ID: 1172588508

View in Genome Browser
Species Human (GRCh38)
Location 20:36101544-36101566
Sequence GCTCCCTTGCCTATGAAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172588508_1172588512 10 Left 1172588508 20:36101544-36101566 CCACTCTTCATAGGCAAGGGAGC No data
Right 1172588512 20:36101577-36101599 TTTGTGAAACACCTAAAAGGGGG No data
1172588508_1172588510 8 Left 1172588508 20:36101544-36101566 CCACTCTTCATAGGCAAGGGAGC No data
Right 1172588510 20:36101575-36101597 AATTTGTGAAACACCTAAAAGGG No data
1172588508_1172588511 9 Left 1172588508 20:36101544-36101566 CCACTCTTCATAGGCAAGGGAGC No data
Right 1172588511 20:36101576-36101598 ATTTGTGAAACACCTAAAAGGGG No data
1172588508_1172588509 7 Left 1172588508 20:36101544-36101566 CCACTCTTCATAGGCAAGGGAGC No data
Right 1172588509 20:36101574-36101596 CAATTTGTGAAACACCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172588508 Original CRISPR GCTCCCTTGCCTATGAAGAG TGG (reversed) Intronic