ID: 1172588509

View in Genome Browser
Species Human (GRCh38)
Location 20:36101574-36101596
Sequence CAATTTGTGAAACACCTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172588505_1172588509 15 Left 1172588505 20:36101536-36101558 CCACAGAGCCACTCTTCATAGGC No data
Right 1172588509 20:36101574-36101596 CAATTTGTGAAACACCTAAAAGG 0: 1
1: 0
2: 0
3: 18
4: 184
1172588508_1172588509 7 Left 1172588508 20:36101544-36101566 CCACTCTTCATAGGCAAGGGAGC 0: 1
1: 0
2: 1
3: 30
4: 190
Right 1172588509 20:36101574-36101596 CAATTTGTGAAACACCTAAAAGG 0: 1
1: 0
2: 0
3: 18
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172588509 Original CRISPR CAATTTGTGAAACACCTAAA AGG Intronic
904508678 1:30982417-30982439 TAATTTGTGGATCACCTTAATGG + Intronic
908587499 1:65587313-65587335 ATATTTGAAAAACACCTAAAAGG + Intronic
911113629 1:94219293-94219315 GAATTGGAGAAACACCTAACAGG - Intronic
912763570 1:112389289-112389311 AAATTTGTGACTCACCCAAAGGG + Intergenic
912976626 1:114336865-114336887 AAATCGATGAAACACCTAAAAGG + Intergenic
913554098 1:119947729-119947751 CAAATTGGAAAACACCCAAATGG + Intronic
917132593 1:171757782-171757804 AAATTTGTGAAATTCATAAAAGG - Intergenic
917521265 1:175750141-175750163 CCAGGTGAGAAACACCTAAATGG + Intergenic
917667940 1:177243748-177243770 CAATTTATGAGAGACATAAAAGG + Intronic
919126397 1:193398369-193398391 CAAATTGTGAAACAAATATAAGG + Intergenic
920802719 1:209204593-209204615 CAATTTATGAAACTCCCACAAGG + Intergenic
921659716 1:217787115-217787137 GAATTTGAGAAAAACTTAAAAGG - Intronic
1064508139 10:16056390-16056412 AAATTTGTGAGACACATGAATGG - Intergenic
1065782559 10:29183655-29183677 CAATTTGTGACAACACTAAAGGG - Intergenic
1066363020 10:34749139-34749161 CAATTTTGGAAACAGATAAAGGG - Intronic
1067332067 10:45331652-45331674 CAAGTTCTTAAACACCTACAAGG - Intergenic
1067565568 10:47334070-47334092 CAACTTCTGAAACTACTAAAAGG + Intergenic
1071835983 10:89417371-89417393 GCCTATGTGAAACACCTAAAAGG + Exonic
1074840686 10:117347737-117347759 GAATTAGTGAAACACATAATGGG + Intronic
1078089554 11:8256299-8256321 CAAAGGGTGAAACACCTAACTGG - Intronic
1081161258 11:39752109-39752131 TAATTTTTGAATCACCAAAATGG - Intergenic
1086096344 11:83053695-83053717 CAATTTGTCAAATATCTATAAGG - Intronic
1086651188 11:89293049-89293071 CAGTTTGTAAAATTCCTAAAAGG - Intronic
1088202711 11:107357218-107357240 CAATGTTTGAAACACAGAAAGGG + Intronic
1090500655 11:127257651-127257673 CAAGCTGTGAAACACCCAGAAGG - Intergenic
1092840396 12:12534852-12534874 CCATGTGTGAAACACCAAACTGG - Intronic
1093860767 12:24163903-24163925 CAATTTGTGAAAAAACAAAAAGG + Intergenic
1094042221 12:26130109-26130131 CACTTTGTGAAAGTCCTTAATGG - Intronic
1094254972 12:28413033-28413055 CAATTTGTGAGACAAATAAATGG - Intronic
1099359414 12:81681290-81681312 CAAGGTGTGAAAAACCTAAGTGG + Intronic
1099982145 12:89617025-89617047 AAGATTTTGAAACACCTAAAAGG + Exonic
1103798235 12:123519841-123519863 CAATCTGAGACACACTTAAATGG - Intronic
1104185653 12:126428112-126428134 CAACCTGTGAAACACAGAAAGGG - Intergenic
1107534765 13:41317745-41317767 CAATATGTAAAACAGATAAAAGG + Intronic
1109315657 13:60746032-60746054 GAATTTGTGAAACAGCTGCATGG + Intergenic
1109798107 13:67342633-67342655 AACTTTGAGAAAAACCTAAAAGG - Intergenic
1112759241 13:102674447-102674469 CATTTTGGGAAACTACTAAATGG + Exonic
1113895738 13:113763510-113763532 CAATTTGTTAAAAACCTGAAAGG - Intronic
1115177722 14:30583709-30583731 CATATTGTGGAACAGCTAAATGG - Intronic
1115200230 14:30845263-30845285 CAAATTATGAAACTACTAAAAGG - Intergenic
1116132540 14:40875191-40875213 CAGTTTGTTAAAAATCTAAAAGG + Intergenic
1116345750 14:43791190-43791212 CAATGTCTGAAACAACTACATGG + Intergenic
1118259302 14:64232828-64232850 CCCTTTGTGAAACATCTTAAAGG - Intronic
1120072329 14:80117594-80117616 CAAATTGTTCAAAACCTAAATGG + Intergenic
1121057471 14:90871118-90871140 CAATGTGAGGAAAACCTAAAGGG - Exonic
1122830135 14:104391896-104391918 CACTTGGAGGAACACCTAAAGGG + Intergenic
1125810488 15:42536288-42536310 CTATTTGTGAAAAAACTTAATGG + Intronic
1126207247 15:46059679-46059701 CAATTTATGAATAACATAAATGG - Intergenic
1126622073 15:50650273-50650295 CAATTTCTGAAGCTCATAAAGGG + Intronic
1126871735 15:52996593-52996615 CAATTTTACAAACACCTATAAGG - Intergenic
1127563600 15:60164943-60164965 CAATTTGGGGAACACCCACATGG - Intergenic
1127794942 15:62429347-62429369 CGATTTTCGAAGCACCTAAAGGG - Intronic
1128448649 15:67787223-67787245 AAATTTGAGAAACAGCCAAAGGG - Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1134293076 16:12919338-12919360 CTATTTGTGAAACACCAAGAAGG + Intronic
1135921733 16:26656064-26656086 AAATTTGTGAGACAGCTAAAAGG - Intergenic
1135978526 16:27127950-27127972 CTATTTCTGAAACAGGTAAAAGG + Intergenic
1137266909 16:46876439-46876461 CAATTTCAGAAACACCCCAAGGG - Intergenic
1138359113 16:56411530-56411552 GAATTTGTGAAACATTTACATGG - Intronic
1138941806 16:61800546-61800568 CAATTTATGAAAGTCCTTAATGG - Intronic
1140905355 16:79404728-79404750 GAATTTGTGAAACCCAAAAAGGG + Intergenic
1147872700 17:43598704-43598726 CAATCTGTGAAACAGACAAAAGG - Intergenic
1151072285 17:71229061-71229083 CAAATAGAGAAACACCTAATTGG - Intergenic
1153382794 18:4456657-4456679 CAATTACTGAAACCACTAAATGG + Intergenic
1153696559 18:7648941-7648963 CAACTTATGAAAGACCTAGATGG - Intronic
1158767322 18:60469399-60469421 CAATTTGTGAAACTCACACAGGG - Intergenic
1159577473 18:70197371-70197393 CCATTTATGGATCACCTAAATGG - Intronic
1168044236 19:53782529-53782551 TAATATGTGGAACACCTAAAAGG - Intergenic
925397491 2:3546073-3546095 CAATTTGTGAAAAAACAAAATGG - Intronic
925626680 2:5848142-5848164 AAATTTGTTAAACAACAAAAGGG - Intergenic
926532873 2:14072628-14072650 ATATTTGTGAAACAACTGAAAGG - Intergenic
928085806 2:28345615-28345637 CAACTTGTGCCAAACCTAAAAGG - Intergenic
929113229 2:38422794-38422816 CAATTTGTGCAGCACATACAAGG - Intergenic
930794695 2:55376786-55376808 CTATGTGTGTAACAGCTAAATGG + Intronic
931086419 2:58835807-58835829 CAATTTGGAAAACTCCCAAATGG + Intergenic
932616614 2:73235449-73235471 CATTTGGTAGAACACCTAAAAGG - Intronic
934988823 2:98906616-98906638 CAATTTAAGAAACAACCAAATGG - Intronic
935353790 2:102179138-102179160 AAATTTGTAAAACATCTAATAGG - Exonic
935892953 2:107699680-107699702 AAATCTGTGAAACCCCTACATGG - Intergenic
936117257 2:109712067-109712089 CAATTTGTTCAAAACCAAAATGG - Intergenic
937665472 2:124482573-124482595 CCATTTCTGAAACACCTCATTGG - Intronic
937773706 2:125751112-125751134 ACATTTGTGAAACACTTATATGG + Intergenic
939137216 2:138311811-138311833 CAAGTTGTGTAATTCCTAAAAGG + Intergenic
939663530 2:144920486-144920508 CAATTTGTGGCACATCAAAATGG - Intergenic
940362323 2:152809872-152809894 CAATTATTAAAAGACCTAAAGGG - Intergenic
940363242 2:152818120-152818142 CCCTTTGTGAACCCCCTAAAAGG - Intergenic
941339916 2:164294259-164294281 GAAATTATGAAACACATAAATGG + Intergenic
941981493 2:171462893-171462915 AAATTTGTGATACAGCTATATGG - Intronic
942532765 2:176929765-176929787 CAATTCCTGAAAGAGCTAAAAGG - Intergenic
942646988 2:178122878-178122900 GAGTTTGTGACACAACTAAAAGG - Intronic
943306893 2:186273767-186273789 CAATTTTTGAAACTCAGAAATGG - Intergenic
944681150 2:202078015-202078037 CAATTTGGCAAAAGCCTAAAAGG + Intronic
944919742 2:204399742-204399764 AAATTTATCAAAGACCTAAATGG + Intergenic
1169778257 20:9280038-9280060 CCATTTGTGAAATACAAAAAGGG - Intronic
1169860212 20:10143389-10143411 CATTTTGTGAAACACAGTAAGGG + Intergenic
1171070620 20:22064902-22064924 CAATCTGTTAACCACATAAATGG + Intergenic
1172588509 20:36101574-36101596 CAATTTGTGAAACACCTAAAAGG + Intronic
1173370072 20:42427296-42427318 AAGTTTGAGAAACACTTAAAAGG - Intronic
1177963801 21:27702190-27702212 CCAATTTTGAACCACCTAAATGG - Intergenic
1183876344 22:40785447-40785469 CCATTTGGGAAAAACCTAAAAGG + Intronic
1185400218 22:50611657-50611679 CAATTTCGGAAAGAGCTAAAAGG - Intronic
950793874 3:15494898-15494920 CTATGTGTGAATCACTTAAATGG - Intronic
951721414 3:25702170-25702192 CAATTTTTGGAAATCCTAAATGG + Intergenic
951744706 3:25964737-25964759 CAATTTGTGGAATAAATAAATGG + Intergenic
952650155 3:35716504-35716526 AAAATTGAGAAACACATAAAAGG + Intronic
952848085 3:37705376-37705398 CAAGTTGTTAAAGGCCTAAAAGG + Intronic
952938258 3:38418379-38418401 AATTTTGTGAAACTCCTAAAGGG + Intronic
957440931 3:80246489-80246511 AAATTAATCAAACACCTAAAAGG - Intergenic
957873848 3:86119639-86119661 CAATTTGTGAATCCCTTAAAAGG - Intergenic
962986285 3:140538998-140539020 CACTCTGTGAAACATCTTAAAGG + Intronic
963298224 3:143571034-143571056 CAATTTCTGAAACCAATAAAAGG + Intronic
964573447 3:158138012-158138034 CAAGATGTGAAACACTAAAATGG - Intronic
965879897 3:173376168-173376190 CAATTCATTAAAGACCTAAATGG - Intergenic
967289323 3:187903729-187903751 CAGTTTGTGATACAAGTAAATGG - Intergenic
970224017 4:13838497-13838519 CATTTTGTGAGACCTCTAAAGGG + Intergenic
972152435 4:36110492-36110514 CAAGATGTGAAAAACCTAGAAGG + Intronic
974433446 4:61828170-61828192 AAATTTGTGAAACAAAGAAAAGG - Intronic
974437358 4:61873586-61873608 CAATTTGTGAAATGGCTCAAAGG - Intronic
975256977 4:72248192-72248214 CATATAGTGAAAGACCTAAATGG + Intergenic
976022183 4:80642386-80642408 TAATTTGTGAAATGCCTAAATGG - Intronic
976805718 4:89044499-89044521 CAAAGTGGGAAACAACTAAATGG + Intronic
977014371 4:91674455-91674477 AAATTTATGAAACACTGAAATGG - Intergenic
978106506 4:104907817-104907839 CAGTTTGTGAAAAAGCGAAATGG - Intergenic
978746936 4:112205537-112205559 GAATTTGGGAAACATATAAAGGG + Intergenic
979451825 4:120881357-120881379 CAATTTGTGGAACTATTAAAAGG - Intronic
980468976 4:133225752-133225774 CAATTTATAAAACAACTGAATGG + Intergenic
984582874 4:181530916-181530938 TAATTTGTGAAACACAGAACTGG - Intergenic
990387699 5:55283407-55283429 CAATTGTTGAAACTCTTAAAAGG - Exonic
991378004 5:65986559-65986581 GAAATTCTGAAACACATAAATGG + Intronic
991431748 5:66555241-66555263 CAGTTTCTCAAACAGCTAAACGG - Intergenic
992543884 5:77791506-77791528 TACTTTGTGAAACATTTAAAAGG + Intronic
992993722 5:82312282-82312304 AAATTTGAGAAAAACTTAAATGG - Intronic
993241633 5:85395846-85395868 CAAATTTTAAAAGACCTAAAGGG - Intergenic
993390270 5:87312545-87312567 CAATTTTTTAAACATCTGAACGG + Intronic
994283202 5:97931104-97931126 CATTTTGTTAAACACTGAAAGGG + Intergenic
994471167 5:100209989-100210011 ACATTTTTGAAACAGCTAAAAGG - Intergenic
994994765 5:107045915-107045937 CAATCTTTGAGACACTTAAAAGG + Intergenic
995281048 5:110336088-110336110 CAATTTGGGGAACAATTAAAGGG + Intronic
995364199 5:111337216-111337238 CAATTTGTGATACATCCATATGG - Intronic
995957113 5:117790554-117790576 CAATTTGACAAGCACCTAACTGG - Intergenic
997009270 5:129857736-129857758 CAATGTGTGAAAGGCCTAGAAGG + Intergenic
999445701 5:151637412-151637434 CAATTTGTGAATCTCTAAAAGGG + Intergenic
1000006960 5:157194615-157194637 CACTTTGGGAAACACCAAATTGG - Intronic
1001631447 5:173178437-173178459 CACTTTGTGTAACACCTTTAAGG - Intergenic
1001869174 5:175135737-175135759 AATTTTGTGAAAGATCTAAAAGG + Intergenic
1004488954 6:16095547-16095569 CAATTTAAGAGACACCTAAGCGG - Intergenic
1004576026 6:16895932-16895954 AAATTTGTCAAACAACAAAAGGG - Intergenic
1004656896 6:17671606-17671628 AAATTTATAAACCACCTAAATGG + Intronic
1005405412 6:25482277-25482299 CAATTTGCCAAACTCCCAAAGGG + Exonic
1008216712 6:48798648-48798670 AAATTTGTAAAATACATAAAGGG - Intergenic
1013662476 6:112311657-112311679 CATCTGGTGAAACACCAAAATGG - Intergenic
1016024621 6:139273385-139273407 CAATTTATGAAACACCTGTAGGG - Intronic
1016339807 6:143050218-143050240 CAATTTAAGTAAAACCTAAAGGG + Intergenic
1018798429 6:167205002-167205024 CAATTTGTGAAACTCTTAATAGG - Intergenic
1018814286 6:167319173-167319195 CAATTTATGAAACTCTTAATAGG + Intergenic
1020492319 7:8802813-8802835 CTATTTGTAAAATACTTAAATGG + Intergenic
1021308222 7:19058436-19058458 CAAAGTTTGATACACCTAAATGG + Intronic
1023944276 7:44791317-44791339 AAATTTGTGAAAAAGCTAAAGGG + Intergenic
1026529687 7:71186077-71186099 CCATTTTTGGAAAACCTAAATGG - Intronic
1027352173 7:77323545-77323567 TAATTTGAAAAACACATAAATGG + Intronic
1027352193 7:77323699-77323721 CATTTTTTGAGACACCTACAGGG - Exonic
1028009806 7:85627339-85627361 CAATTAGTTAACCACTTAAAAGG + Intergenic
1030940493 7:115640986-115641008 CAATTTGTAAAACACCCACATGG - Intergenic
1032596414 7:133245541-133245563 CAGTTTGTGAAACAATTATACGG + Intergenic
1033727543 7:144135410-144135432 CATTTTCTGAAACACAAAAAGGG + Intergenic
1036179812 8:6574557-6574579 AAATTTTGAAAACACCTAAAGGG + Intronic
1037230584 8:16653212-16653234 AAAATTCTGAAACAACTAAAAGG - Intergenic
1040722831 8:50347100-50347122 CTATTTGAGAAAGTCCTAAATGG - Intronic
1042679791 8:71370284-71370306 AGATTTCTGAACCACCTAAAAGG - Intergenic
1043739835 8:83797025-83797047 CAATCTGTGAAACTACTAACAGG - Intergenic
1047147725 8:122223614-122223636 CAATTTGTGAAACAACAACAAGG + Intergenic
1047608104 8:126494614-126494636 CAATTTCAGAAATACCAAAATGG + Intergenic
1048788180 8:138074361-138074383 CATTTGGTTAAACCCCTAAAGGG - Intergenic
1049019176 8:139942060-139942082 TAATTTGTAAAACACAGAAAAGG - Intronic
1050070889 9:1812709-1812731 CGTTTTGAGAAACACCTAATGGG + Intergenic
1050507985 9:6367060-6367082 AACTTTGTGAAAAACCTACATGG + Intergenic
1051790121 9:20792473-20792495 CAATTTGTCAAACTCATCAATGG - Intronic
1051967221 9:22843893-22843915 AAACTTGTGAACCACCTAAAAGG - Intergenic
1052030549 9:23623147-23623169 CAATTTTTAAAACATCTAATGGG - Intergenic
1055106372 9:72517353-72517375 AAATATGTGAAAAACCAAAATGG - Intergenic
1055230576 9:74059356-74059378 CATGTTCTGAAACACCTAGAAGG - Intergenic
1055359826 9:75477737-75477759 CACTTTGTGAAAAGCCAAAAAGG - Intergenic
1056014050 9:82363492-82363514 TAATTTGGGTAACATCTAAAAGG + Intergenic
1061763265 9:132865133-132865155 CTAATTGTGAAACAGCAAAATGG + Intronic
1062683074 9:137794155-137794177 TATTCTTTGAAACACCTAAATGG + Intronic
1186013070 X:5159279-5159301 TAATTTGTGTAATACCTATAAGG - Intergenic
1186140396 X:6565990-6566012 CAATCTGTGAAACCCATGAAAGG - Intergenic
1188298297 X:28477071-28477093 CAAACTGTGAAACAACTAGAAGG - Intergenic
1188386303 X:29563489-29563511 CAATTTGAAAAACATGTAAATGG - Intronic
1189507799 X:41630192-41630214 CAATATGTCAAACATCAAAATGG + Intronic
1189611704 X:42743575-42743597 TATTTACTGAAACACCTAAATGG - Intergenic
1191818080 X:65270966-65270988 CAATTTGGGAAACATCTACATGG + Intergenic
1194213222 X:91094646-91094668 CCACTTGTGAAACACCTTTAAGG + Intergenic
1196227320 X:113181335-113181357 GATTTTGTGAAACACCCCAATGG + Intergenic
1196583793 X:117406142-117406164 AAATCTGTCCAACACCTAAATGG + Intergenic
1197058545 X:122149354-122149376 CAAATTGTGATAAACATAAAAGG + Intergenic
1198661533 X:138974049-138974071 CATGTTGTGATACACCAAAAAGG + Intronic
1199364859 X:146969379-146969401 CAACTTGGAAAACACATAAAAGG + Intergenic
1199383395 X:147195636-147195658 CAACTTGGAAAACACATAAAAGG - Intergenic
1202166114 Y:21990322-21990344 TAATTTATGTAACCCCTAAAGGG + Intergenic
1202225244 Y:22596051-22596073 TAATTTATGTAACCCCTAAAGGG - Intergenic
1202317869 Y:23599610-23599632 TAATTTATGTAACCCCTAAAGGG + Intergenic
1202552897 Y:26070448-26070470 TAATTTATGTAACCCCTAAAGGG - Intergenic