ID: 1172588528

View in Genome Browser
Species Human (GRCh38)
Location 20:36101631-36101653
Sequence CTCCTAGGGTTCCCTAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172588513_1172588528 20 Left 1172588513 20:36101588-36101610 CCTAAAAGGGGGAGCAGCTTAGC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1172588528 20:36101631-36101653 CTCCTAGGGTTCCCTAAGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 88
1172588515_1172588528 -5 Left 1172588515 20:36101613-36101635 CCCACCCCATTCCCCTCCCTCCT 0: 1
1: 0
2: 27
3: 263
4: 2104
Right 1172588528 20:36101631-36101653 CTCCTAGGGTTCCCTAAGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 88
1172588516_1172588528 -6 Left 1172588516 20:36101614-36101636 CCACCCCATTCCCCTCCCTCCTA 0: 1
1: 0
2: 7
3: 155
4: 1702
Right 1172588528 20:36101631-36101653 CTCCTAGGGTTCCCTAAGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 88
1172588514_1172588528 -4 Left 1172588514 20:36101612-36101634 CCCCACCCCATTCCCCTCCCTCC No data
Right 1172588528 20:36101631-36101653 CTCCTAGGGTTCCCTAAGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 88
1172588518_1172588528 -9 Left 1172588518 20:36101617-36101639 CCCCATTCCCCTCCCTCCTAGGG 0: 1
1: 0
2: 14
3: 51
4: 408
Right 1172588528 20:36101631-36101653 CTCCTAGGGTTCCCTAAGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 88
1172588520_1172588528 -10 Left 1172588520 20:36101618-36101640 CCCATTCCCCTCCCTCCTAGGGT 0: 1
1: 0
2: 2
3: 35
4: 288
Right 1172588528 20:36101631-36101653 CTCCTAGGGTTCCCTAAGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172588528 Original CRISPR CTCCTAGGGTTCCCTAAGGC TGG Intronic
904388174 1:30161066-30161088 CTCATAGGTTTCCCTATGCCAGG + Intergenic
911155022 1:94628491-94628513 CTGCTAGGGTGCCCTAATGGAGG - Intergenic
911317805 1:96376221-96376243 CTCACAGGGTTCCCTAGGGAGGG + Intergenic
914914440 1:151810244-151810266 CTCCTATTGTTCCCTAAGCCTGG + Intronic
915021061 1:152778677-152778699 GTCCTGTGGCTCCCTAAGGCAGG + Intronic
916142817 1:161713908-161713930 CACCTAGGGTTTCATTAGGCTGG - Exonic
917601462 1:176578407-176578429 TTACTAGGGTTCCCCAAGACTGG + Intronic
921272868 1:213488427-213488449 CTCCTAGGCTTCCCACTGGCAGG + Intergenic
1064717263 10:18189551-18189573 CTCCTAGCGTTTGCTATGGCAGG + Intronic
1067217592 10:44315968-44315990 CCCCTGGGGCTCCCTCAGGCAGG + Intergenic
1068973283 10:62981503-62981525 CTACTAGGATTCCTTAGGGCAGG - Intergenic
1072899264 10:99393016-99393038 TTCCAAGTTTTCCCTAAGGCTGG - Exonic
1073467141 10:103700814-103700836 CTCCCATGGTTCCCTAGGTCTGG - Intronic
1073650246 10:105351287-105351309 CTCATAGGGTTCCCCAAGTTAGG + Intergenic
1076111267 10:127861477-127861499 CTCTTGGCTTTCCCTAAGGCTGG - Intergenic
1076406370 10:130214834-130214856 CTCCTAGGGCTCTCCAAGGCTGG - Intergenic
1077218972 11:1407037-1407059 CTCCTAGGGTTTCCCAGGGAAGG + Intronic
1085651783 11:78274762-78274784 CCCCCAGGGGTCCCTATGGCAGG - Intronic
1092771824 12:11903888-11903910 CTCCTAGGTTTTCCTCAGGTAGG - Intergenic
1100469600 12:94878463-94878485 ATCCCAGGGTTCCCTAAGAATGG - Intergenic
1102081867 12:110104699-110104721 CTCCAAGGTTTCCCTCAGGGTGG - Intergenic
1104974521 12:132546456-132546478 CTCCTAGGGTTCCCCCGGTCTGG - Intronic
1109454914 13:62573286-62573308 CTCCTAGGCCTCCCAAATGCTGG - Intergenic
1115116915 14:29891591-29891613 CTCCTATGACTCTCTAAGGCAGG + Intronic
1118772799 14:68953238-68953260 TTCCTAGGTTTCCCCAATGCCGG + Intronic
1119605217 14:76010041-76010063 CTCCTCGGCCTCCCAAAGGCTGG + Intronic
1124038093 15:26075079-26075101 CTCTTAAGGTTCCCTGAGGGAGG - Intergenic
1124652952 15:31486330-31486352 CTCCCAGGGCTCCATGAGGCAGG - Intronic
1131132815 15:89910955-89910977 CTCCAAAGGGTCCCAAAGGCTGG + Intronic
1134482822 16:14633313-14633335 CTCCTGGGGCTCCCTAGGGCGGG + Intronic
1136178637 16:28535957-28535979 CTCCTTGGCCTCCCAAAGGCTGG + Intronic
1138334811 16:56244707-56244729 CACCCAGGGTTCCCTGTGGCAGG + Intronic
1146750608 17:35374543-35374565 GGCCTAGGGTTCCGCAAGGCTGG - Intergenic
1148910750 17:50941259-50941281 CTTCTACAGTTCCCTAGGGCTGG + Intergenic
1149368080 17:55965572-55965594 TTCCTAGGGTAGCCTACGGCAGG + Intergenic
1151953202 17:77366651-77366673 CTCCCAGGGTTCCATCAGGTTGG + Intronic
1156807304 18:41200793-41200815 CTCCCAGAAATCCCTAAGGCAGG - Intergenic
1159954258 18:74508148-74508170 CTCCTCTGGTTCCATGAGGCCGG + Intronic
1160389858 18:78521849-78521871 CTCCTGGGGTGTCCGAAGGCCGG - Intergenic
1163086634 19:14985712-14985734 CTCCTTGGCCTCCCAAAGGCTGG - Intronic
1164853284 19:31501942-31501964 CTCCTGGGCTTCCTTAGGGCTGG + Intergenic
1165146277 19:33732844-33732866 CTCACAAGGTTCCCTAAGGTAGG + Intronic
1165431666 19:35776442-35776464 CCCATAAGGTTCCCCAAGGCAGG - Intronic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
926275162 2:11397993-11398015 CTCCTTGAGTTCCATAAGGGTGG + Intergenic
934558050 2:95297704-95297726 CTCCTAGGGCTCCCTTTGGATGG + Intronic
938310599 2:130286146-130286168 CTCCTGGGGTACCCTAGGGAAGG - Intergenic
938919876 2:135985504-135985526 CTCGCAGGCTTCCGTAAGGCAGG + Exonic
939953819 2:148508127-148508149 CACCTAGGGTTTGCTGAGGCTGG - Intronic
1169052669 20:2594072-2594094 CTCCAAGGGCTTCCTAAGGCTGG + Intronic
1170351608 20:15447712-15447734 TTCCTGGGGTTTCCTAAGGATGG - Intronic
1172588528 20:36101631-36101653 CTCCTAGGGTTCCCTAAGGCTGG + Intronic
1175809689 20:61851386-61851408 CTCCTGGGTTTCCCTGGGGCAGG + Intronic
1178625172 21:34210283-34210305 CACCTTGGCTTCCCAAAGGCTGG + Intergenic
1179596135 21:42444298-42444320 TTCCTAGGCCTCCCTGAGGCTGG + Intronic
1180669632 22:17542937-17542959 CTCCCAGGGTTGCCCAGGGCAGG - Exonic
1182365613 22:29776977-29776999 CTTCTAGGGTACCCTCTGGCTGG - Intergenic
1185418393 22:50721839-50721861 CTGCTGGGCTTCCCTGAGGCCGG - Intergenic
953004943 3:38969462-38969484 CTCCCTGTGTTCCCTAAGGAGGG - Intergenic
953494473 3:43374144-43374166 TTCCTAGGGTTCCCTGTGCCAGG + Intronic
958500075 3:94894192-94894214 CTCCTTGGCCTCCCAAAGGCTGG + Intergenic
959903667 3:111687048-111687070 CTCAGAGAGTTGCCTAAGGCTGG - Intronic
964094824 3:152918955-152918977 CTCCTAGGCCTCCCAAATGCTGG - Intergenic
973334389 4:48941668-48941690 CTATTAGGGTTCCCTGGGGCTGG + Intergenic
977216612 4:94292631-94292653 CTCCTCGGCCTCCCAAAGGCTGG + Intergenic
978867604 4:113533088-113533110 CTCCTAAGCTTCCCTAAGATAGG + Intronic
979019345 4:115476163-115476185 CTCCTAGTGTCCACTAAAGCAGG + Intergenic
981960586 4:150533419-150533441 CTCCTTGGGCTCCCAAAGGCTGG + Intronic
982439803 4:155422467-155422489 CGCCTTGGCTTCCCAAAGGCTGG - Intergenic
989627437 5:43443882-43443904 CTCCTATGGGTCTCTAATGCTGG - Intergenic
1001510182 5:172315051-172315073 CTTCTAGGGGTCCATGAGGCAGG + Intergenic
1004417139 6:15435393-15435415 CAGCTAGGATTCCCAAAGGCTGG - Intronic
1006511911 6:34526079-34526101 CTCTTGGGGTTACCTAAGTCTGG + Intronic
1013808462 6:114018319-114018341 CTCGTAGGGTACCCGAAGTCCGG - Intergenic
1018289045 6:162271942-162271964 CTTCTCTGGTTCCCAAAGGCAGG + Intronic
1026312797 7:69202318-69202340 CTCCAATGCTTCCTTAAGGCAGG - Intergenic
1029272300 7:99384565-99384587 CTCCTTCAGTTCCCCAAGGCTGG + Intronic
1030412984 7:109204899-109204921 CTCCTAAAGTTCCTCAAGGCAGG - Intergenic
1032733763 7:134671165-134671187 CACCTAGGGTTCACTAAATCAGG + Intronic
1034386639 7:150746009-150746031 CTCCTTGCTTTCCCCAAGGCAGG + Intronic
1045981915 8:108199657-108199679 CTCACATGGTTGCCTAAGGCAGG - Intergenic
1049343210 8:142124816-142124838 CCCCTGGGGTCCCCTGAGGCTGG + Intergenic
1050679652 9:8095568-8095590 CTCCCAGAGTACCCTTAGGCAGG - Intergenic
1058793426 9:108473398-108473420 ATCCTCAGGTTACCTAAGGCCGG + Intergenic
1061955842 9:133960922-133960944 CTCCTGGGCTTCTCCAAGGCCGG - Intronic
1191105225 X:56768318-56768340 CTCCAAGGGGTCCCAATGGCAGG + Intergenic
1191106218 X:56773720-56773742 CTCCAAGGGGTCCCAATGGCAGG + Intergenic
1191107211 X:56779122-56779144 CTCCAAGGGGTCCCAATGGCAGG + Intergenic
1191109574 X:56794132-56794154 CTCCAAGGGGTCCCAACGGCAGG + Intergenic
1195710867 X:107772944-107772966 CTCTCAGGCTTCGCTAAGGCTGG - Intronic
1197380811 X:125736659-125736681 GTCCTGGGGTCCCCTAAGCCAGG - Intergenic
1200083817 X:153592990-153593012 CTCGTAGGTTTCCCTAGAGCTGG - Intronic
1200913358 Y:8550198-8550220 AACCTAGGGTTCCCTATGTCTGG + Intergenic
1201160169 Y:11159810-11159832 CAGCTAGGGTCCCCTCAGGCTGG + Intergenic