ID: 1172591336 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:36120158-36120180 |
Sequence | GAATCACTTATAACCACGCC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1172591336_1172591338 | 24 | Left | 1172591336 | 20:36120158-36120180 | CCAGGCGTGGTTATAAGTGATTC | No data | ||
Right | 1172591338 | 20:36120205-36120227 | TAATCCTCATCCTAAGAAATGGG | No data | ||||
1172591336_1172591337 | 23 | Left | 1172591336 | 20:36120158-36120180 | CCAGGCGTGGTTATAAGTGATTC | No data | ||
Right | 1172591337 | 20:36120204-36120226 | TTAATCCTCATCCTAAGAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1172591336 | Original CRISPR | GAATCACTTATAACCACGCC TGG (reversed) | Intronic | ||