ID: 1172587327 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:36093716-36093738 |
| Sequence | TGCGCGCGCGTGTGTGGATG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1172587325_1172587327 | 24 | Left | 1172587325 | 20:36093669-36093691 | CCGTGTGCGTGCGTGCGTGCGTG | No data | ||
| Right | 1172587327 | 20:36093716-36093738 | TGCGCGCGCGTGTGTGGATGTGG | No data | ||||
| 1172587324_1172587327 | 25 | Left | 1172587324 | 20:36093668-36093690 | CCCGTGTGCGTGCGTGCGTGCGT | No data | ||
| Right | 1172587327 | 20:36093716-36093738 | TGCGCGCGCGTGTGTGGATGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1172587327 | Original CRISPR | TGCGCGCGCGTGTGTGGATG TGG | Intronic | ||