 9:83538284-83538306 GCGAGCGTGTGTGTCCGCGCAGG - Exonic
1057721778 9:97537310-97537332 TCGTGCGTGCCTGTGTGTGCGGG + Intronic
1057869891 9:98709288-98709310 GGGCGCGTGTGTGCGTGTGCTGG - Intergenic
1059145645 9:111897029-111897051 GCGCGCGGGCGGGGGCGCGCAGG + Exonic
1060887980 9:127168921-127168943 ACGCGTGTGCTTGTGTGTGCTGG - Intronic
1060984054 9:127809774-127809796 GCGCGCAGGCCTGCGTGCGCTGG + Exonic
1061627219 9:131848216-131848238 GTGCGCGTGTGTGTGTGTGTGGG + Intergenic
1062325562 9:136010927-136010949 GTGTGTGTGCGTGTGTGTGCAGG - Exonic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1185513469 X:680408-680430 GCACGTGTGTGTGTGTGTGCAGG + Intergenic
1185559581 X:1049358-1049380 GCATGCGTGTGTGTGTGCACGGG - Intergenic
1188213885 X:27454558-27454580 GCACGTGTGTGTGTGTGTGCAGG - Intergenic
1188612286 X:32115408-32115430 GCGCGCGTGTGTGTGTGTAGAGG + Intronic
1189545554 X:42038905-42038927 GCGTGCGTGTGTGTGTGTGTAGG + Intergenic
1192234417 X:69286594-69286616 GTGTGCGTGTGTGTGTGCGGCGG + Intergenic
1192436482 X:71146371-71146393 GTGTGTGTGCGTGTGTGTGCGGG + Intronic
1194915556 X:99703537-99703559 GTGTGCGTGCGTGTGTGTGTAGG + Intergenic
1197735082 X:129844185-129844207 GCGCGCGCGTGTGTGTAGGCTGG - Intergenic
1197735083 X:129844189-129844211 GCGCGCGCGCGCGTGTGTGTAGG - Intergenic
1197782495 X:130171917-130171939 CCGCCCGTGTGTGCGTGCGCCGG - Exonic
1198160059 X:133999287-133999309 GCGCGCGTGCGTGTGTTTTGAGG + Intergenic
1198520689 X:137449397-137449419 GCGCGCGTGTGTGTGTTGGTAGG + Intergenic
1200136842 X:153879433-153879455 GTGCACGTGCGCGTGCGCGCAGG + Intronic