ID: 1172591336

View in Genome Browser
Species Human (GRCh38)
Location 20:36120158-36120180
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172591336_1172591338 24 Left 1172591336 20:36120158-36120180 CCAGGCGTGGTTATAAGTGATTC No data
Right 1172591338 20:36120205-36120227 TAATCCTCATCCTAAGAAATGGG No data
1172591336_1172591337 23 Left 1172591336 20:36120158-36120180 CCAGGCGTGGTTATAAGTGATTC No data
Right 1172591337 20:36120204-36120226 TTAATCCTCATCCTAAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172591336 Original CRISPR GAATCACTTATAACCACGCC TGG (reversed) Intronic