ID: 1172588510

View in Genome Browser
Species Human (GRCh38)
Location 20:36101575-36101597
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172588508_1172588510 8 Left 1172588508 20:36101544-36101566 CCACTCTTCATAGGCAAGGGAGC No data
Right 1172588510 20:36101575-36101597 AATTTGTGAAACACCTAAAAGGG No data
1172588505_1172588510 16 Left 1172588505 20:36101536-36101558 CCACAGAGCCACTCTTCATAGGC No data
Right 1172588510 20:36101575-36101597 AATTTGTGAAACACCTAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type