ID: 1172591336 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:36120158-36120180 |
| Sequence | GAATCACTTATAACCACGCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1172591336_1172591338 | 24 | Left | 1172591336 | 20:36120158-36120180 | CCAGGCGTGGTTATAAGTGATTC | No data | ||
| Right | 1172591338 | 20:36120205-36120227 | TAATCCTCATCCTAAGAAATGGG | No data | ||||
| 1172591336_1172591337 | 23 | Left | 1172591336 | 20:36120158-36120180 | CCAGGCGTGGTTATAAGTGATTC | No data | ||
| Right | 1172591337 | 20:36120204-36120226 | TTAATCCTCATCCTAAGAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1172591336 | Original CRISPR | GAATCACTTATAACCACGCC TGG (reversed) | Intronic | ||