ID: 1172591336

View in Genome Browser
Species Human (GRCh38)
Location 20:36120158-36120180
Sequence GAATCACTTATAACCACGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172591336_1172591337 23 Left 1172591336 20:36120158-36120180 CCAGGCGTGGTTATAAGTGATTC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1172591337 20:36120204-36120226 TTAATCCTCATCCTAAGAAATGG 0: 1
1: 0
2: 3
3: 14
4: 175
1172591336_1172591338 24 Left 1172591336 20:36120158-36120180 CCAGGCGTGGTTATAAGTGATTC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1172591338 20:36120205-36120227 TAATCCTCATCCTAAGAAATGGG 0: 1
1: 0
2: 1
3: 15
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172591336 Original CRISPR GAATCACTTATAACCACGCC TGG (reversed) Intronic
905944476 1:41890187-41890209 AAATTACTTAGAACCAAGCCTGG + Intronic
907550605 1:55301593-55301615 GAATCATTTACAACAATGCCTGG - Intergenic
908565023 1:65345607-65345629 GACTCAATAATAACCACTCCTGG - Intronic
911442930 1:97951668-97951690 GAAACACTTAGAACAATGCCTGG - Intergenic
918005825 1:180541317-180541339 GAAGCACTTAGAACAATGCCTGG + Intergenic
918666844 1:187161989-187162011 AAAGCACTTAAAACCATGCCTGG - Intergenic
920712309 1:208306945-208306967 GAAGCAATTATTACCATGCCTGG - Intergenic
1067512739 10:46909292-46909314 GAAGCATTCATCACCACGCCTGG - Intergenic
1067649506 10:48142530-48142552 GAAGCATTCATCACCACGCCTGG + Intergenic
1072291437 10:93969235-93969257 CAAGCACATACAACCACGCCCGG - Intergenic
1074423658 10:113331603-113331625 AAAACACTTAGAACCATGCCTGG - Intergenic
1076036200 10:127200544-127200566 GAGTAACCTGTAACCACGCCTGG + Intronic
1077897028 11:6460823-6460845 GAAGCACTTAGAATCATGCCTGG - Intronic
1081496504 11:43616529-43616551 GAAGCACTTAGAACAATGCCTGG - Intronic
1085582995 11:77671927-77671949 GAAACTCATATAACCAGGCCAGG - Intronic
1087191801 11:95262481-95262503 GAAGCACTTAGAACCATGCCCGG + Intergenic
1087851439 11:103034690-103034712 CAAACACTCATCACCACGCCTGG - Intergenic
1095812952 12:46390595-46390617 GAAGCACTTAGAACCATGCCTGG + Intergenic
1100971609 12:100076993-100077015 GAATCACTTATAATCCCACATGG - Intronic
1107640909 13:42442280-42442302 AAATCACTTAGCACCAAGCCTGG - Intergenic
1116133808 14:40894501-40894523 GCATCACTTAGAACCAAGCTAGG + Intergenic
1122633702 14:103120195-103120217 AAAACACTTAGAACAACGCCTGG + Intergenic
1128101178 15:65001278-65001300 GAAGCACTTATAATTACTCCAGG - Intergenic
1128231128 15:66036144-66036166 GGATCAGTGATAACCACCCCAGG + Intronic
1128399248 15:67260800-67260822 GAATGCCTTAGAACCAGGCCAGG + Intronic
1130139932 15:81216453-81216475 GCATCACTTCTACCCACCCCTGG + Intronic
1132135969 15:99339223-99339245 GAATAAGTTGTAAACACGCCTGG - Intronic
1136595528 16:31246645-31246667 TAATCACTTAGAACCATGTCTGG + Intergenic
1138938129 16:61755961-61755983 CAAGCACATACAACCACGCCTGG + Intronic
1139332572 16:66204890-66204912 GACTTACTTATTACCACTCCTGG - Intergenic
1143357277 17:6339719-6339741 GAATCATCTATGACCACGTCAGG - Intergenic
1146701418 17:34963807-34963829 AAAGCACTTAGAACCATGCCTGG - Intronic
1147651847 17:42067368-42067390 CAAGCACTTATGACCACACCAGG - Intergenic
1153336232 18:3928556-3928578 GAAGCACTTGGAACCATGCCTGG - Intronic
1159988361 18:74872612-74872634 GAAGCACGTACCACCACGCCTGG - Intronic
930075062 2:47399793-47399815 GAATCACTTGAAACCAGGGCGGG + Intergenic
931182218 2:59914480-59914502 GAACCACTTATAACAGCACCTGG + Intergenic
935615362 2:105074522-105074544 GAAGCACTTAGAACTATGCCTGG - Intronic
941017700 2:160375336-160375358 GAATCACTTATGACTAAGTCGGG - Intronic
942384612 2:175428710-175428732 GAGGCACCTATCACCACGCCTGG - Intergenic
945709839 2:213282126-213282148 AAAGCACTTATAACCATGTCTGG - Intergenic
1171988326 20:31676238-31676260 GAAGCACTTAGCACCATGCCTGG - Intronic
1172591336 20:36120158-36120180 GAATCACTTATAACCACGCCTGG - Intronic
1184083393 22:42242057-42242079 CAGGCACTTATTACCACGCCTGG - Intronic
950645027 3:14371938-14371960 GAATCACTTGTCACCGGGCCTGG - Intergenic
964405544 3:156344651-156344673 GAATCACTCAAAACCATCCCAGG - Intronic
978783668 4:112584047-112584069 ATATCACTTAAAACCATGCCAGG + Exonic
979772369 4:124543596-124543618 GAATCACTTAAAACAATACCTGG - Intergenic
982791414 4:159595995-159596017 AAATCACTTAGAACAGCGCCTGG + Intergenic
985720745 5:1487342-1487364 GAATGACTCAGAACCACGCGTGG + Intronic
991633104 5:68676762-68676784 AAATCACTTATAACTCCCCCAGG - Intergenic
993921554 5:93811000-93811022 AAAGCACTTAAAACAACGCCTGG + Intronic
994204687 5:97021613-97021635 GTATCACTTATAACCACTGCTGG - Intronic
1009520944 6:64681587-64681609 GAATCACTTTTAGCGAGGCCAGG - Intronic
1013652015 6:112205162-112205184 GAAACACTTAGAACAATGCCAGG + Intronic
1017860186 6:158389966-158389988 GAATCACTTGAACCCACACCCGG - Intronic
1024161467 7:46680659-46680681 GAATCACTTAGAAGGAGGCCTGG + Intronic
1026229947 7:68473961-68473983 AAAGCACTTAGAACCACTCCTGG + Intergenic
1026967382 7:74448859-74448881 GAATCACTTAACATCAGGCCTGG - Intergenic
1028838352 7:95398861-95398883 AAATCACTTATCACCACCTCTGG + Intergenic
1031434404 7:121714553-121714575 GAATCACTTTGAACCATTCCTGG - Intergenic
1034630317 7:152525452-152525474 CAGTCACGTATCACCACGCCTGG - Intergenic
1037109755 8:15151962-15151984 GAATCACTTAATATCACGTCAGG - Intronic
1037507669 8:19547980-19548002 GAATCACTTAATACAATGCCGGG - Intronic
1043074932 8:75686273-75686295 AAAACACTTAAAACCAAGCCTGG - Intergenic
1043146361 8:76660690-76660712 AAAGCACTTATCACCATGCCTGG + Intergenic
1044857032 8:96486965-96486987 GAAACACTAATAACCACAACTGG + Intergenic
1047633042 8:126729006-126729028 AAATCATTTAGAACCATGCCTGG - Intergenic
1051763945 9:20501449-20501471 GACTCAGTTAAAACCACACCCGG + Intronic
1055952861 9:81746740-81746762 CAGTCACTTACCACCACGCCTGG - Intergenic
1056320665 9:85431845-85431867 GATTCACTTATAAGGAAGCCTGG + Intergenic
1061898203 9:133659409-133659431 GAAGCACTTGGTACCACGCCTGG - Intergenic
1186221863 X:7357382-7357404 GAATCACTTATAATCAATCCTGG - Intergenic
1186221930 X:7358325-7358347 GAAGCACTTAGAACCATGTCTGG - Intergenic
1187820654 X:23284458-23284480 CAACCACTTATAACAACGCTGGG + Intergenic
1189245368 X:39559225-39559247 GTAACACTTAGAACCATGCCCGG + Intergenic
1197405526 X:126043358-126043380 GAGTCTCTTTTAACCACCCCAGG - Intergenic
1199655576 X:149991745-149991767 GAAGCACTTAAAACAAGGCCTGG + Intergenic