ID: 1172587327

View in Genome Browser
Species Human (GRCh38)
Location 20:36093716-36093738
Sequence TGCGCGCGCGTGTGTGGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172587325_1172587327 24 Left 1172587325 20:36093669-36093691 CCGTGTGCGTGCGTGCGTGCGTG No data
Right 1172587327 20:36093716-36093738 TGCGCGCGCGTGTGTGGATGTGG No data
1172587324_1172587327 25 Left 1172587324 20:36093668-36093690 CCCGTGTGCGTGCGTGCGTGCGT No data
Right 1172587327 20:36093716-36093738 TGCGCGCGCGTGTGTGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172587327 Original CRISPR TGCGCGCGCGTGTGTGGATG TGG Intronic