ID: 1172590616

View in Genome Browser
Species Human (GRCh38)
Location 20:36115213-36115235
Sequence CTTTGAGTAAGTAAGGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172590612_1172590616 -3 Left 1172590612 20:36115193-36115215 CCTGTTAAGTTAAGGCCACACTT 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 151
1172590611_1172590616 -2 Left 1172590611 20:36115192-36115214 CCCTGTTAAGTTAAGGCCACACT 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 151
1172590606_1172590616 26 Left 1172590606 20:36115164-36115186 CCCCATATTATCGATGAGGAAAC 0: 1
1: 9
2: 228
3: 1663
4: 5402
Right 1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 151
1172590608_1172590616 24 Left 1172590608 20:36115166-36115188 CCATATTATCGATGAGGAAACTG 0: 1
1: 9
2: 355
3: 2526
4: 7920
Right 1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 151
1172590607_1172590616 25 Left 1172590607 20:36115165-36115187 CCCATATTATCGATGAGGAAACT 0: 1
1: 7
2: 325
3: 2128
4: 6916
Right 1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172590616 Original CRISPR CTTTGAGTAAGTAAGGGAGC TGG Intronic
900691337 1:3982314-3982336 CTTTCAGGAAGTGAGGGAGCTGG + Intergenic
903400481 1:23042331-23042353 ATTTGGGCAAGAAAGGGAGCAGG - Intronic
904425044 1:30417577-30417599 CTTTGAGTAAGACCGGAAGCTGG - Intergenic
908960247 1:69688854-69688876 CTTAGCATAAGTAATGGAGCAGG + Intronic
910566293 1:88646825-88646847 CTTTGTGTAGGTTGGGGAGCTGG - Intergenic
911754793 1:101541039-101541061 CTTTGAATAAGCAATGGAGGAGG - Intergenic
918085819 1:181244342-181244364 CTTTGTGTTAGTAAGGATGCAGG + Intergenic
919169484 1:193935999-193936021 CTATGAGTAAGTAAAGGATAAGG - Intergenic
921138209 1:212281964-212281986 TTTTGAGTAAATAAGGTATCTGG - Intergenic
921417691 1:214909807-214909829 CTTTCTGTAATTAAGGGAGTTGG - Intergenic
1064346515 10:14537432-14537454 CTTAGAGCAAGTGAGGAAGCTGG - Intronic
1065455416 10:25901852-25901874 GATTGAGTAAGGAAGGGAGTGGG - Intergenic
1069088978 10:64176431-64176453 ATTTGAGTCAGTAAGGGAGATGG - Intergenic
1069731937 10:70622719-70622741 CTTTGAGGAGGTCTGGGAGCAGG + Intergenic
1070485772 10:76929631-76929653 CCTTGAGTAAGTAAGGGGCTAGG + Intronic
1070944533 10:80378287-80378309 CTTTAAGTACCTAAGGGAGAAGG + Intergenic
1072417666 10:95262605-95262627 CTCTGAGTAAACAAGGGTGCTGG - Intronic
1073253268 10:102134653-102134675 CTCTGAGAAAGTAGGGGAGAAGG - Intronic
1074265631 10:111900475-111900497 CTTTAAGGATGGAAGGGAGCTGG - Intergenic
1074297319 10:112202439-112202461 CTTTTAATAAGTAAGACAGCAGG + Intronic
1074459966 10:113627755-113627777 CTTTAAGTAAGTAGAAGAGCTGG - Intronic
1079441073 11:20515469-20515491 ATCTGAGTAATTAAGGGAGTGGG - Intergenic
1079518399 11:21295182-21295204 CCTTGAGCAAGTCAGTGAGCTGG - Intronic
1083741603 11:64714221-64714243 CTTTGAGAGGGTGAGGGAGCGGG - Intronic
1085039092 11:73316544-73316566 CCTGGAGGAAGTGAGGGAGCAGG + Intronic
1086956265 11:92937245-92937267 CTTGGAGAAAGCAAGGGAGGAGG + Intergenic
1087270680 11:96108467-96108489 CTACTAGTAAGTAGGGGAGCTGG - Intronic
1091390058 12:120711-120733 CTTTGAGAAAGTAGGGAAACAGG - Intronic
1092205354 12:6611501-6611523 CTCAGAGTAAGTATGGGAGAGGG - Intergenic
1093205667 12:16245987-16246009 CTTTGATTAATTGAGGAAGCTGG + Intronic
1093298622 12:17424975-17424997 CTTTCAGTAATTAATGGATCAGG - Intergenic
1095355044 12:41262456-41262478 TTTCAAGTAAGTGAGGGAGCTGG + Intronic
1095522948 12:43089073-43089095 CTTTGAGTAAGTAGGGAAGGTGG + Intergenic
1098172267 12:67759002-67759024 CTTTGAGTAAGTAAGTGTCCTGG + Intergenic
1100562386 12:95760927-95760949 CTTTAAGGAAGAAAGGGAGATGG - Intronic
1102548011 12:113670523-113670545 CTTTGAGTGAGGATGGGAGTTGG - Intergenic
1102608667 12:114091322-114091344 CTTTGATTAGGTGAGGCAGCAGG + Intergenic
1107878092 13:44808163-44808185 CTTTGAATATGAGAGGGAGCAGG + Intergenic
1110123001 13:71906504-71906526 ATTTGAGGAAGAAAGGGAACAGG + Intergenic
1110370745 13:74737579-74737601 CATTGAGAAGGGAAGGGAGCAGG + Intergenic
1114494521 14:23123468-23123490 TTTTGAGAAAGAAAGAGAGCTGG - Intergenic
1116102611 14:40460921-40460943 ATGAGAGTAAGAAAGGGAGCCGG + Intergenic
1118046272 14:61974777-61974799 CACTGAGTAAGTAAGGAAACAGG + Intergenic
1119941918 14:78650102-78650124 CTTTTATTTAGTAAGGGAGGTGG + Intronic
1120290920 14:82569773-82569795 CTTTGAGGAAGTGATGGAGTAGG - Intergenic
1121952227 14:98181510-98181532 CTTAGTGTATGTAAGGGAGACGG + Intergenic
1122186076 14:99997267-99997289 CTTTGAGGAAGTTAAGAAGCTGG + Intronic
1124062260 15:26305388-26305410 CTTTTAGTCAGTTAGGGAGATGG + Intergenic
1125284818 15:38081081-38081103 CTTAGAGGAAGTAAAGAAGCTGG - Intergenic
1127658379 15:61076913-61076935 CTTTGAACAAGCAAGGGAGAGGG - Intronic
1128479849 15:68027826-68027848 CTCTCAGTGAGAAAGGGAGCTGG + Intergenic
1128894234 15:71357870-71357892 CTTTGAATAAGTAAGGCAGTTGG - Intronic
1132530075 16:442752-442774 CTTTGACCAATTAAGAGAGCAGG + Intronic
1133457070 16:5951728-5951750 CGTGCAGTAAGTAAGGGAGAAGG - Intergenic
1137804766 16:51294512-51294534 CTGTGAGGAAGTAATGGAGCTGG - Intergenic
1140681492 16:77389523-77389545 CTGCGAATAAGTAATGGAGCAGG + Intronic
1140774089 16:78233972-78233994 CTTTGAGAATGGAAGAGAGCAGG - Intronic
1142963710 17:3567474-3567496 CTTTGAGTAGTTGAGGGAGGAGG - Intronic
1145890161 17:28408452-28408474 CTTGAAGGAAGTGAGGGAGCCGG - Intergenic
1149207756 17:54268096-54268118 ACTTGAGTAAGTAAGTGGGCAGG - Intergenic
1149937123 17:60819177-60819199 CTTTAAGTAATTAAGTGAACTGG - Intronic
1150973796 17:70060814-70060836 CTGGGAGGAAATAAGGGAGCAGG + Intronic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1156705435 18:39875808-39875830 CTTTGAGTAAGCACAGGAGAAGG - Intergenic
1156948522 18:42864930-42864952 CATTTAGTAAGTAAGGCAGGTGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159061032 18:63514035-63514057 TTTTCAGTCTGTAAGGGAGCTGG - Intergenic
1160151525 18:76398559-76398581 CTTAGAGTAAGGAGGAGAGCAGG + Intronic
1161757763 19:6146851-6146873 CTTTGAGAAACTAAGGGAGGAGG + Intronic
1166148282 19:40851954-40851976 CAGGGAGTAAGTGAGGGAGCTGG + Intronic
1166152425 19:40883739-40883761 CAGGGAGTAAGTGAGGGAGCTGG + Intronic
1166177756 19:41086906-41086928 CAGGGAGTAAGTGAGGGAGCTGG - Intergenic
927015775 2:18960150-18960172 CTCTGAGTAAGTCAGTGAGTGGG - Intergenic
928074102 2:28247282-28247304 CTGTGAGTTAGTGAGGGAGCAGG - Intronic
929667127 2:43841745-43841767 CTTTGAGAAGGGGAGGGAGCTGG - Intronic
930630271 2:53746054-53746076 CTTTGGGAAACTAAGGGAGGAGG + Intronic
930806073 2:55492058-55492080 CTGTGAGGAAGTAAGGAAGGTGG + Intergenic
931762176 2:65427884-65427906 CTGTGAGTAACTGAAGGAGCTGG - Intronic
933199478 2:79432791-79432813 CTTTGAGTGAGTATCAGAGCTGG - Intronic
933665002 2:84957763-84957785 CTTAGAGGAAGGAAGGAAGCAGG - Intergenic
934014909 2:87870236-87870258 CTTTGAGTTAGTAAAGGGCCAGG + Intergenic
937484112 2:122295927-122295949 CTTTGAATAAGTAAGGCAGGTGG - Intergenic
937538139 2:122916294-122916316 CATAGAGCAAGCAAGGGAGCTGG + Intergenic
939561414 2:143736502-143736524 CTTTGTGTAAGTAAAAGAGCTGG - Intronic
941099878 2:161283765-161283787 ATTGCAGGAAGTAAGGGAGCAGG + Intergenic
943801926 2:192071049-192071071 CTTTGAATAAGTAAGGGAGGAGG + Intronic
944541945 2:200762521-200762543 GTTTGCGTAAGTAAGGAAGGAGG - Intergenic
945530011 2:210941343-210941365 CTTTGAGAAAGAAAGTGAGAAGG + Intergenic
947227748 2:227856712-227856734 CTGTGAGAAAGAATGGGAGCAGG - Intergenic
947419475 2:229929265-229929287 CTTTGAGAAACTAAAGGAGCTGG + Intronic
1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG + Intronic
1173333161 20:42092474-42092496 CTTGGAGAAAGTAAAGGAACTGG + Intronic
1176257824 20:64161596-64161618 CTTTGTGTGAGTGGGGGAGCAGG - Intronic
949991130 3:9580137-9580159 CTTTGAGGAAGCAAGGTGGCAGG + Intergenic
950377541 3:12584160-12584182 TTTAGAGGAAGTAAGGTAGCAGG - Exonic
950939201 3:16876428-16876450 CTTGGAGGAAGTGATGGAGCTGG - Intronic
951116060 3:18863395-18863417 CTCTAAGTAAGAAAGAGAGCAGG + Intergenic
951131351 3:19049157-19049179 CATTGAGTAAGTTGAGGAGCAGG - Intergenic
953802422 3:46035311-46035333 CTTTTAGTCAGTCAGGGAGATGG + Intergenic
953897052 3:46810979-46811001 TTTTTAGTAAGTCAGGGAGGAGG - Intronic
954265364 3:49467260-49467282 CTTTGGGAAACTAAGGCAGCTGG - Intergenic
955006800 3:54976177-54976199 CTTTTAGAAAGTAAGGGTGGGGG + Intronic
955810715 3:62785590-62785612 CCTTGAGCAGGTATGGGAGCAGG - Intronic
963982520 3:151555589-151555611 CTTTGATTAGGTCAGGCAGCTGG - Intergenic
966649653 3:182285272-182285294 CTTTGAGTACGTAAGGGTCAAGG - Intergenic
968216674 3:196897674-196897696 CTTGGAGTTACAAAGGGAGCTGG + Intronic
968976595 4:3825268-3825290 CCTGGAGTGAGTAAGGGTGCTGG - Intergenic
969985734 4:11208620-11208642 CTTTTTGTAAGTAAAGAAGCTGG + Intergenic
971128543 4:23780494-23780516 CTTTGAGTTTGTAAGGATGCTGG - Intronic
972066544 4:34953155-34953177 CTTTCAGTGGGAAAGGGAGCTGG - Intergenic
972775059 4:42232657-42232679 CTGTGAGTAGCGAAGGGAGCCGG + Intergenic
975049841 4:69848817-69848839 ATTTGAGGAAGAAAGGGTGCAGG - Intronic
975114025 4:70659226-70659248 ATTTTAGTAAGTAATGGAGTTGG + Intronic
975540962 4:75511990-75512012 CTTGGAGTAAGTTAGGGAGGAGG - Intronic
978303141 4:107293390-107293412 TCTTGAGTTAATAAGGGAGCTGG + Intergenic
981640322 4:146934884-146934906 ATTTCAGTAAGTATGGGGGCTGG + Intronic
983709975 4:170702370-170702392 CTTTGATTAGATAAGTGAGCTGG + Intergenic
988773380 5:34453446-34453468 CTCTGAATAAGTAAGGGATTGGG + Intergenic
990463786 5:56053409-56053431 CTCTCAGTGAGAAAGGGAGCTGG - Intergenic
990920442 5:60959925-60959947 ATTTGTATAAGTAAGGGAGAAGG - Intronic
992671791 5:79068990-79069012 CTTTGAGTACATATGGGAGTCGG - Intronic
994238667 5:97394278-97394300 CATTAAGTAAGGAAGGGAGGGGG - Intergenic
994643150 5:102435508-102435530 CTTTGAGTATATAAGGTAGCAGG + Intronic
996691347 5:126343542-126343564 CTGTTAGTAAGTAACTGAGCTGG - Intergenic
996915795 5:128710992-128711014 ATTTTAGTCAGTAAGGGAGATGG + Intronic
999089607 5:148924650-148924672 CTGTTAGTAAGTAATGGAGCTGG + Intronic
999514203 5:152284642-152284664 CTGTGAGGCAGTAAGGAAGCAGG + Intergenic
1001406999 5:171483569-171483591 GTCTGAGTAGGGAAGGGAGCTGG + Intergenic
1002860914 6:1078651-1078673 TTTTGAGTAACCAAAGGAGCAGG - Intergenic
1003958128 6:11184998-11185020 CTTTCAGAAATTCAGGGAGCTGG - Exonic
1006642192 6:35495275-35495297 CTTTGGGTGAGGATGGGAGCAGG + Intronic
1006762952 6:36479706-36479728 ATCTGAGTAAGTACAGGAGCAGG + Exonic
1009452012 6:63812319-63812341 CTTGAAGGAAGTGAGGGAGCAGG - Intronic
1011342822 6:86336264-86336286 CTTTGACTAAGGAAGAGACCAGG - Intergenic
1015035573 6:128650221-128650243 CTTTGAGTATCTCAGGCAGCAGG - Intergenic
1017681610 6:156870150-156870172 CTTTGAAGAAGTAGGAGAGCCGG + Intronic
1018113342 6:160558366-160558388 CTGTGAGTAAATAAAGGGGCTGG - Intronic
1019212154 6:170415238-170415260 CTTTCAGGAAGGGAGGGAGCAGG + Intergenic
1020148780 7:5665751-5665773 ATTTGAGTAACTAAGGGAATTGG - Intronic
1021229052 7:18063486-18063508 CTTTGAGATAGTAGGGGATCCGG - Intergenic
1021457504 7:20845556-20845578 CTTTGAAGAAGAAAGGGAGCAGG - Intergenic
1023113470 7:36837828-36837850 GTCTGAGTAGATAAGGGAGCAGG + Intergenic
1027505320 7:79010847-79010869 CTTTCAGTAAATGAGAGAGCTGG + Intronic
1028945693 7:96577146-96577168 CTTTAAGTAAATAACTGAGCTGG + Intronic
1029461594 7:100697174-100697196 CTTTGAGAAAGGAAGCTAGCTGG - Intergenic
1030938948 7:115620910-115620932 CCTTGGGAGAGTAAGGGAGCAGG - Intergenic
1031306945 7:120140300-120140322 TTATGAGTTAATAAGGGAGCTGG - Intergenic
1031551325 7:123116733-123116755 CTGTGTGAAAGAAAGGGAGCTGG + Intronic
1035055902 7:156036305-156036327 CTTTGATTTAATAAGGGAGTGGG - Intergenic
1035870008 8:3127318-3127340 CTTTGAGTAATTAGGGGAACAGG - Intronic
1037931825 8:22885527-22885549 CTCCGAGTATGTGAGGGAGCTGG + Intronic
1040607359 8:48947035-48947057 CTTTGAGGAAGTAAGTGGCCTGG + Intergenic
1040994339 8:53387097-53387119 CTTAGAGCACGGAAGGGAGCAGG - Intergenic
1041182728 8:55265551-55265573 CTAAGAGTAAGAAAGGGAGGGGG + Intronic
1041773437 8:61497539-61497561 CTTTGAGTAAGTAAGTGGTGGGG - Intronic
1041941669 8:63394853-63394875 CTTTTATTAAGTAAGGGAAATGG - Intergenic
1042257934 8:66825674-66825696 CTCTGTGTAAATAAGGGAGTAGG - Intronic
1045578693 8:103454280-103454302 CTTTGATTCAGTAAGTAAGCTGG + Intergenic
1052699982 9:31925926-31925948 CTTTGTGTAATAAAGAGAGCAGG - Intergenic
1054992289 9:71343088-71343110 CTTAGAGTAGGGAAGGGAGGGGG + Intronic
1058089081 9:100783512-100783534 CGTTGAGTAAGTTGGGGAGGAGG - Intergenic
1058180159 9:101788356-101788378 GTATGAGTCAGTAATGGAGCTGG + Intergenic
1060237050 9:121871856-121871878 CTTTGAGTGTGGAAGGGAGCTGG - Intronic
1061144237 9:128787684-128787706 CTTGGAGAGAGTACGGGAGCAGG - Intronic
1061247097 9:129406133-129406155 CTTTCAGTAGAAAAGGGAGCAGG + Intergenic
1187236267 X:17470258-17470280 GTTTGGATAATTAAGGGAGCAGG - Intronic
1194632468 X:96302332-96302354 CTGTGGATAAGTAAGGGGGCAGG - Intergenic
1198428228 X:136540863-136540885 CTGTTAGTAAGTGATGGAGCTGG - Intronic
1199129572 X:144168275-144168297 CTTTGAGTTAGTAAAGGGCCAGG - Intergenic
1199818164 X:151418807-151418829 CTTGGAGAAAGTAATGGAGTTGG + Intergenic