ID: 1172589246

View in Genome Browser
Species Human (GRCh38)
Location 20:36105891-36105913
Sequence CAGAATAGGGAAAAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 419}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172589246_1172589252 -8 Left 1172589246 20:36105891-36105913 CCTGCCACCTTTTCCCTATTCTG 0: 1
1: 0
2: 3
3: 40
4: 419
Right 1172589252 20:36105906-36105928 CTATTCTGGAATCTGCTTCCAGG 0: 1
1: 0
2: 2
3: 21
4: 218
1172589246_1172589259 19 Left 1172589246 20:36105891-36105913 CCTGCCACCTTTTCCCTATTCTG 0: 1
1: 0
2: 3
3: 40
4: 419
Right 1172589259 20:36105933-36105955 TCTCCTCCCCTCCTCCCCAGGGG 0: 1
1: 2
2: 10
3: 107
4: 776
1172589246_1172589258 18 Left 1172589246 20:36105891-36105913 CCTGCCACCTTTTCCCTATTCTG 0: 1
1: 0
2: 3
3: 40
4: 419
Right 1172589258 20:36105932-36105954 CTCTCCTCCCCTCCTCCCCAGGG 0: 1
1: 2
2: 9
3: 167
4: 1055
1172589246_1172589262 24 Left 1172589246 20:36105891-36105913 CCTGCCACCTTTTCCCTATTCTG 0: 1
1: 0
2: 3
3: 40
4: 419
Right 1172589262 20:36105938-36105960 TCCCCTCCTCCCCAGGGGGCAGG 0: 1
1: 0
2: 5
3: 63
4: 566
1172589246_1172589260 20 Left 1172589246 20:36105891-36105913 CCTGCCACCTTTTCCCTATTCTG 0: 1
1: 0
2: 3
3: 40
4: 419
Right 1172589260 20:36105934-36105956 CTCCTCCCCTCCTCCCCAGGGGG 0: 1
1: 1
2: 9
3: 107
4: 782
1172589246_1172589257 17 Left 1172589246 20:36105891-36105913 CCTGCCACCTTTTCCCTATTCTG 0: 1
1: 0
2: 3
3: 40
4: 419
Right 1172589257 20:36105931-36105953 CCTCTCCTCCCCTCCTCCCCAGG 0: 1
1: 1
2: 21
3: 233
4: 1535
1172589246_1172589253 -7 Left 1172589246 20:36105891-36105913 CCTGCCACCTTTTCCCTATTCTG 0: 1
1: 0
2: 3
3: 40
4: 419
Right 1172589253 20:36105907-36105929 TATTCTGGAATCTGCTTCCAGGG 0: 1
1: 0
2: 2
3: 25
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172589246 Original CRISPR CAGAATAGGGAAAAGGTGGC AGG (reversed) Intronic
900780084 1:4612270-4612292 CAGAAAAGGGGAGAGGAGGCGGG - Intergenic
901076198 1:6556165-6556187 TAGAAGAGGGAAAAAGCGGCTGG - Intronic
901753889 1:11429275-11429297 GAGAAAGGGGAGAAGGTGGCAGG + Intergenic
901885428 1:12219369-12219391 AAAAAAAGAGAAAAGGTGGCCGG - Intergenic
902179907 1:14679974-14679996 GACAAGAGGGAGAAGGTGGCTGG + Intronic
902184196 1:14712846-14712868 AAGCACAGGGAAAAGGTGGGGGG - Intronic
902223864 1:14984068-14984090 CAGAGTAGAGCAAATGTGGCTGG + Intronic
902687136 1:18085591-18085613 TAGAATAGGGAAAAAGTGATGGG - Intergenic
903536275 1:24068384-24068406 CAGAACAGGGAAAAGGACTCTGG - Intronic
904109332 1:28113112-28113134 CAGAATAGAGAACTGGAGGCGGG + Intergenic
904377082 1:30088407-30088429 CGGAGGAGGGAAAACGTGGCTGG - Intergenic
905278106 1:36832215-36832237 CACAACAGTGAAAAGGTGACAGG - Intronic
906042297 1:42797275-42797297 CAGCAAAGGGAAAAGGTGCATGG + Intergenic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
906737085 1:48140747-48140769 CAGAGTAGGAAAAAGGTTGATGG + Intergenic
907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG + Intronic
908856405 1:68434464-68434486 CAGAATAGGGAAAGGATGGGAGG + Intronic
909323771 1:74323535-74323557 CAGCCGAGGGCAAAGGTGGCTGG + Intronic
912579556 1:110707799-110707821 CAGAGAAGAGAAAAGGAGGCAGG - Intergenic
912653863 1:111468041-111468063 CAGAATATGGCAAAGGTGACAGG + Intergenic
913417191 1:118621601-118621623 AAAAATAGGCAAAATGTGGCCGG - Intergenic
915328395 1:155093123-155093145 CAGAAGAGGGAGGAGGTGGGAGG + Intergenic
915847997 1:159289094-159289116 CAGAATAGTGGAAAGATGGCAGG - Intergenic
916818746 1:168377979-168378001 CAGAATGGGGACAATGTGGCTGG + Intergenic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918315014 1:183316264-183316286 ATGAAGAGGGAAAGGGTGGCAGG + Intronic
918391949 1:184074616-184074638 CAGAATACGGCAAAGGTGATGGG - Intergenic
919390299 1:196975980-196976002 GAGAATAGTGAAAAAGTGTCAGG + Intergenic
920362990 1:205432138-205432160 AAGGGTAGGGAAAAGGTAGCAGG + Intronic
920534690 1:206729853-206729875 CAGGATAGGCAAATGGTTGCTGG + Intronic
921048746 1:211495854-211495876 CAGCAAAGGGGAAAGGTGGAAGG - Intergenic
922493099 1:226034420-226034442 CAGAATATGGCAAAGGTGATGGG + Intergenic
924586238 1:245363490-245363512 AAGAAAAGAGAAAAGGAGGCCGG - Intronic
924819223 1:247472026-247472048 CAGGATAGGGGAAAGCTGGTTGG + Intergenic
924826286 1:247542398-247542420 CAGCATATGGAAAAGGTGGAAGG + Intronic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1062777339 10:163674-163696 CAGAAGAGGGTAAAGGTTGGGGG - Intronic
1063187091 10:3661100-3661122 CAGAATACGGCAAAAGTGACAGG + Intergenic
1063963786 10:11328858-11328880 CAGAAAACAGAAAAGGGGGCTGG - Intronic
1064040789 10:11961498-11961520 CAGAAGAGGGAAGAGGAGGGAGG + Intronic
1064229070 10:13513834-13513856 TAGAATAGGAGAAATGTGGCAGG - Intronic
1064700349 10:18012570-18012592 CAGACTATTGAAAGGGTGGCTGG + Intronic
1065478158 10:26163564-26163586 AAGAATAGGGAAGAGTAGGCTGG + Intronic
1065886644 10:30083729-30083751 CATAAGAAAGAAAAGGTGGCTGG + Intronic
1066076931 10:31888194-31888216 CAGAATAAGGGAGAGGTGCCAGG - Intronic
1067654706 10:48182628-48182650 CAGCATTGCCAAAAGGTGGCTGG + Intronic
1067932003 10:50571452-50571474 CAGGAAATGGAAAAGGTGCCAGG - Intronic
1068462964 10:57351192-57351214 CAGTATGGGGAAAAGTTGCCAGG + Intergenic
1068518607 10:58054661-58054683 CAGTATTGGGAAAACTTGGCAGG - Intergenic
1068764815 10:60751513-60751535 AAGAACAGGGATAAGGTGACTGG - Intergenic
1069420853 10:68245125-68245147 GAGAGAAGGGAAATGGTGGCAGG + Intergenic
1070381112 10:75881332-75881354 CACAATAGGGATAATGAGGCAGG + Intronic
1072177378 10:92941345-92941367 CACAATAGTCAAAAGGTGGAAGG - Intronic
1072488381 10:95878490-95878512 CAGAAGAGAGAAAAGGTTGAAGG - Intronic
1072667696 10:97406273-97406295 GAGAAAAGGGAACTGGTGGCTGG + Intronic
1072801180 10:98393417-98393439 GAGAATGGGGAAAAGGTGGTGGG - Intronic
1073063765 10:100746617-100746639 CTGACTAGGGAGAGGGTGGCTGG - Intronic
1073463303 10:103678836-103678858 AACAATAAGGAAAAGGTGGGAGG + Intronic
1074174168 10:110979368-110979390 CAGAATATGGCAAAGGTGATGGG - Intronic
1074660122 10:115645824-115645846 CACAATAGGGATGGGGTGGCAGG - Intronic
1074850248 10:117433673-117433695 CAGGAAAGAGCAAAGGTGGCTGG - Intergenic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1076330376 10:129660120-129660142 CAGAATGGGGTAAAAGTGACAGG - Intronic
1076565783 10:131398184-131398206 GAGAAAAGGGAAAATGAGGCAGG - Intergenic
1076727622 10:132420855-132420877 CAGAAAAGGGAAGTGCTGGCTGG - Intergenic
1077469794 11:2751866-2751888 GGGAATAGGGCAAAGCTGGCCGG - Intronic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1078399894 11:11016765-11016787 CAGATTTGGGGAAAGGTGGTGGG + Intergenic
1078495755 11:11814748-11814770 CAGAAAGGGGAAAATGTGGGAGG + Intergenic
1078542514 11:12223299-12223321 CAGTAGAGGAAAATGGTGGCAGG + Intronic
1078912423 11:15745415-15745437 CAGAATATGGTAAAGGTGACAGG - Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083871260 11:65489841-65489863 CAGAGTAGGGAAAGGAAGGCCGG - Intergenic
1085351706 11:75802039-75802061 CAGAATATGGCAAAAGTGACAGG - Intergenic
1085628694 11:78094414-78094436 CAGAATGTGGCAAAGGTGACAGG + Intergenic
1086401393 11:86463558-86463580 CAGAATGGAGAAAGGCTGGCAGG + Intronic
1086487635 11:87325546-87325568 CAGAGAATGGACAAGGTGGCAGG - Intergenic
1087211730 11:95451896-95451918 AAGAAAAGGGAAAAGGTTGTTGG - Intergenic
1087687846 11:101285568-101285590 CAGTATAGAGAGAAGTTGGCTGG - Intergenic
1088755321 11:112880880-112880902 CAGAAAAGGAAAACGTTGGCTGG - Intergenic
1089245589 11:117117148-117117170 AACAATAGAGAATAGGTGGCAGG + Intergenic
1090361745 11:126177519-126177541 CAGAAGAGGGAACCGGTGGCAGG + Intergenic
1090521375 11:127483098-127483120 CAAGAGAAGGAAAAGGTGGCTGG + Intergenic
1091129863 11:133136636-133136658 GAGAATAGGGAAAAGGAGAAAGG + Intronic
1091414882 12:273237-273259 TAGAATAGGGCAATGGTGGCAGG + Intergenic
1091421120 12:341603-341625 CATAATAGAGAAATGGAGGCTGG + Intronic
1091866761 12:3845135-3845157 CACCAAAGGGAAAAGGGGGCTGG - Intronic
1091967811 12:4760440-4760462 CAGAATATGGCAAGGATGGCAGG - Intronic
1092158136 12:6298236-6298258 CAAAACAGTGAAAAGGAGGCCGG + Intergenic
1092818442 12:12331353-12331375 CAAATTAAGGAAAAGGTGGGAGG + Intronic
1094108853 12:26839735-26839757 CACTATGGGGGAAAGGTGGCTGG - Intergenic
1094169220 12:27474436-27474458 CATAAAAAAGAAAAGGTGGCAGG - Intronic
1094360038 12:29620796-29620818 CAGCACAGGAAAAAGGTGGCAGG + Intronic
1095233610 12:39771284-39771306 CAGAATATGGCAAAAGTGACAGG + Intronic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1096131670 12:49164161-49164183 TAGAATACGGAAAGGCTGGCTGG - Intergenic
1097081838 12:56437514-56437536 CAGAATACAGAAAATGAGGCAGG + Intronic
1097336313 12:58387669-58387691 AAGAATATTGAAAAGGTGGCTGG - Intergenic
1098857513 12:75669561-75669583 CAGAATATGGCAAAGGTAGGTGG + Intergenic
1099207638 12:79746462-79746484 CAGAATATGGAAAAGGTATCTGG + Intergenic
1099310720 12:81018291-81018313 TAGAATATGGAAAAGGTGATGGG + Intronic
1099323155 12:81177208-81177230 CTGAACAGGGAAAAGCTGGATGG + Intronic
1100471370 12:94896328-94896350 CAGAATAGGGAAGGGGTGGCAGG + Intergenic
1101621650 12:106394727-106394749 CAGATTAGTGAGAAGATGGCAGG + Intronic
1102591525 12:113959878-113959900 GAGAAGAAGAAAAAGGTGGCAGG - Exonic
1103418781 12:120763160-120763182 CAGAACAGGGAGGAGATGGCTGG + Exonic
1103530296 12:121596439-121596461 CAGAACAGGGAACAAGGGGCCGG - Intergenic
1103586449 12:121959784-121959806 CAGAAAACTGAAAAGGTAGCGGG - Intronic
1104016117 12:124963571-124963593 CAGAATAAAGAAACAGTGGCCGG + Intronic
1104464597 12:128980158-128980180 CAGAATATGGCAAAGGTCCCGGG - Intronic
1105069429 12:133225760-133225782 CAGAAGAGGGGGAGGGTGGCAGG + Intronic
1105806675 13:23955495-23955517 CAGGAGAGGGAAAAAGTGGGTGG + Intergenic
1107945479 13:45414320-45414342 CCAAATAAGGAAAAGGGGGCGGG + Intronic
1108376503 13:49818977-49818999 CTAAATATAGAAAAGGTGGCTGG + Intergenic
1111161011 13:84394615-84394637 CAGAATTGGGAAAAGACCGCAGG - Intergenic
1112047991 13:95616792-95616814 CAGAATACGGCAAAGGTGAAGGG + Intronic
1112065095 13:95784355-95784377 CAGCACAGGGAAAAGGTGCAAGG + Intronic
1113231822 13:108219781-108219803 CAGAATGTGGAATGGGTGGCAGG + Intronic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1114356248 14:21912380-21912402 CTGATTAGGGAAAAGGAGTCAGG + Intergenic
1114570907 14:23667610-23667632 CAGCATAGGGAAAACCAGGCTGG - Intergenic
1114719448 14:24864927-24864949 CAGTAGAGAGAGAAGGTGGCGGG - Intronic
1115120184 14:29928227-29928249 CAGCATTTGGAAGAGGTGGCAGG - Intronic
1115749522 14:36475382-36475404 CAGAATACGGCAAAAGTGGTGGG - Intronic
1116035203 14:39619139-39619161 TATAATAGGAAAAAGGTGGGGGG - Intergenic
1116997843 14:51342453-51342475 CAGAATATGGCAAAGATGGTGGG + Intergenic
1117899523 14:60517334-60517356 CAGAGGAGAGAAAAGGTGGGAGG - Intergenic
1117906888 14:60598607-60598629 GAAAATAGGCAAAAGGTGGCCGG - Intergenic
1118526177 14:66646519-66646541 CAGAACAGCCAAAAGGTGGAAGG + Intronic
1118922463 14:70161987-70162009 CTGAATTGAGAAAAGGTGACAGG - Intronic
1121179499 14:91918079-91918101 TAGAATAAGGTAAAGGTGGGAGG + Intronic
1122766583 14:104075997-104076019 AAGAATTTGGAAAAGGTGGAAGG + Intergenic
1123022888 14:105410468-105410490 CACAATAGCGAAAATGTGGAAGG - Intronic
1125487488 15:40122412-40122434 CAGAAAAGGGAAGGAGTGGCAGG + Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125540478 15:40467071-40467093 AAGACTAGGGAAAGGGTGGCAGG - Exonic
1125871782 15:43108700-43108722 CAGTATAGTCAAATGGTGGCAGG + Intronic
1127222166 15:56891292-56891314 CAGAAGAGGGAAAAAGAGACTGG - Intronic
1128569144 15:68720765-68720787 CAGAATAGGGCAGAAGTGGTGGG - Intronic
1129227475 15:74178549-74178571 AAGAACAGGGAAAGGGTGCCTGG - Intergenic
1130328119 15:82897560-82897582 CAGAATATGGCAAAGGTGATGGG + Intronic
1131030511 15:89182437-89182459 CAGAAGAGAGAAGGGGTGGCAGG - Intronic
1131073908 15:89483032-89483054 CAGAATGGGGATGAGGTGGTGGG - Intronic
1133730130 16:8571743-8571765 CAGAATAGAGCGAGGGTGGCTGG + Intronic
1134423035 16:14112188-14112210 TAGGAAAGGAAAAAGGTGGCAGG + Intronic
1136009137 16:27351353-27351375 CAGAATATGGTAAAGGTGATGGG - Intronic
1139853503 16:69964078-69964100 CAGGAAAGGGAATAGGTGGGTGG - Exonic
1139882474 16:70186987-70187009 CAGGAAAGGGAATAGGTGGGTGG - Exonic
1140370035 16:74408517-74408539 CAGGAAAGGGAATAGGTGGGTGG + Intronic
1140501343 16:75436069-75436091 CAGAAGAGGAAGAGGGTGGCAGG - Intronic
1140779598 16:78282578-78282600 TAGAACAGGGAAAATGTGGCCGG + Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141633528 16:85301853-85301875 CAGAATGGGGACAAGGTCACGGG - Intergenic
1141636384 16:85316167-85316189 CTGAAAATGGAATAGGTGGCTGG - Intergenic
1142883965 17:2901365-2901387 CAGAGAAGGGAAAAGGAGGATGG - Intronic
1143189158 17:5029092-5029114 AATAAAAGGGAAAAGGTGACTGG - Intergenic
1143569062 17:7743155-7743177 GAGTATAGGGAAAAGGGGCCAGG - Intronic
1143594850 17:7907891-7907913 CAGAAGATGTAAAAGGTGACCGG + Exonic
1143622592 17:8089353-8089375 CAGGATAGGGAGAAGGTGTTAGG + Intergenic
1143843741 17:9756140-9756162 TAGAATAAGGAAGTGGTGGCCGG - Intergenic
1144031720 17:11329127-11329149 GGGAATAAAGAAAAGGTGGCAGG + Intronic
1144453881 17:15403422-15403444 GAGAATAGGGAGAGGGTGGCTGG - Intergenic
1144501328 17:15787997-15788019 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1145163503 17:20590671-20590693 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1146018155 17:29249965-29249987 CAGAGTAGGGATGAGGTGGAGGG - Intronic
1146030447 17:29361689-29361711 CAGAAAAGGGGAAATGTGGGGGG - Intergenic
1146186801 17:30729549-30729571 AAAAACAGGGAAAAGATGGCGGG + Intergenic
1146910742 17:36646859-36646881 AAGAATAGGAGAAAGGAGGCAGG + Intergenic
1147693109 17:42330410-42330432 AAGAAAAGAGAAAATGTGGCTGG - Intronic
1148121295 17:45213587-45213609 CAAAAAAATGAAAAGGTGGCTGG - Intergenic
1148548295 17:48533216-48533238 CATGATCGGGAAAAGGAGGCAGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148862196 17:50610204-50610226 CACAGGAGGGAAGAGGTGGCAGG - Intronic
1148951447 17:51316519-51316541 CAGAATAGAGGAAAAATGGCAGG + Intergenic
1148990915 17:51666561-51666583 AGGAATAGGGGAAAGTTGGCAGG - Intronic
1149945198 17:60917887-60917909 CAAAATTGGCGAAAGGTGGCGGG - Intronic
1150464623 17:65381558-65381580 CAGAAAAGAGAAAATGAGGCAGG + Intergenic
1151102036 17:71566952-71566974 TAGAATAGAGGAAACGTGGCTGG + Intergenic
1152707843 17:81854240-81854262 TAGAATAGTTAAAACGTGGCCGG + Intronic
1153348019 18:4049481-4049503 TAGAACAGGGATATGGTGGCAGG - Intronic
1153497545 18:5715418-5715440 CAGAAAAGGGAAGAGTTGGCAGG + Intergenic
1154050395 18:10950715-10950737 CAGAAGAGGGAAGAGGAGGAAGG - Intronic
1156412319 18:36842588-36842610 CAGAATAGTAAAACTGTGGCTGG - Intronic
1156487487 18:37475769-37475791 GAGAACAGGGAAAATGTGTCTGG - Intronic
1157357643 18:46950071-46950093 TAGATTAGGGAGAATGTGGCTGG - Intronic
1158181277 18:54717188-54717210 CATGATGGGGAAAAGGTGGGGGG + Intergenic
1158498412 18:57977967-57977989 CAAAATTGGTAAAAGGTAGCAGG - Intergenic
1158537019 18:58317449-58317471 TACATTAGGGAAAGGGTGGCTGG - Intronic
1159053002 18:63438818-63438840 CAGAAGAGGGAAATTTTGGCTGG - Intergenic
1159201604 18:65192781-65192803 CAGAATAGTTAAAATGTGGCAGG + Intergenic
1159679103 18:71325359-71325381 AAGAACAGTGAAAAGATGGCAGG + Intergenic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160964509 19:1740756-1740778 CAGAATAGGGCAAAGGTGTTAGG - Intergenic
1161086519 19:2338062-2338084 CAGAAGATGGAAAAGGGGCCAGG - Intronic
1162133554 19:8542154-8542176 CAGAATAGGGGATGGGGGGCGGG + Intronic
1164725852 19:30465164-30465186 GAGAATAGAGGCAAGGTGGCAGG - Intronic
1165066308 19:33230845-33230867 GAGAACAGGGAAAATGAGGCAGG - Intergenic
1165301309 19:34971208-34971230 AAGAATATGGCAAAGGTGGTGGG - Intergenic
1165549699 19:36573566-36573588 CAGAATGGGGAACAGGAAGCTGG + Intronic
1166398882 19:42463162-42463184 GATAATAGGGAAGAGGAGGCAGG + Intergenic
1166642582 19:44506516-44506538 TAGAATATGGCAAAGGTGGCAGG + Intronic
1166680865 19:44765798-44765820 CAAAAAAGGAAAAAGGTGGGGGG + Intergenic
1166879179 19:45916736-45916758 CAGGATATGGAAACTGTGGCTGG + Intergenic
1166965246 19:46525980-46526002 CTGAATAGGGTAAAGGGGGGCGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167151655 19:47713620-47713642 CAGACTGGGGACAGGGTGGCAGG - Intronic
1167836816 19:52079620-52079642 CAGCAAAGAGAAAAGGTGGGAGG + Intronic
1168565532 19:57419175-57419197 CAGTAAAAGGAACAGGTGGCTGG - Intronic
925879260 2:8337861-8337883 CAGAATGGGGAGAAGGTAACAGG + Intergenic
926493080 2:13549280-13549302 AATAATAGGGAAATTGTGGCTGG + Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
928200841 2:29246748-29246770 CAGGACAGGGGAAAGATGGCAGG - Intronic
930182740 2:48380518-48380540 CACAATAGCCAAAAGGTGGAAGG + Intergenic
931102421 2:59017387-59017409 CAGAAAAGGGGAAAGGAGGGAGG + Intergenic
931108372 2:59082931-59082953 AAGAACAGGGACAAGGTGGTAGG + Intergenic
931152957 2:59595563-59595585 CAGAATATGGCAAAGGTAACGGG + Intergenic
931393517 2:61865272-61865294 CTGAGTAAGAAAAAGGTGGCTGG + Intergenic
932639437 2:73428375-73428397 AAGAATAGTTAAAAGGTGGGGGG - Intronic
934044922 2:88164916-88164938 CAGAGTGGGGAAAGGGTAGCAGG + Intergenic
934294771 2:91733566-91733588 CATTATAGGGAAATGGTGGGGGG + Intergenic
934962429 2:98688442-98688464 CAGAATATGGCAAAGGTGATAGG + Intronic
935081297 2:99798102-99798124 AACAATAGGAAAAAGGTGGCTGG + Intronic
935530319 2:104224346-104224368 CAGAATTGAGAAAAGGTTGTGGG - Intergenic
936666154 2:114598112-114598134 CATAATATGAAAAGGGTGGCAGG + Intronic
937710934 2:124979147-124979169 CAGATTAGAGAGAAGGTAGCTGG + Intergenic
937959128 2:127441266-127441288 TAGAAAAGTGAATAGGTGGCTGG + Intronic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
939191731 2:138924536-138924558 GAGAAGAGAGAAAAGGTGGAAGG - Intergenic
939500135 2:142974230-142974252 CAGTAAAGGGAAAAGTGGGCTGG + Intronic
939654393 2:144805393-144805415 CATACTGGGCAAAAGGTGGCAGG - Intergenic
940030979 2:149260902-149260924 CAGCAGAGGGAAAAGGTAACTGG - Intergenic
940751074 2:157628326-157628348 CGGAAGAGGGAAAAGGCAGCAGG - Intronic
941773289 2:169364864-169364886 CAGAAGAGGGGAAAGGAGGGAGG + Intergenic
942674253 2:178411020-178411042 CACAATAGCCAAAAGGTGGAAGG + Intergenic
943581350 2:189687128-189687150 CAGAAGCTGGGAAAGGTGGCAGG - Intronic
944016923 2:195051713-195051735 AAGAGTAGGGAAAAGGTGCCAGG - Intergenic
944135814 2:196398087-196398109 GAGTGTAGGGGAAAGGTGGCTGG + Intronic
944566351 2:200995444-200995466 CAGAATAAGGCAAAGGTGATGGG + Intronic
944652237 2:201842701-201842723 CAGAATAGAGAAAAAGTAGGAGG + Intronic
944993836 2:205270975-205270997 CAAAAAAGGAAAAAGGTGTCTGG + Intronic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946222665 2:218241849-218241871 CTGAATTTGGAAAGGGTGGCAGG - Intronic
947361008 2:229345415-229345437 GAGAATAGGGAAAATGAGGCAGG - Intergenic
947625874 2:231618323-231618345 CAGAATATGGCAAAGGTGACAGG + Intergenic
947818534 2:233054533-233054555 CAGAACAGGGAAGGGGTGGAGGG + Intergenic
947907917 2:233779188-233779210 CAGAATATGGCAAAGGTGATGGG - Intronic
948002503 2:234579920-234579942 CAGAATGGGGAACAGGGGACAGG + Intergenic
948108577 2:235435439-235435461 CAGAATATGGCAAAGGTGATGGG + Intergenic
948156310 2:235785763-235785785 CAGAATACAGAAAAAGTGACTGG - Intronic
948169157 2:235887386-235887408 CAGAGGAGAGAAAAGGAGGCAGG - Intronic
948197726 2:236107721-236107743 CAGAATCAGGAAAACCTGGCTGG + Intronic
949003001 2:241628129-241628151 CAGAATGGAGAGAAGGGGGCTGG - Intronic
949053543 2:241911168-241911190 CAGAAGAGGACAAACGTGGCAGG + Intergenic
1168753645 20:300854-300876 CAGAATAGGGTCAAGGTCCCTGG + Intergenic
1169010704 20:2247701-2247723 CAGCAAAGGGAAAAGGTGCATGG + Intergenic
1169561594 20:6807174-6807196 GAGAATAGCAAAAAGGTGGGAGG - Intergenic
1169593764 20:7175293-7175315 CAGCAAAGGGAAAAGGTGCATGG - Intergenic
1169944219 20:10971755-10971777 CAGAATATGGCAAAGGTGATAGG - Intergenic
1170283089 20:14673620-14673642 TATAAAATGGAAAAGGTGGCTGG + Intronic
1170286610 20:14716562-14716584 AAGAAAGGGGAAAAGGTGGGAGG - Intronic
1171154853 20:22862526-22862548 CAGAAAAGTGAACAGGTGACAGG + Intergenic
1172161220 20:32869593-32869615 CAGAATATGGCACAGGTGACAGG - Intronic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1172830331 20:37828681-37828703 CTGAATAGTGCATAGGTGGCAGG - Intronic
1173055051 20:39603942-39603964 CAGAATAGTGAAAAGGTGGATGG - Intergenic
1174124474 20:48292950-48292972 GAGAATCGGAAAAAGGTGACGGG - Intergenic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174992980 20:55534186-55534208 AAGAAAAGGAAGAAGGTGGCCGG + Intergenic
1175259373 20:57664922-57664944 CAGATTAGGGAAACTGAGGCAGG - Intronic
1175547349 20:59787059-59787081 CAGAATAGGGCACAAGTGACAGG - Intronic
1176916574 21:14633011-14633033 TAGAGTAGGGCAAAGGTGACAGG - Intronic
1177583135 21:23053781-23053803 CAGAGGTTGGAAAAGGTGGCAGG - Intergenic
1178573626 21:33764390-33764412 CAGAATAAGGAAGAGCGGGCAGG + Intronic
1178629906 21:34250550-34250572 AAGAATGGGGAAAAGATGACTGG - Intergenic
1178671232 21:34593516-34593538 CAGTAAATGCAAAAGGTGGCAGG - Intronic
1179094127 21:38296772-38296794 CAGAATAGGGTAAAGGTTCAAGG - Intronic
1182052888 22:27326522-27326544 CAGAATAGGAAAAAAGTGTTAGG + Intergenic
1182113397 22:27740503-27740525 CAGAATATGGCAAAGGTGATGGG + Intergenic
1183225973 22:36550133-36550155 CAGAATAGGGAAGACGGGCCAGG + Intergenic
1183819570 22:40334496-40334518 CAGAACAGGGATGAGGTGGGTGG - Exonic
949588530 3:5467883-5467905 GAGAATAGTGACAAGGTAGCAGG - Intergenic
950503164 3:13377129-13377151 CAGCTTGGGGAAAAGGGGGCGGG + Intronic
951397024 3:22181398-22181420 TAGAATATGGTAAAGGTGGCCGG + Intronic
951587763 3:24232734-24232756 CAGAATAGAGAAAAAGGTGCTGG + Intronic
951701295 3:25499414-25499436 CAGAAGAGAGAAAAGGCAGCAGG + Intronic
952135734 3:30417161-30417183 CTGAATTGAGAACAGGTGGCAGG - Intergenic
952286006 3:31970377-31970399 TAGAATATGGAAATGATGGCTGG - Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952801023 3:37292020-37292042 CAGAATAGTGTATAGGTAGCCGG + Intronic
953154889 3:40360779-40360801 CAGAGAAGGAAAAAGGTGGTGGG - Intergenic
953444379 3:42950176-42950198 CACAATAGGCAAATGGTGGTGGG + Intronic
953782149 3:45880703-45880725 CAGCAGAGGGAACAGTTGGCAGG - Intronic
954788836 3:53115537-53115559 GAGAGAAAGGAAAAGGTGGCGGG - Intronic
954816077 3:53281734-53281756 GATAAGATGGAAAAGGTGGCTGG - Intergenic
955498388 3:59560485-59560507 CAGAATATGGCAAAGGTGATAGG - Intergenic
955607731 3:60723662-60723684 CAACATAGGGAAAAGGTGCATGG - Intronic
956004206 3:64761692-64761714 CAGAATAGGAAGATGGTGGTGGG + Intergenic
957137763 3:76310944-76310966 CAGAAAAGGGAAAAGATGTCAGG - Intronic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
961059230 3:123814243-123814265 CGGAATAGGGTGAATGTGGCCGG - Intronic
962204435 3:133423511-133423533 CAAAGTACGGAAAAGTTGGCTGG - Intronic
962412668 3:135154860-135154882 AAGAAAAGGGAAATGGTGCCTGG + Intronic
963781369 3:149489837-149489859 CAGAATAGGGTAAACCTTGCAGG + Intronic
965400346 3:168205988-168206010 CAAGATGGGGAAAAGGGGGCCGG - Intergenic
966211976 3:177462981-177463003 AAGAAGAGGGAAAAGGGTGCTGG + Intergenic
966365239 3:179178736-179178758 CAGCAAAGGGAAAAGGTGAATGG + Intronic
967664799 3:192158294-192158316 GAGAAAAGGGAAAAGCAGGCAGG - Intronic
970511600 4:16787115-16787137 CAAAAGAGGGAAAAAGTAGCAGG + Intronic
970989287 4:22193789-22193811 CAGAATGGGCAAAAGCTGGAAGG - Intergenic
972190322 4:36583645-36583667 ATGAAGAGGGAAAAGGTGGGGGG + Intergenic
972217808 4:36916659-36916681 CAGAAGAGGGAAAGGGGGGTTGG - Intergenic
972332040 4:38073042-38073064 CACAATAGCCAAAAGGTGGAAGG - Intronic
972652191 4:41028908-41028930 TAGAAAAGGGAAAAGGAGGAGGG - Intronic
973276084 4:48310920-48310942 AATAATAGGGAAAAAGAGGCAGG + Intergenic
974997144 4:69175346-69175368 CAGAATAGGAGGAAGGTGGAGGG + Intronic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
975077855 4:70235297-70235319 CTGAAGAAGGAAGAGGTGGCAGG + Intergenic
976038350 4:80852119-80852141 CAGAAAAGGGAAGAGAAGGCGGG - Intronic
981265398 4:142777241-142777263 CAGAATATGGCAAAGGTGATAGG + Intronic
981471001 4:145134778-145134800 CACCAAAGGGAAAAGGGGGCTGG + Exonic
982381990 4:154759032-154759054 CAGAACAGGGAATAAGTGTCAGG - Intergenic
982589459 4:157287733-157287755 CAGAATTGTGAAAAGGTGGTCGG - Intronic
983460901 4:168024921-168024943 CAAATTAGGGAAAAGGAGTCAGG + Intergenic
983526697 4:168767311-168767333 CAGAACAGGGGAGAAGTGGCTGG - Intronic
984001429 4:174251457-174251479 GAGAAAAGGGAAAAGGAGGGTGG + Intronic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
985034370 4:185823175-185823197 CATAAAGGGGAAAAGGAGGCCGG - Intronic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
986746522 5:10749812-10749834 CAGAATTTGGAAATGCTGGCTGG + Intronic
986878714 5:12143172-12143194 CAGAATAGGGGAAAAGGGGAAGG + Intergenic
987226540 5:15847623-15847645 CATTATATGGAAAAGGTGGGGGG + Intronic
987376334 5:17238649-17238671 CAAACTAGGGAAGAGATGGCAGG - Intronic
989040079 5:37218468-37218490 CAGCAAAGGGAAAAGGTGCATGG - Intronic
989261444 5:39423903-39423925 AAGAAAGGGGAAAAGGTGGGGGG + Intronic
990503119 5:56416747-56416769 CAGAAAAGGGAATAGGAAGCAGG + Intergenic
991368541 5:65894438-65894460 CTGAATGGGGAAAAGGAGACAGG - Intergenic
992384230 5:76268211-76268233 CAGATTCTGGAAAAGGTGGGAGG + Intronic
992786330 5:80173793-80173815 CAGAAAGGTGAAAAGGTGTCAGG - Intronic
993196757 5:84758344-84758366 CAGGATAGGGACTAGGTGGGAGG + Intergenic
993791816 5:92219176-92219198 CAGACTAGGGGAAAGAAGGCAGG - Intergenic
994260039 5:97646753-97646775 CAGAATAGAGAAAAAGTAACAGG - Intergenic
994486642 5:100390991-100391013 CGGGAGTGGGAAAAGGTGGCAGG - Intergenic
995497035 5:112757435-112757457 CAAAAAAGGCAAAAGGAGGCTGG + Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998793634 5:145793589-145793611 CAGAAAAGGCAAAAGCTAGCAGG + Intronic
998801669 5:145875251-145875273 TAGAATAGTGAAGAGGTGGCTGG + Intergenic
999364775 5:151015217-151015239 CAGCAAAGGGAAAAGGTGCATGG - Intergenic
1000440482 5:161257180-161257202 CAGCATAGTGAAGAGCTGGCTGG + Intergenic
1000473258 5:161672651-161672673 CTGAATAAAGAAAATGTGGCAGG - Intronic
1000993713 5:167937677-167937699 CAGAATTGAGAAAAGCAGGCAGG - Intronic
1001548833 5:172587415-172587437 CAGAAAAGGGAAGAGGCAGCTGG + Intergenic
1001636224 5:173212279-173212301 CACAATAGCCAAAAGGTGGAAGG + Intergenic
1002088177 5:176788892-176788914 CAGAATCTGGAAAAGTTGGTGGG - Intergenic
1003659010 6:8043015-8043037 CAGCAAAGGGAAAAGGTGCTTGG - Intronic
1003962575 6:11222480-11222502 GAAGACAGGGAAAAGGTGGCAGG + Intronic
1005045781 6:21640954-21640976 CAAAAAAAGGAAAAGATGGCCGG - Intergenic
1005440842 6:25866123-25866145 CAGAATACGGCAAAGGTGATGGG + Intronic
1005589753 6:27311651-27311673 CAGAAAAGGGAAAGGGAGGTTGG - Exonic
1005666807 6:28065897-28065919 GAGAACAGGGAGAAGGTGGTTGG - Intergenic
1007059285 6:38922377-38922399 CAGATTTGGGAAAAGGTGCATGG + Intronic
1008118462 6:47581814-47581836 CAGAGTAGGGTAATAGTGGCAGG + Intronic
1009052890 6:58299395-58299417 CAGGCTAGGGAAAGGGTGGTAGG + Intergenic
1009238220 6:61151191-61151213 CAGGCTAGGGAAAGGGTGGTGGG - Intergenic
1010732338 6:79404446-79404468 CAGCAGAGGGAAGAAGTGGCTGG + Intergenic
1011508493 6:88074180-88074202 AAGAATAGAGAAAAGAGGGCCGG + Intergenic
1011675742 6:89731805-89731827 GAGAAAAAGGAAAAGGTGGGGGG - Intronic
1012135774 6:95554090-95554112 CAGAATAGGGTGAGGGTGGAGGG - Intergenic
1013172428 6:107648745-107648767 CAGAAATAGGAAAAGGTGGATGG - Intronic
1013366532 6:109441680-109441702 CAGGATAGGGAAGGGCTGGCAGG - Intronic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1013784019 6:113759227-113759249 CAGAATGGGGAAAATGTGTATGG + Intergenic
1015429746 6:133117088-133117110 CAGAATATGGCAAAGGTGATGGG + Intergenic
1015496461 6:133888905-133888927 CACAGTTGGGAGAAGGTGGCTGG + Intergenic
1015652177 6:135475764-135475786 CAGCAAAGGGAAAAGGTGCATGG - Intronic
1016058916 6:139607950-139607972 GAGAATTGGGAAAAGGAGGAAGG - Intergenic
1016622290 6:146125693-146125715 CAGAATGGAGAAAAGGAGGGGGG - Intronic
1016774207 6:147886554-147886576 CGGAATAGGGCAAAGGTGATGGG + Intergenic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018897069 6:168027154-168027176 TAGAAAAAGGGAAAGGTGGCCGG + Intronic
1019691976 7:2420443-2420465 CACAATAGCCAAAAGGTGGAAGG - Intronic
1021083086 7:16386362-16386384 CAGGATAGGGAAGGTGTGGCAGG + Intronic
1021377454 7:19925354-19925376 CAGAAGAGGGAAAAAGTGGATGG + Intergenic
1021428895 7:20537302-20537324 CAGAATTGGAAAAAACTGGCCGG + Intergenic
1021601421 7:22367940-22367962 CAGAAATGGGAAAAGCTGGCTGG + Intergenic
1022495349 7:30849846-30849868 CAAAATAAGGACAATGTGGCTGG - Intronic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1025243163 7:57294850-57294872 TAGAATATGGAAATGTTGGCTGG + Intergenic
1026168543 7:67932562-67932584 TAGAATATGGAAATGTTGGCTGG + Intergenic
1026499946 7:70935629-70935651 CTGAATAAGGAAGAGGGGGCAGG - Intergenic
1028510297 7:91617889-91617911 CAAAATATTGCAAAGGTGGCTGG - Intergenic
1031837311 7:126693025-126693047 CTCAATAGGAAAAAGTTGGCTGG + Intronic
1032682771 7:134202561-134202583 CACAATAGCCAAAAGGTGGAAGG + Intronic
1032864347 7:135911050-135911072 CAGAAAAGGTTAAAGGTAGCTGG + Intergenic
1034185124 7:149169905-149169927 CAGCAAAGGGAAAAGGTACCTGG + Intronic
1034468226 7:151242262-151242284 CAGAACAGGGACGAGGTGGGAGG + Intronic
1034496976 7:151428886-151428908 CAGATTAGGGAGCAGGGGGCTGG + Intronic
1034630860 7:152529606-152529628 AAGAAAAGGGAAAGGATGGCAGG - Intergenic
1035019840 7:155794387-155794409 CAGAACTGGGAAGAGGTGCCAGG + Intergenic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1035892623 8:3362205-3362227 CAGAGTAGGGATATGGTGGCTGG - Intronic
1036538660 8:9679613-9679635 CTGAATAGAGAAAAGGGGGGAGG + Intronic
1036557852 8:9875794-9875816 CAAAATGAGGAAGAGGTGGCTGG + Intergenic
1037577344 8:20220053-20220075 GAGAAGAGGGAAGAGGCGGCTGG - Intronic
1037836218 8:22216195-22216217 CAGGTTAGGAAAGAGGTGGCTGG - Intergenic
1038526223 8:28275960-28275982 CAGAACAGGAAAAAGGAGCCTGG - Intergenic
1042309091 8:67362227-67362249 CAGAATAGAGAATATGTGGCCGG - Intergenic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1043811537 8:84748479-84748501 CAGAATTAGGAAAATGGGGCAGG - Intronic
1044199818 8:89421326-89421348 AAGAATAGGGATAATGTGGCCGG + Intergenic
1044312151 8:90706286-90706308 CTGAATAGGCAAAAGGTAGAAGG - Intronic
1044327093 8:90870640-90870662 GAGAATTGGCAAAAGGTGTCCGG - Intronic
1044407821 8:91850158-91850180 CAGAATCTGGAAAGGGTGGTTGG + Intergenic
1045014041 8:97983299-97983321 CACAATAGGCAAAAGGTGGAAGG - Intronic
1045767019 8:105684463-105684485 GGGTATGGGGAAAAGGTGGCAGG + Intronic
1046680576 8:117164956-117164978 CAGAATGGGGGAGAGGAGGCAGG - Intronic
1047701927 8:127457261-127457283 CAGAATATGGCAAAGGTGATGGG + Intergenic
1048298704 8:133235646-133235668 AAGAAAAGGGAAAATCTGGCCGG + Intergenic
1048718750 8:137298574-137298596 TAGAAAAGGGTAAAGGTGGAGGG - Intergenic
1050094932 9:2054561-2054583 TAAAATGGGGAAAAGGGGGCAGG - Intronic
1050404075 9:5289069-5289091 CTGAATAGGCAAAAGCTGGAAGG - Intergenic
1050425660 9:5510098-5510120 CTGAATAGGCAAAAGCTGGAAGG + Intergenic
1050752381 9:8955210-8955232 CAGAATATGAAAAAGTTGGCTGG + Intronic
1050864100 9:10476029-10476051 CTGAATGGGGAAAAGCTGGAAGG + Intronic
1051534334 9:18140364-18140386 CAGCAAAGGGAAAAGGTGTATGG + Intergenic
1051879934 9:21829527-21829549 CAGTGTAGGGAAAAGGAGCCTGG - Intronic
1051937782 9:22465511-22465533 CAGGAGAGGGAACTGGTGGCGGG + Intergenic
1054870855 9:70046014-70046036 CAGTATAGGGAAAGGGTGAGTGG - Intronic
1055574001 9:77644852-77644874 CAGCATAGGGAGAAAGTGTCAGG - Intronic
1056109985 9:83385288-83385310 AAGATTAGGGAAAAAGTGGGTGG - Intronic
1056215515 9:84402688-84402710 CAGAATAGGGACAAAGTGGCAGG - Intergenic
1056848647 9:90062105-90062127 CAGGATAGGGAAGAGGTAGGTGG - Intergenic
1057473549 9:95379832-95379854 CAAATGAGAGAAAAGGTGGCAGG - Intergenic
1057874376 9:98742828-98742850 CAGAAGAGGGAATGGGTGGGGGG + Intronic
1058645762 9:107130412-107130434 AAGAAAACAGAAAAGGTGGCTGG + Intergenic
1058646566 9:107136418-107136440 CAGAATAGACTAAAGGTGGAGGG - Intergenic
1059420406 9:114187003-114187025 CAGACCAGAGACAAGGTGGCTGG - Intronic
1059656573 9:116362956-116362978 CAGAATACAGAAAAGCTGTCAGG + Intronic
1059750434 9:117242455-117242477 CAGAACAGGGATATGCTGGCTGG + Intronic
1059983264 9:119796528-119796550 CAGAATAGTTAAAAGGTCTCAGG + Intergenic
1060171077 9:121461560-121461582 AAGAGAAGGGAAAAGGGGGCTGG + Intergenic
1060458980 9:123830566-123830588 CAAAACAGGGAAAAGAGGGCCGG + Intronic
1060607894 9:124933928-124933950 CAGCAAAGGGAAAAGGTGCATGG - Intronic
1061218378 9:129235086-129235108 CAGATTGGGGGAAAGGAGGCCGG - Intergenic
1061804736 9:133131596-133131618 AAGAACAGGGAATGGGTGGCTGG - Intronic
1185550471 X:979915-979937 AAGAAGAGGGAAGAGGCGGCCGG + Intergenic
1187395347 X:18914650-18914672 CAGAAGAGGGTAAAGGAGGAAGG + Intronic
1187672828 X:21685671-21685693 GAGAACAGGCAAAAGGTGACAGG - Intergenic
1188616735 X:32166495-32166517 CAAGATAGGGAAAAAGTGACAGG - Intronic
1189217678 X:39341012-39341034 AAGAAGAGGGAGAAGGTGTCAGG + Intergenic
1189390763 X:40574538-40574560 CACAATAGCAAAAAGGTGGAGGG + Intergenic
1189906995 X:45771326-45771348 CATTCTAGGGAAAACGTGGCTGG - Intergenic
1189999383 X:46670945-46670967 CAAAATGGGGAAAAGGCTGCCGG - Intronic
1190441724 X:50481621-50481643 CAGAATATGGCAAAGGTGATGGG - Intergenic
1192247305 X:69384374-69384396 CAGGATAGGGAAGAGGTAGGGGG - Intergenic
1193254557 X:79331852-79331874 GAGAATAGGGAAAATGAGGCAGG - Intergenic
1193602848 X:83529641-83529663 CAGACTGGAGAAAAGTTGGCAGG + Intergenic
1195135389 X:101901403-101901425 CTGAATAGGGAAAAGTTGAAAGG - Intronic
1195551253 X:106174233-106174255 CTGAATAGCGAGAATGTGGCAGG + Intronic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1198797466 X:140414240-140414262 CAGAATATGACAAAGGTGACAGG - Intergenic
1198922030 X:141739850-141739872 CAAAGTAGAGAAAAGGTTGCTGG + Intergenic
1200131621 X:153851517-153851539 CAAATAAGGGAAAAGGTGGTAGG - Intergenic