ID: 1172591592

View in Genome Browser
Species Human (GRCh38)
Location 20:36121841-36121863
Sequence CTTTGGGCAGGAAGTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 768
Summary {0: 1, 1: 0, 2: 14, 3: 83, 4: 670}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172591582_1172591592 12 Left 1172591582 20:36121806-36121828 CCCATACACTGGTGGGTGTAACC 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1172591592 20:36121841-36121863 CTTTGGGCAGGAAGTGGGGAAGG 0: 1
1: 0
2: 14
3: 83
4: 670
1172591586_1172591592 -9 Left 1172591586 20:36121827-36121849 CCTCTTATTATTTCCTTTGGGCA 0: 1
1: 0
2: 0
3: 35
4: 320
Right 1172591592 20:36121841-36121863 CTTTGGGCAGGAAGTGGGGAAGG 0: 1
1: 0
2: 14
3: 83
4: 670
1172591583_1172591592 11 Left 1172591583 20:36121807-36121829 CCATACACTGGTGGGTGTAACCT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1172591592 20:36121841-36121863 CTTTGGGCAGGAAGTGGGGAAGG 0: 1
1: 0
2: 14
3: 83
4: 670
1172591577_1172591592 23 Left 1172591577 20:36121795-36121817 CCAGCAGGGACCCCATACACTGG 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1172591592 20:36121841-36121863 CTTTGGGCAGGAAGTGGGGAAGG 0: 1
1: 0
2: 14
3: 83
4: 670
1172591576_1172591592 28 Left 1172591576 20:36121790-36121812 CCTGTCCAGCAGGGACCCCATAC 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1172591592 20:36121841-36121863 CTTTGGGCAGGAAGTGGGGAAGG 0: 1
1: 0
2: 14
3: 83
4: 670
1172591581_1172591592 13 Left 1172591581 20:36121805-36121827 CCCCATACACTGGTGGGTGTAAC 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1172591592 20:36121841-36121863 CTTTGGGCAGGAAGTGGGGAAGG 0: 1
1: 0
2: 14
3: 83
4: 670

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172591592 Original CRISPR CTTTGGGCAGGAAGTGGGGA AGG Intronic
900628996 1:3624039-3624061 CTTCAGTCAGGGAGTGGGGATGG - Intergenic
900916875 1:5645386-5645408 CAAAGGGCAGGGAGTGGGGAGGG + Intergenic
900983037 1:6057439-6057461 CTGAGGGCAGGAGGAGGGGAAGG + Intronic
901064388 1:6488007-6488029 CTTCGGTCTGGCAGTGGGGAAGG - Intronic
901331053 1:8408841-8408863 CTTGGGGCAGGAGGTGGTGGTGG + Intronic
901433323 1:9231663-9231685 CTTCTCGCAGGAGGTGGGGAGGG - Intergenic
901838773 1:11940676-11940698 CTTTGGGCAGTAGGTGGGGAGGG + Intronic
903220381 1:21865921-21865943 GTTTGGGCAGGGAGGGGGGTGGG - Intronic
903365797 1:22804906-22804928 CTTAGAGAAGGAAATGGGGAGGG - Intronic
903731040 1:25495538-25495560 CTGTAGGGAGGGAGTGGGGAAGG - Intronic
904268797 1:29334887-29334909 CTTTGGGGACTCAGTGGGGAAGG + Intergenic
904365921 1:30010801-30010823 CCTGGGGCAGGAAGTGGGAGTGG - Intergenic
904466063 1:30708135-30708157 CTTTGGGAAGGAGGTTGGGAAGG + Intergenic
905230144 1:36510150-36510172 AGATGGGCAGGCAGTGGGGATGG - Intergenic
905262904 1:36731771-36731793 TTTGGGGCATGTAGTGGGGAAGG + Intergenic
905726634 1:40258017-40258039 CTTTGGGCCGGAAGTGAGGAAGG + Intergenic
906202360 1:43968211-43968233 CTTTGGGCTGCAAGTGGGGTAGG + Intergenic
906293661 1:44635971-44635993 CTGTGGGGAGCAGGTGGGGATGG + Intronic
907468324 1:54654219-54654241 CTTAGGGCAGGGAGAGGAGAAGG + Intronic
907732152 1:57077068-57077090 CTTGGGGCAGGAATGGGCGAAGG + Intronic
910290183 1:85592896-85592918 GGTTGAGGAGGAAGTGGGGATGG + Intergenic
910991204 1:93058383-93058405 GTGTGTGGAGGAAGTGGGGATGG + Intergenic
911155328 1:94630551-94630573 TTCTTGCCAGGAAGTGGGGAAGG - Intergenic
911381315 1:97118506-97118528 CATGGGGCAGGAACTGAGGAGGG + Intronic
911475518 1:98367653-98367675 CTTTGTGGAGGCAGTGGGGTTGG - Intergenic
911755417 1:101548557-101548579 CATTGAGCAGGCAGTGGGGCTGG - Intergenic
912138365 1:106689827-106689849 GGTTTGGCAGGAAGTGGGGAGGG + Intergenic
912392326 1:109312178-109312200 CTTTGGGCAGGAGGGAGGGTGGG + Exonic
913340755 1:117755744-117755766 CCTGGGGCAGGGGGTGGGGAGGG + Intergenic
913518147 1:119622618-119622640 CCAGGGGAAGGAAGTGGGGAAGG - Exonic
914250610 1:145918721-145918743 CTAGGGGCGGGAAGTGGGGCGGG - Exonic
914416778 1:147491324-147491346 CCTTGGGCAGGAAGGGTGAAGGG - Intergenic
914876114 1:151513644-151513666 CTTCTGGCAGGAAGTGGGGGTGG - Intronic
915320447 1:155053187-155053209 CTCTGGGCAGGAAGCCGAGAAGG + Intronic
916004608 1:160648067-160648089 GGTTGGGGAAGAAGTGGGGATGG - Intergenic
916026470 1:160837722-160837744 CTGCTGGCAGGAAGTGGGGCAGG - Intronic
916262041 1:162851691-162851713 CATGGGGGAGGAAATGGGGAAGG + Intronic
916505548 1:165425236-165425258 CTGTGGGTAGGAATTGGGCAAGG - Intronic
916758467 1:167795803-167795825 CTTTAGGAAGGATGTGAGGAGGG - Intergenic
917167660 1:172130781-172130803 CAGTAGGCTGGAAGTGGGGAAGG + Intronic
918204671 1:182298201-182298223 CTATGGGGAGGATGTGGGGCAGG - Intergenic
918651276 1:186966342-186966364 CTCTGGGAAGGATGTAGGGATGG + Intronic
919099037 1:193071020-193071042 TTTTCCGCAGGCAGTGGGGAGGG + Intronic
919471709 1:197987461-197987483 CGTGGGGAAGGAAGTGTGGAGGG - Intergenic
919931155 1:202222317-202222339 TTTGGGGCAGGATGTGGGGGCGG + Intronic
919966166 1:202527687-202527709 TTTTGGGCAGGAGGTTGGGGAGG - Intronic
920440695 1:205978741-205978763 GCTTGGGCAGGCAGTGGGGCTGG + Exonic
920569093 1:207002817-207002839 CTTTGGGCAGGAAGGGGTGGAGG + Intergenic
921518523 1:216128903-216128925 CCTGGGGAAGGAAATGGGGAGGG - Intronic
921841755 1:219836127-219836149 CTTTCTGCAGGAAATGGGGCAGG - Intronic
921993845 1:221396211-221396233 CTTTGGTGGGGATGTGGGGAGGG - Intergenic
923191725 1:231626760-231626782 CGCTGGACGGGAAGTGGGGAGGG - Intronic
923483299 1:234404881-234404903 ATTTGGGCATTAAGTGGGTAAGG - Intronic
923682815 1:236132637-236132659 TATTGGGCAGGAAGTGTGGGAGG + Intergenic
923714542 1:236413777-236413799 CTTTGTGCAGTCAGTAGGGAAGG + Intronic
923765446 1:236888907-236888929 TCTTGGGCAGGGGGTGGGGATGG + Intronic
923884593 1:238140535-238140557 CTATGGGCAGGGAGAGGGCAGGG + Intergenic
924286692 1:242494458-242494480 CTTAGAGCAGGAAGAGGGGATGG - Intronic
924454159 1:244204790-244204812 CTTTGGTCAGTCACTGGGGAAGG + Intergenic
1063775697 10:9261227-9261249 ATGTGGGCATGAAGTGAGGAGGG - Intergenic
1063972493 10:11390905-11390927 GGTGGGGCAGGAAGTGAGGACGG + Intergenic
1064110309 10:12532961-12532983 GGGTGGGTAGGAAGTGGGGATGG + Intronic
1065801243 10:29354952-29354974 CTTTGAGGAGGAACAGGGGAGGG - Intergenic
1066491033 10:35895002-35895024 CGTTGGGCTGGAGGTGGGGAAGG + Intergenic
1066694967 10:38069238-38069260 CATTGGGCAGTGAGTGGGCAGGG - Intergenic
1067061848 10:43081728-43081750 CTTGGGGCTGGAAGGGGAGAAGG + Intronic
1067172866 10:43922289-43922311 GTTTGGGGAGGAAGGGAGGAAGG - Intergenic
1067294602 10:44968047-44968069 CTTAGAGCAGGAAGTTGGGGTGG + Intronic
1067342604 10:45417841-45417863 TCTTGGCCAAGAAGTGGGGAGGG - Intronic
1067564326 10:47325912-47325934 CTTTGGGTGGGGTGTGGGGAGGG - Exonic
1067566283 10:47340049-47340071 CTTGTGGCAGGAGGTGGGGTGGG - Intergenic
1068011532 10:51457410-51457432 CTTTGGGGACTCAGTGGGGAGGG + Intronic
1068192297 10:53667591-53667613 ATTTGGGCATGAGGTGGAGAAGG - Intergenic
1068774295 10:60854299-60854321 CTTAGGGCTGGGAGTGGGGATGG + Intergenic
1069626058 10:69868290-69868312 CTTTGGGCAGGTGGTGGTGGTGG + Intronic
1070284438 10:75072878-75072900 GTGTGGGCAGGAAGTGGGACGGG - Intergenic
1070679812 10:78440644-78440666 CTTGGGGCAGGAACTGGGACTGG - Intergenic
1070722730 10:78768033-78768055 CTGTGGGCAGGAGGTGAGCAAGG + Intergenic
1070764149 10:79047028-79047050 CTTAGGGCAGGAACACGGGAGGG - Intergenic
1071521609 10:86334831-86334853 CTGTGTTCTGGAAGTGGGGAGGG - Intronic
1073006573 10:100329787-100329809 TTTTGGGCAGGGGGTGGGGGTGG - Intronic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073299717 10:102463492-102463514 CTGTGGGCTGGAGGAGGGGAAGG + Intronic
1073434368 10:103507352-103507374 CTTGGGGCAAGAGATGGGGAGGG + Intronic
1073498427 10:103915281-103915303 CTTTGGGAAGGGAGTGGGGCTGG - Intronic
1073760780 10:106626194-106626216 CTGAGGGTAGGAACTGGGGAGGG + Intronic
1073930173 10:108566544-108566566 CCCTGGGCAGGAAGTGGGACAGG + Intergenic
1074049120 10:109866553-109866575 CTTTTGGTTGGAAGTAGGGAGGG + Intronic
1074137916 10:110644127-110644149 CTGGGCGCAGGAAGCGGGGAGGG - Intergenic
1074159391 10:110824571-110824593 TGTTGGGAATGAAGTGGGGAGGG + Intronic
1075006705 10:118835863-118835885 CTTTGGGGAAGAGGTGGGGAGGG - Intergenic
1075382399 10:122029905-122029927 CGGTGGGCAGGGGGTGGGGAGGG + Intronic
1076428637 10:130385345-130385367 CTCTGGGCTGGATGTGTGGATGG + Intergenic
1076504023 10:130960019-130960041 TGTGGGGCAGGAAGTGGGGCTGG - Intergenic
1076542958 10:131225742-131225764 CTGTGTGCAGGGAGTTGGGAGGG - Intronic
1076688138 10:132207392-132207414 CTTGGGGCAGCCAGTGGGGTGGG - Intergenic
1076799039 10:132812253-132812275 CTTTTGGCAGGAGGTGGGGATGG - Intronic
1077333971 11:1995126-1995148 CTGTGGGCATGATGTGGGGGAGG - Intergenic
1077552414 11:3206555-3206577 CTTTGAGGAGGATGTGGAGAAGG + Intergenic
1077902116 11:6497934-6497956 CTTTGGGGAAGCAGTAGGGAGGG + Exonic
1078333473 11:10445126-10445148 ATTATGGCAGGAAGTGGGGAGGG - Intronic
1080944621 11:36957625-36957647 TGTTGGGAGGGAAGTGGGGATGG + Intergenic
1081532067 11:43968812-43968834 CTTTGTGCAGGAAGTAGGATGGG + Intergenic
1081611863 11:44567696-44567718 CATCGAGCAGGAAGTGGGGGTGG - Intronic
1081746811 11:45478879-45478901 CTGAGGCCAGGAAGTGGGCAAGG + Intergenic
1081989236 11:47328760-47328782 CTTCGGACAGGAGGAGGGGAGGG + Intronic
1082005316 11:47415856-47415878 CTTTGGCTTAGAAGTGGGGAAGG - Exonic
1082689183 11:56278852-56278874 CTTGAAGCAGGAGGTGGGGAGGG - Intergenic
1083396029 11:62392661-62392683 CTGTGGGCTGGAAGGTGGGAAGG + Exonic
1083541418 11:63514088-63514110 CTTTGGGAAGGAGGTGGCCAGGG - Intronic
1083647923 11:64183884-64183906 CTGTGTGGAGGAAGAGGGGAGGG - Intergenic
1083771429 11:64869860-64869882 GTGTCGGCAGGAAGTGGGGGCGG + Intronic
1083903430 11:65654866-65654888 CCTGGGGCAGGACTTGGGGAGGG + Exonic
1084345916 11:68548794-68548816 ATTTGGGTGGGAAGAGGGGAGGG + Intronic
1084394249 11:68898447-68898469 GTTTGAGCAGGATGTGGTGAAGG - Intronic
1084406825 11:68979109-68979131 CTGTGGGAAGGAAAGGGGGAGGG + Intergenic
1085227646 11:74936820-74936842 GGGTGGGGAGGAAGTGGGGAAGG - Intronic
1085512060 11:77093448-77093470 CTCTGGCCAGGAAGGGGAGAGGG + Intronic
1086028363 11:82322726-82322748 CTTTGTGACTGAAGTGGGGAGGG + Intergenic
1087102725 11:94380774-94380796 CTGGGGGCAGGAAGTGGGGAGGG + Intronic
1087782634 11:102317559-102317581 CTCTGGGCAGCAGGTGGGCAAGG + Exonic
1087914915 11:103799116-103799138 CTTTGGGCTGGACATTGGGATGG + Intergenic
1088164808 11:106921554-106921576 CTTTGTGAAGGAATTGGAGAAGG - Intronic
1089323831 11:117644038-117644060 CTTGGGATAGGAACTGGGGAAGG - Intronic
1089411995 11:118252095-118252117 CTCTGGGAAGGAAGGAGGGAGGG - Intronic
1089669772 11:120045802-120045824 ATTTGGGATGGAAGTAGGGAAGG - Intergenic
1089775318 11:120831746-120831768 ATGTGGGCTGGAAGTGGGGTCGG - Intronic
1090002439 11:122973865-122973887 CTTTGGGGGAGAAGTGGGGAAGG - Intergenic
1090087114 11:123660138-123660160 ATTGTGGCAGGAAGTGGGGTGGG + Intergenic
1090098159 11:123764476-123764498 ATCTGGGCAGGAGGAGGGGAAGG + Intergenic
1090118845 11:124003178-124003200 AATTGGGGAGGAAGTGTGGATGG - Intergenic
1090449870 11:126796941-126796963 CACAGAGCAGGAAGTGGGGAAGG + Intronic
1090632265 11:128660095-128660117 CTTTGGGCAGGAGGTGAAGTAGG + Intergenic
1090769988 11:129911477-129911499 GTTTGGAAAGGAAGTTGGGAGGG - Intronic
1202816954 11_KI270721v1_random:50308-50330 CTGTGGGCATGATGTGGGGGAGG - Intergenic
1091790201 12:3267861-3267883 CGTTGGGCAGGAGTGGGGGATGG - Intronic
1091791581 12:3274986-3275008 CTTTGGACAGGAAATGGGAAAGG + Intronic
1091983891 12:4891812-4891834 CTCTGGGCAGGGAGCAGGGAGGG + Intergenic
1091999579 12:5021238-5021260 CTTTGGGCAGACAGAGGGGAGGG - Intergenic
1092099028 12:5867927-5867949 GAGTGGGCAGGAAGTGGGAATGG + Intronic
1092626088 12:10330315-10330337 CTGGGGGCAGGAATTAGGGAAGG + Intergenic
1092658366 12:10712069-10712091 ATTTGGGCAGGATGTGATGATGG + Intronic
1092754678 12:11752418-11752440 ATAAGGGCAGGAAGAGGGGAGGG - Intronic
1093079400 12:14791966-14791988 CTTTGGGGACTCAGTGGGGAAGG + Intronic
1093080929 12:14810161-14810183 CCTTGGGTGGGGAGTGGGGAGGG + Intronic
1093601704 12:21034251-21034273 GTTTGGGGGGAAAGTGGGGATGG - Intronic
1093667971 12:21836914-21836936 ATGTGGGGAGGATGTGGGGAGGG + Intronic
1094118337 12:26941302-26941324 TTTTGGCCAGGAAGTGGAGTGGG - Intronic
1094219017 12:27973874-27973896 CATTGCCCAGGAAGTAGGGAAGG - Intergenic
1094406300 12:30119954-30119976 GTTGGGGGAGGAGGTGGGGACGG - Intergenic
1094871319 12:34600726-34600748 CTGTGGGCATGAAGCTGGGACGG - Intergenic
1095776427 12:46015518-46015540 CTTTGGGGACTCAGTGGGGAGGG - Intergenic
1096078195 12:48817894-48817916 CCTTGGCAGGGAAGTGGGGAAGG + Intronic
1096346115 12:50848326-50848348 TTCTGGGTGGGAAGTGGGGAAGG - Intronic
1096354474 12:50928637-50928659 CTTTAGGCAGACAGTAGGGAAGG - Intronic
1096460178 12:51818112-51818134 CCAGGGGCAGGGAGTGGGGAGGG - Intergenic
1096520980 12:52184359-52184381 CTGTGGTCAGGTAGTGGGCAGGG - Intronic
1096545818 12:52339528-52339550 CTGTGGCCAGCAAGTGGTGAGGG + Intergenic
1096621321 12:52867542-52867564 GTTTGGGGTGGAGGTGGGGAAGG - Intergenic
1096670984 12:53198081-53198103 CTGTGGCGAGGAAGAGGGGAGGG - Intronic
1096809939 12:54162802-54162824 CTTTGGCCATGGGGTGGGGAGGG - Intergenic
1096967429 12:55639351-55639373 CCTGGAGAAGGAAGTGGGGAAGG + Intergenic
1097102205 12:56597770-56597792 GTTTGGGAAGGAGGTGGGGAAGG + Exonic
1097125880 12:56774498-56774520 CCATGGACAGGGAGTGGGGATGG + Intronic
1098046547 12:66407229-66407251 CTACAGGCAGGAGGTGGGGAGGG - Intronic
1098065262 12:66608005-66608027 ATGTGGGCAGCAGGTGGGGAGGG + Intronic
1098352545 12:69579195-69579217 CTTTTTGGAGGAAGTGGGGATGG + Exonic
1098457837 12:70695586-70695608 ATCTGGGCAGGAAATGGAGAAGG + Intronic
1100227353 12:92572665-92572687 ATTTGGGCATGAAGGTGGGAAGG + Intergenic
1100721359 12:97362328-97362350 CTGTGAGCAGGAAGGAGGGATGG + Intergenic
1101058386 12:100944491-100944513 CTTTTGGGGGAAAGTGGGGAGGG - Intronic
1101504295 12:105331387-105331409 GGTGGGGCAGGAAGCGGGGAAGG + Intronic
1101611604 12:106297890-106297912 TTTGGGGCAGGAAGTGGGAGGGG - Intronic
1101719152 12:107336000-107336022 CATTGGGCGGGTGGTGGGGAGGG - Intronic
1101748622 12:107564233-107564255 CTTTGGGAAGGATGTTGGAAAGG - Intronic
1101811308 12:108110349-108110371 CTTTGGGGAGGATGTGGGTCTGG + Intergenic
1101870242 12:108559977-108559999 CTTTGGGCCGGAAGGGGTGAAGG - Intronic
1101926207 12:108973313-108973335 CCGAGGGCAGGGAGTGGGGATGG + Intronic
1101966648 12:109286745-109286767 CTGGGGGCAGGAGGTGGGGCAGG + Intronic
1101977889 12:109377894-109377916 CTATGGGAAACAAGTGGGGAAGG - Intronic
1102680725 12:114688600-114688622 CTTTGGGGAGGAGGAAGGGATGG - Intergenic
1103006327 12:117423251-117423273 CTTTGGCCAGTCATTGGGGATGG + Intronic
1103497912 12:121376979-121377001 GAATAGGCAGGAAGTGGGGAAGG + Intronic
1103774168 12:123353161-123353183 TTTTGGGCAGGGAGTGAGGAAGG + Intronic
1104484673 12:129140412-129140434 CTGTGGTCAGGGATTGGGGAGGG - Intronic
1104733120 12:131119900-131119922 CTTTGGGGAGGAATGGGGGCAGG + Intronic
1106588083 13:31074400-31074422 CATTTGCCAGGCAGTGGGGAGGG - Intergenic
1107005915 13:35611576-35611598 CCTTGGGCTGGAGGTGGGCAGGG - Intronic
1107511600 13:41091202-41091224 CTTTGGGGATTCAGTGGGGAAGG + Intergenic
1107786493 13:43962997-43963019 CATTGGGCAGAGGGTGGGGAAGG - Intergenic
1108182834 13:47857956-47857978 CATAGGGCAGGAAGTGAGAATGG - Intergenic
1108415810 13:50197111-50197133 TTTTGAACAAGAAGTGGGGAAGG + Intronic
1108761269 13:53568479-53568501 ATTTGGGGAGGAAGTGGGAGCGG + Intergenic
1110176875 13:72567585-72567607 CATTGGCCAAGAAATGGGGAGGG - Intergenic
1110566457 13:76961936-76961958 CTATGGGCTGGAGGTGGGAATGG - Intergenic
1110714157 13:78682988-78683010 ATTTGGAGTGGAAGTGGGGAGGG + Intergenic
1110719711 13:78747536-78747558 TTATGGGCAGGGATTGGGGATGG + Intergenic
1112094433 13:96116531-96116553 GTTTGGGAATGGAGTGGGGATGG - Intronic
1112184028 13:97111306-97111328 GTTGGGGCATGTAGTGGGGATGG + Intergenic
1112318826 13:98388924-98388946 TTGTGGGAAGTAAGTGGGGAAGG - Intronic
1112537258 13:100271546-100271568 CCTTGGCCAGAAAATGGGGAAGG + Intronic
1112683844 13:101799689-101799711 CTTTGGGAAGGAAGTGGGAAGGG - Intronic
1112753994 13:102609922-102609944 GTTTGGGCAGGATGTGGGATGGG + Intronic
1115358836 14:32478744-32478766 TTTTAGGCAGGAAATGGGGATGG + Intronic
1116897851 14:50334740-50334762 TTTTGGGCAGGAGGTTGGGTGGG - Exonic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1117251661 14:53946104-53946126 CTTTGGAGAGGGAGTGGGGGCGG + Intergenic
1119380312 14:74224208-74224230 CCTTGAGCAGAAGGTGGGGAGGG - Intergenic
1119562447 14:75602081-75602103 CATAGGGCAGGAAATTGGGATGG + Intronic
1119722948 14:76903584-76903606 CTTTGGGAAGGAAGCAGGAATGG - Intergenic
1120746726 14:88159123-88159145 CCTGAGGCATGAAGTGGGGATGG - Intergenic
1121328233 14:93034165-93034187 CTGGGGGCAGGATGTGGGGGAGG - Intronic
1121444904 14:93972708-93972730 CCTTGGTAAGGAAGGGGGGATGG + Intronic
1121979750 14:98444223-98444245 CTCTGGGCAGGAAGTGGGGGTGG + Intergenic
1122448539 14:101784748-101784770 CTTTGGGCAGAAAGAAGGGTGGG + Intronic
1122774669 14:104111897-104111919 CTATGGGGAAGCAGTGGGGAGGG - Intronic
1122993620 14:105250543-105250565 CTTTGGGCAGGAGGGGATGACGG + Exonic
1123014624 14:105367852-105367874 GGGTTGGCAGGAAGTGGGGAGGG - Intronic
1202893415 14_KI270722v1_random:181321-181343 CTTTGCTCTGGAAGTGGGGGTGG - Intergenic
1124376906 15:29134286-29134308 CTTTAGTCAGGAGGTGGGCATGG - Intronic
1124997827 15:34741001-34741023 CTTTTGGGAGGAAGAGTGGAGGG - Intergenic
1125513187 15:40303650-40303672 CTCTGGGCAGGAGGACGGGAAGG - Intronic
1125676534 15:41505156-41505178 CCTTGGGGAGGGAGTTGGGATGG + Intronic
1125682744 15:41542892-41542914 CTTTGGGTAGGCATTGGGGTAGG - Intronic
1125727019 15:41873343-41873365 ATCTGGGTGGGAAGTGGGGATGG + Intronic
1125877134 15:43159363-43159385 CATTGGGAGGGAGGTGGGGATGG - Intronic
1125913547 15:43463905-43463927 CTTTGGGTGGGAAGGGGGGTTGG - Intronic
1125956583 15:43794678-43794700 TCTTGGGCTGGAAGTGGGGGTGG - Exonic
1126096399 15:45093872-45093894 CTAAGGGCAGGAAGTCTGGAGGG + Exonic
1127729332 15:61784087-61784109 CTTTGGGGACTCAGTGGGGAAGG + Intergenic
1127932737 15:63607821-63607843 GTGTGTGCAGGAAGAGGGGAAGG - Intergenic
1128009900 15:64283001-64283023 CTTTGGGCAGAAGGGTGGGAGGG + Intronic
1128665130 15:69532169-69532191 CATTTGGGAGGAAGTGGGGTAGG - Intergenic
1128700947 15:69803859-69803881 CTTTGGGGAGGAAGTGCAGGAGG + Intergenic
1128797647 15:70477311-70477333 CTATGGGGAGGGAATGGGGAGGG - Intergenic
1128977715 15:72165626-72165648 CTATGGTGAGGAAGAGGGGAGGG - Intronic
1129384015 15:75185776-75185798 CTGAGGGAAGGGAGTGGGGATGG + Intergenic
1129536369 15:76316418-76316440 CTCTGTGCAGGAAGAGTGGATGG + Intergenic
1130260245 15:82348862-82348884 CTTGGGGCAGCAGGAGGGGAGGG + Intronic
1130268485 15:82430571-82430593 CTTGGGGCAGCAGGAGGGGAGGG - Intronic
1130280988 15:82520145-82520167 CTTGGGGCAGCAGGAGGGGAGGG - Intergenic
1130472358 15:84236326-84236348 CTTGGGGCAGCAGGAGGGGAGGG - Intronic
1130479849 15:84350897-84350919 CTTGGGGCAGCAGGAGGGGAGGG - Intergenic
1130491921 15:84437232-84437254 CTTGGGGCAGCAGGAGGGGAGGG + Intergenic
1130503535 15:84516272-84516294 CTTGGGGCAGCAGGAGGGGAGGG + Intergenic
1130535797 15:84784157-84784179 CTTTGGGCAGGAGGTTGGCAGGG - Exonic
1130594656 15:85240962-85240984 CTTGGGGCAGCAGGAGGGGAGGG - Intergenic
1132120245 15:99169579-99169601 CAGTGAGCAGGGAGTGGGGAGGG + Intronic
1132357238 15:101180847-101180869 CTTTGGGCAGGAAGTGCATCAGG - Intronic
1132514663 16:360567-360589 CTCTGGGCAGAACCTGGGGAAGG + Intergenic
1132957317 16:2601808-2601830 CTGTGGGCAGGGAGTTGGGGGGG - Exonic
1133099484 16:3470506-3470528 CTTTGGGAAGGACGTGGAGCTGG - Intronic
1134064920 16:11221929-11221951 CTCTGGCCAGGAGGTGGGGAGGG + Intergenic
1134099439 16:11441218-11441240 TATAGGGCAGGAAGCGGGGATGG + Intronic
1134344736 16:13379263-13379285 ATTTTGGAAGGAAGTGGGAAAGG + Intergenic
1134850535 16:17475081-17475103 ATTTGGGGTGGAGGTGGGGAGGG - Intergenic
1135699237 16:24617128-24617150 TTTTTGGCAGGTTGTGGGGATGG + Intergenic
1135920276 16:26643246-26643268 GTCTGGGCAGGATGTGGGGAGGG + Intergenic
1136783267 16:32920382-32920404 CTTTGGGGAGTACTTGGGGAGGG + Intergenic
1137803531 16:51283179-51283201 CTGAGGGCAGGAGGAGGGGAAGG - Intergenic
1138449605 16:57085613-57085635 CTTTGGGGAGGAAGGGGGCAGGG - Intergenic
1138488845 16:57364352-57364374 CTTTTGGCAGGGAGAGGGGAGGG - Exonic
1138546298 16:57721890-57721912 CGTGTGGCAGGAAGGGGGGAGGG - Intronic
1138599558 16:58046581-58046603 CTTTGGGAAGGAAAAGAGGAAGG - Exonic
1138756516 16:59492962-59492984 CTCGGGGCAGAGAGTGGGGAAGG + Intergenic
1139512844 16:67437124-67437146 CAGTGGGCATGAAGTGGGGGTGG - Exonic
1140019981 16:71229725-71229747 CTATGGGCTGGAAGTGGGGAAGG + Intronic
1140225201 16:73071361-73071383 CTGTGGTCTGGCAGTGGGGAAGG - Intergenic
1141500961 16:84443769-84443791 CTTTGGGAAGGCAGTGGTGTGGG - Intronic
1141518838 16:84564150-84564172 TTTGGGGCAGGGAGTGGGGTGGG + Intergenic
1141680071 16:85538653-85538675 CTGTGGGGAGGAAGTGGAGGAGG + Intergenic
1142898345 17:2996421-2996443 CTCTGAGCAGGAACTGGGGAGGG + Intronic
1143419160 17:6775836-6775858 CTTTGGGCAGGGAGAGTGGCTGG + Intergenic
1143618713 17:8069041-8069063 CATTGGGCAGAAACTGGGGAAGG - Intergenic
1143626041 17:8110591-8110613 CTCTGGGGTGGAAGTGGGCAGGG - Intronic
1143832001 17:9659999-9660021 CTTTGGGATGGGAATGGGGATGG + Intronic
1144085777 17:11807354-11807376 TTTTGGGCAAGAAGAGGGGACGG - Intronic
1144754262 17:17669775-17669797 GCTGGGGCAGGGAGTGGGGAAGG - Intergenic
1144783890 17:17821404-17821426 CTTTGGGATGGAGATGGGGATGG + Intronic
1145285208 17:21500456-21500478 TTTTTGCCAGGAAATGGGGACGG + Intergenic
1145392321 17:22465288-22465310 TTTTTGCCAGGAAGTGGGGATGG - Intergenic
1145749899 17:27348068-27348090 CTTTGGGTACGATGTGAGGAAGG - Intergenic
1145993253 17:29091753-29091775 CCTTGGGCAGGGAATGGGGCAGG - Intronic
1146076008 17:29729898-29729920 TTGTGGAGAGGAAGTGGGGATGG + Intronic
1146456793 17:33015047-33015069 CTGTGGAACGGAAGTGGGGAAGG - Intronic
1146511855 17:33456347-33456369 TATTTGGGAGGAAGTGGGGAGGG - Intronic
1146668596 17:34721417-34721439 CTGTGAGCAGGAAACGGGGATGG + Intergenic
1146723170 17:35137473-35137495 CATTGGGCAGGGAAAGGGGATGG + Intronic
1147134047 17:38425200-38425222 CTATGGGCAGGAAGCATGGAGGG - Intergenic
1147186928 17:38717972-38717994 CTTTGGGAAGAAAGGGGAGAGGG - Intronic
1147619922 17:41859125-41859147 CTTTGGGCAGCCAGAGGGGATGG + Intronic
1148465575 17:47863123-47863145 CTCTGGGCAGGAAAGGAGGATGG + Intergenic
1148617988 17:49014416-49014438 CCTTGGCCAGGAGGAGGGGACGG - Intronic
1148688535 17:49513797-49513819 GGGTGGGCAGGCAGTGGGGAAGG - Exonic
1148804997 17:50259591-50259613 CTTGGGGCAGGGAGTGGGCTTGG - Intergenic
1149020768 17:51961942-51961964 GCTTGGGCATGAAGTGGAGAGGG - Intronic
1149801949 17:59577532-59577554 CTTTGAGCAGGAAATGGAGTAGG + Intronic
1149844541 17:59997949-59997971 CTTTGAGCAGGAAATGGAGTAGG - Intergenic
1150564140 17:66323599-66323621 CTGTGGGCAAGAAGTGTGTATGG + Intronic
1150956586 17:69866799-69866821 CATAGGGAAGGAAGTGAGGAAGG + Intergenic
1151119740 17:71779445-71779467 GGTTGGGCAGGCAGTTGGGAAGG + Intergenic
1151312146 17:73299882-73299904 CTGAGAGCAGGAAGTGGGAATGG - Intronic
1151933123 17:77245264-77245286 CTTTGGGAAGGAAATGTGGAGGG + Intergenic
1152622682 17:81373067-81373089 GTGGGGGCAGGAAATGGGGAGGG - Intergenic
1152851533 17:82639473-82639495 CTTTGGGAAGGAGGTGGAAAGGG - Intronic
1152856051 17:82664911-82664933 GCTTGGGGAGGAGGTGGGGAGGG - Intronic
1153033336 18:735478-735500 CTTTGGGGAGTAAGGGGGAAAGG + Intronic
1153466305 18:5391511-5391533 CTCTGCTCAGGAAATGGGGATGG - Intergenic
1153979029 18:10293909-10293931 GGAGGGGCAGGAAGTGGGGAAGG - Intergenic
1155840379 18:30635535-30635557 CTCTGGGCAGGAACTAGGCAGGG + Intergenic
1156398938 18:36723560-36723582 CTTTTGGCAGGGAGCGAGGAGGG + Intronic
1157616449 18:48990400-48990422 CAATGGGCAGGAAGGAGGGAGGG + Intergenic
1157732796 18:50019347-50019369 ATCTGGGAGGGAAGTGGGGAGGG - Intronic
1157819276 18:50753565-50753587 CCTATGGCAGGGAGTGGGGAAGG + Intergenic
1157934449 18:51857891-51857913 CTCCTGGCAGGAGGTGGGGAGGG - Intergenic
1158269895 18:55701417-55701439 CACTGGGGAGGAGGTGGGGATGG - Intergenic
1158449527 18:57551598-57551620 CTTTAGGAAGGTAATGGGGAAGG - Intronic
1158589536 18:58768276-58768298 CTTTGGAAAGGAAATGGGGCAGG + Intergenic
1158775547 18:60574129-60574151 CATGGGGCAGGAGGTGGGGATGG + Intergenic
1159493944 18:69176144-69176166 AGTTGGGCAGAAAGTGGAGAAGG - Intergenic
1160239781 18:77114869-77114891 CTGCAGGGAGGAAGTGGGGAAGG + Intronic
1160585075 18:79909632-79909654 CTATGGTGAGGATGTGGGGAAGG - Intronic
1160585110 18:79909758-79909780 CTATGGTGAGGATGTGGGGAAGG - Intronic
1160585228 18:79910154-79910176 CTATGGTGAGGATGTGGGGAAGG - Intronic
1160585237 18:79910186-79910208 CTATGGTGAGGATGTGGGGAAGG - Intronic
1160585246 18:79910218-79910240 CTATGGTGAGGATGTGGGGAAGG - Intronic
1160828340 19:1091037-1091059 CTTGAGGCAGGAAATGGGGTTGG - Intronic
1161332745 19:3696156-3696178 CATTGGGCAGGAAGAGGGCATGG - Intronic
1161552630 19:4922798-4922820 AATGGGGCGGGAAGTGGGGATGG - Intronic
1161777834 19:6273380-6273402 GTGTGGGAAGAAAGTGGGGATGG + Intronic
1162241983 19:9362672-9362694 CTTTGGTCAGGAAGAGGGGAGGG + Intronic
1162484899 19:10953800-10953822 CTTTGGGCGGGAACCGGGGAGGG - Intergenic
1163233574 19:16019044-16019066 CTTGGGGGAGCAGGTGGGGATGG + Intergenic
1163678891 19:18669396-18669418 CTTTGGGAAGGAGGGAGGGAGGG - Exonic
1164159456 19:22617176-22617198 CTTTTGGTGGGAGGTGGGGAAGG - Intergenic
1164604421 19:29587145-29587167 CTATGGGCATGATGTTGGGAAGG + Intergenic
1165067718 19:33238887-33238909 GTGTGGGCAGGAGGTGGGGATGG - Intergenic
1165068496 19:33242029-33242051 GTATGGGCAGGAGGTGGGGACGG - Intergenic
1165183444 19:33994270-33994292 GAGTGGGAAGGAAGTGGGGATGG + Intergenic
1165471462 19:36007006-36007028 CTTTGGATAGGAAATGGGGGAGG - Intronic
1165498569 19:36169319-36169341 TGGTGGGCAGGAACTGGGGAAGG - Intergenic
1165854406 19:38870986-38871008 CTGGGGGCTGGAAGTGAGGAGGG + Exonic
1165874113 19:38993562-38993584 TATTAGACAGGAAGTGGGGATGG + Intronic
1166209135 19:41294535-41294557 CTGCGGGCAGGAATTGGTGAGGG - Intronic
1166366422 19:42280673-42280695 CTTTGTGCAGGGAGGGCGGACGG - Intronic
1166370903 19:42300288-42300310 CTGTGGGCAAGAAGTGGTGTGGG + Intronic
1166371504 19:42303822-42303844 CTCTGGGGAGGAAGAGGAGAAGG + Intronic
1166702181 19:44888590-44888612 CATGAGGCAGGAGGTGGGGAAGG + Exonic
1166867041 19:45845327-45845349 GGTTGGGGAGGAAGTGGGAATGG - Intronic
1168031445 19:53683033-53683055 CTTTGGGAATGGAGTGGGGCGGG + Intergenic
1168288135 19:55344585-55344607 ATTTGGGCAGGGAGTGTGGCAGG + Intronic
925365352 2:3307557-3307579 CTGTGCGCAGGTAGTGGGCAGGG - Intronic
926396894 2:12452838-12452860 CCTGGGGCAGGTAGTGGGGAGGG - Intergenic
926627814 2:15107844-15107866 CTTGGGGCCAGGAGTGGGGATGG - Intergenic
927207508 2:20619407-20619429 CTCTGGGCAGGATGGGTGGAGGG - Intronic
927504123 2:23602284-23602306 CTTTGGGCAGGCCCTGGGGCAGG - Intronic
928176488 2:29037588-29037610 CTCAGGCCAGGAAGTGGGGTGGG - Intronic
928405828 2:31014255-31014277 TTTTGGGGAGGAAGGGGGAAGGG - Intronic
928769559 2:34690512-34690534 CTGGGAGCAGGAAGTGGGGTTGG + Intergenic
929087062 2:38178824-38178846 CTTTGGGAAGGACAAGGGGATGG - Intergenic
929261110 2:39867395-39867417 CAGTGGGCAGGAAGTGGTGATGG + Intergenic
929441956 2:41971707-41971729 CTCTGGGCAGGTTGTGTGGATGG - Intergenic
929960287 2:46491016-46491038 CTTGGTGGAGGAGGTGGGGAGGG + Intronic
930912183 2:56642299-56642321 CCTTCAGCAGGAAATGGGGAGGG - Intergenic
931578347 2:63744819-63744841 ATTTGTGCAGGAGGTGGGGTGGG - Intronic
931806023 2:65805172-65805194 CTGCGGGGAGGAAGTGGGGATGG + Intergenic
932211096 2:69931306-69931328 GGGTGGGCAGGAGGTGGGGATGG - Intronic
932290531 2:70573807-70573829 CTGTGGGAAGGAATTTGGGAAGG - Intergenic
932341230 2:70963667-70963689 CTGAGAGCAGGAAGTGGGTAGGG - Intronic
932421831 2:71605812-71605834 CTTGGGGGAGGAATGGGGGATGG - Intronic
933209091 2:79545298-79545320 CTATGGACAGGGAGTGGGGAAGG - Intronic
933726805 2:85431578-85431600 CTTTGCTCTGGAGGTGGGGAGGG - Intronic
933778986 2:85788482-85788504 CTTTGGGCTGGGACTGGTGATGG - Intergenic
933809109 2:86021408-86021430 GTGGGGGCAGGAGGTGGGGAGGG + Exonic
933849679 2:86355840-86355862 CTTTGGGCAGGAAATGGAGGGGG + Intergenic
934109225 2:88726197-88726219 CTTTGGTCAGGTACTGGGGTGGG + Intronic
934557249 2:95294017-95294039 CTTGGGGCAGGCAGTGGGCATGG - Intergenic
934691658 2:96365398-96365420 CTTCGGGCAGGGGGTGGGGTGGG - Intronic
934876700 2:97927941-97927963 ATTTGGTGAGGAAGTGGGCAGGG + Intronic
935266997 2:101403227-101403249 CTTTGTGTGGGAAGTGGGTAAGG + Intronic
935290816 2:101609626-101609648 CTTGGGGCAGGGATTGGGTAAGG - Intergenic
935703977 2:105840055-105840077 GGTTGGGGAGGAAGTGGAGATGG + Intronic
936651605 2:114433567-114433589 CTATGGGCATAGAGTGGGGAGGG + Intergenic
937777046 2:125790276-125790298 TTTTGGGCATGATGTGAGGAAGG - Intergenic
937802725 2:126099187-126099209 ATGTGGGGAGGAAGTGGGAATGG + Intergenic
937910404 2:127073014-127073036 CTGTGGGGGGGAGGTGGGGACGG - Intronic
938387482 2:130877220-130877242 CATGGGGCAGAAAGTGGAGAGGG + Intronic
938895881 2:135750011-135750033 CTTAGGACAGGATGAGGGGAGGG - Intronic
939241652 2:139568654-139568676 GTTTGGGGGGAAAGTGGGGATGG + Intergenic
939611842 2:144320533-144320555 CTTTGGGCAGGAAGAGGACAAGG + Intronic
939928817 2:148206605-148206627 GGTTGGGAAGGCAGTGGGGAGGG - Intronic
940884036 2:158973344-158973366 CTTTGGGTAGGAGATGGGGGTGG + Intronic
942735472 2:179106337-179106359 CTTTGGGTAGGATGTGAGAAGGG + Exonic
945008945 2:205441347-205441369 CTTTTGGCAGGAGGTGGGGTTGG - Intronic
945208999 2:207363127-207363149 CTGTGGGGGTGAAGTGGGGAGGG - Intergenic
945376706 2:209085122-209085144 AACTGGGCAGGGAGTGGGGAAGG - Intergenic
945435193 2:209809975-209809997 CTTCGGGGAAGGAGTGGGGAGGG - Intronic
945836274 2:214839178-214839200 CTTTAGGCAGGAAAGGGGGAGGG + Intergenic
946466349 2:219915273-219915295 TTTTGGGGGTGAAGTGGGGAGGG + Intergenic
946901712 2:224379670-224379692 CTTTGGCCAGCAAGTGGCAAAGG + Exonic
947498166 2:230653982-230654004 CTTTGGGGAGGCTCTGGGGAAGG - Intergenic
947612572 2:231532994-231533016 CTGTAGGCAGTAAGTGGGGTGGG - Intergenic
947637581 2:231687858-231687880 CCCTGGGCGGGAGGTGGGGAGGG + Intergenic
947885546 2:233566670-233566692 CTTTAGGCAGTAAGTGCGGCTGG - Intronic
948911888 2:241009028-241009050 CTGGGGGCAGGACATGGGGATGG + Intronic
949003098 2:241628568-241628590 CTTTAGGGAGGAAGTGGCGGTGG - Intronic
949009118 2:241668413-241668435 CAGTGGGCAGGAGGTGGGGAGGG - Intronic
1169197103 20:3689262-3689284 ATGGGGGCAGGAGGTGGGGAGGG - Intronic
1169374498 20:5055598-5055620 TTTTTGGGAGGAGGTGGGGAAGG + Intergenic
1170708792 20:18770052-18770074 GGTTGGGAAGGTAGTGGGGATGG - Intergenic
1171024944 20:21621636-21621658 AGTGGGGAAGGAAGTGGGGATGG + Intergenic
1171234606 20:23514043-23514065 ATTTGGGCAGGAAATGTGAAGGG - Intergenic
1171973100 20:31576936-31576958 TTTTGGGAAGGCAGTAGGGAGGG - Intronic
1172014004 20:31862296-31862318 GGTAGGGCAGGCAGTGGGGAGGG + Intronic
1172033171 20:31995619-31995641 GTTGGGGAAGGAAGTGGGCAGGG - Intronic
1172068014 20:32235186-32235208 CTCTGGCCAGGCAGTGGGGATGG - Exonic
1172591592 20:36121841-36121863 CTTTGGGCAGGAAGTGGGGAAGG + Intronic
1172615337 20:36279691-36279713 CTTTGGGGAGGTGGTTGGGAGGG - Intergenic
1172926669 20:38543413-38543435 AATTGGGCAAGAAGTGAGGAGGG - Intronic
1174082616 20:47981433-47981455 TTTTGGACAGGAAGAAGGGAGGG + Intergenic
1174385709 20:50187569-50187591 CTTTCCCCAAGAAGTGGGGATGG - Intergenic
1174400272 20:50272221-50272243 GTCTGGGCAGGGAATGGGGAGGG + Intergenic
1174992740 20:55530091-55530113 CTGGGGGCAGGGAGTGGGCAAGG + Intergenic
1175877929 20:62238958-62238980 CGCTGAGCAGGAAGTGGGGACGG + Intronic
1175983590 20:62753401-62753423 CTTGTGGCAGGAGGTTGGGAGGG + Intronic
1176081408 20:63275093-63275115 CGTTGGGAAGGTGGTGGGGAGGG + Intronic
1176236674 20:64056690-64056712 CTTTGGGCGGGCAGGGGGCAGGG + Intronic
1176687328 21:9862454-9862476 CTCTGCTAAGGAAGTGGGGAAGG + Intergenic
1177174496 21:17689526-17689548 CTCTGGGCAAGAACTCGGGAGGG - Intergenic
1177453715 21:21306818-21306840 GTTGGGGGAGGAGGTGGGGATGG - Intronic
1178246420 21:30957250-30957272 ATGTAGGCAGGAGGTGGGGAGGG + Intergenic
1178623769 21:34198919-34198941 CTGTAGGCAGGATGTGGGCAGGG - Intergenic
1178820777 21:35973159-35973181 CCTTGGGAAGGAAGGTGGGAAGG - Intronic
1178835135 21:36090889-36090911 ATTTGAGGAGAAAGTGGGGATGG + Intergenic
1178908471 21:36655139-36655161 GCTTGGGCAGGGAGAGGGGATGG - Intergenic
1179054191 21:37916243-37916265 GTTTGGGCAGGGACGGGGGAGGG + Exonic
1179995457 21:44971910-44971932 CTTTGAGCGGGCAGAGGGGACGG + Intronic
1180657668 22:17436880-17436902 CTTTAGGCAGGAACTGGGGGTGG + Intronic
1182316114 22:29448539-29448561 CTTTGGCCAGGAAGATGGGGAGG - Intergenic
1182453270 22:30433641-30433663 CTTGGGGCACGAAGTGGGAGTGG - Intergenic
1182570665 22:31235268-31235290 CTATAGGAAGGATGTGGGGAAGG - Intronic
1183281554 22:36935275-36935297 CTCAGGGCAGGGAGTGGGGTTGG - Intronic
1183315147 22:37132939-37132961 GCTTGGGCAGGGAGTGGGAAAGG + Intronic
1183477145 22:38042031-38042053 CTTTGGGGAGGAGTTGGGGAAGG + Intergenic
1183623203 22:38986747-38986769 CTCTGGGCAGGAGATGTGGAAGG + Intronic
1183630019 22:39027222-39027244 CTCTGGGCAGGAGATGTGGAAGG + Intronic
1183633455 22:39047087-39047109 CTCTGGGCAGGAGATGTGGAAGG + Intronic
1183672401 22:39280578-39280600 CCTTGGGCAGGAAGTACCGAGGG - Intergenic
1183698317 22:39435757-39435779 CTTTGGCCATGAAGAGGGGGTGG + Intronic
1183700715 22:39449459-39449481 CTCTGGGCAGGGAGCAGGGAGGG + Intergenic
1184629853 22:45768244-45768266 GGTGGGGCAGGAAATGGGGAAGG + Intronic
1184694413 22:46131582-46131604 CTCTAGGCAGGCAGAGGGGAGGG + Intergenic
1184728900 22:46362451-46362473 CTTCGGCCAGGAAGTGAGGATGG - Exonic
1184927409 22:47652909-47652931 CTGAAGGAAGGAAGTGGGGATGG + Intergenic
1185139555 22:49092701-49092723 CTGTGGGCGGGAAGAGGGGAAGG - Intergenic
950138989 3:10602125-10602147 GCCAGGGCAGGAAGTGGGGAGGG - Intronic
950357670 3:12425499-12425521 CTCTGGGCAGGATAAGGGGAGGG - Intronic
950972290 3:17201435-17201457 CTTGGGGCAGAAAGCTGGGAGGG + Intronic
952412710 3:33064007-33064029 CTATGGGCAGCTTGTGGGGATGG - Intronic
952741081 3:36735629-36735651 ATTTTGGCAGGAAGCTGGGAAGG - Intronic
952820435 3:37481636-37481658 CTTAGGGCATGAGGTGGGTAGGG - Intronic
952999416 3:38918534-38918556 TCGTGGGCAGGAAGTGGGGGTGG - Intronic
953291574 3:41669372-41669394 CTTTGGGGTGGGAGTGGGGAGGG - Intronic
953391348 3:42535692-42535714 CTGTGTGCAGTGAGTGGGGAGGG + Intronic
954287595 3:49629930-49629952 CATTGGGTAGGAGTTGGGGATGG - Intronic
954330936 3:49889964-49889986 CCTGGGCCAGGAAGTGGGTAAGG + Exonic
954384501 3:50237153-50237175 CTTGGTGCAGGAAGGGTGGAGGG - Intronic
954574829 3:51670290-51670312 CTTTTGGTGGGAGGTGGGGAAGG - Intronic
954639047 3:52087162-52087184 GCTTTGGCAGGAAGTGGGGGCGG + Intronic
955008945 3:54995919-54995941 CATTGGGCATGCTGTGGGGAGGG - Intronic
955619790 3:60850552-60850574 GTTTGGGAAGGAGGTAGGGATGG - Intronic
955788882 3:62568033-62568055 CTTTTAGCAGGAAGAAGGGATGG - Intronic
956881868 3:73519179-73519201 CCTTGGGCAGAAAGTAGGGTGGG + Intronic
957134571 3:76269023-76269045 TATTGGGGAGGAGGTGGGGATGG + Intronic
957885014 3:86275551-86275573 ATTTGGGAAGGAAGGAGGGAGGG - Intergenic
958123020 3:89317651-89317673 TTTGGGGCAGGAAATGAGGAAGG - Intronic
958831556 3:99096800-99096822 CCTTGGAGAGGAAGTGGGAAAGG + Intergenic
959892288 3:111570402-111570424 CATGAGGCAGGAGGTGGGGAAGG - Intronic
959933217 3:112004339-112004361 CTGTGGACAGAAAGTGGGAAAGG + Intronic
960649622 3:119932396-119932418 CTGTGGGAAGGAAATGGGAAAGG + Intronic
961112850 3:124299471-124299493 CTTGGAGCAGGAGGTGGGGTGGG + Intronic
961256861 3:125562097-125562119 CTTTGGGGAGAAAGTGGGATTGG - Intronic
961919929 3:130414969-130414991 CTTTGGGGTGGATGTGGGGGTGG + Intronic
962053421 3:131843217-131843239 CTTCTGGAAGGCAGTGGGGAGGG + Intronic
962356588 3:134699338-134699360 CTGTGGCCTGGAAGTTGGGAGGG + Intronic
963466687 3:145690474-145690496 CTTTGTGAAAGAAGTAGGGATGG + Intergenic
963837425 3:150071149-150071171 ATTTGGGCAGGGAGTTGTGATGG + Intergenic
964358651 3:155871581-155871603 CTCTGAGAAGGAAGCGGGGAGGG - Intronic
965612781 3:170562474-170562496 CTTTGGGGACTCAGTGGGGAGGG + Intronic
965681920 3:171260440-171260462 TCTTGGGGAGGAGGTGGGGATGG - Intronic
967281596 3:187828764-187828786 ATTAGGGCAGGAAGTGAAGAAGG + Intergenic
967703241 3:192619360-192619382 GTGTGGGCAGGAACTGGGAAAGG + Intronic
968725886 4:2247642-2247664 CTCTGTGCAGGCAGTGGGGAGGG + Exonic
968932991 4:3593101-3593123 CATTGCGCAGAGAGTGGGGATGG + Intergenic
969567277 4:7985944-7985966 CAAGGGGCAGGAAGTGGGCAGGG - Intronic
969624943 4:8297625-8297647 CTGTGGGAAGGGAGTGGGGCAGG + Intronic
971482246 4:27125242-27125264 GTCTGGGCAAGAAGTGAGGAGGG + Intergenic
972045226 4:34656981-34657003 CTTTGGGCAGCAAGGAAGGAAGG + Intergenic
973663827 4:53137291-53137313 CTTTGGGAAAGAAGTGAGGAAGG - Intronic
973700168 4:53529305-53529327 CTGGGAGCAGGCAGTGGGGACGG + Intronic
975669462 4:76766386-76766408 CTGTAGGCAGGAAGTGGGGAAGG + Intronic
976781313 4:88761644-88761666 CTTAGGACAGGAAGGGGGAATGG + Intronic
977916564 4:102600689-102600711 CCTTGGGTAGGCAGTTGGGAGGG + Intronic
979435269 4:120680783-120680805 CTTTGGGGACACAGTGGGGAAGG + Intergenic
979913836 4:126405174-126405196 CTCTGGGCATGGAGTGGGGATGG - Intergenic
981266378 4:142788625-142788647 CTTTGGGGACTCAGTGGGGAAGG - Intronic
982136072 4:152275569-152275591 CTGTTGGGAGCAAGTGGGGAGGG - Intergenic
982263861 4:153520568-153520590 CTTTGGGCAGGAAACTGGGAAGG + Intronic
983225530 4:165082588-165082610 CTTTTGGAAGGATCTGGGGAGGG + Intronic
984699360 4:182808436-182808458 CTTGGCACGGGAAGTGGGGAGGG - Intergenic
984779063 4:183506783-183506805 GTTTGGGGAGGGGGTGGGGAGGG + Intronic
984855606 4:184193458-184193480 CTTAGGGCTGGAGGTGAGGATGG + Intronic
985230095 4:187806321-187806343 CGGTGGGGAGGAAGTGAGGATGG + Intergenic
985251800 4:188031909-188031931 CTTTCCGCAGGAAGCGAGGAGGG - Intergenic
985805384 5:2039265-2039287 CTGTGGGAAGGGACTGGGGAAGG - Intergenic
985824645 5:2183288-2183310 CTTCGGGGAGCAGGTGGGGAGGG + Intergenic
987091208 5:14509156-14509178 CTTGGGGCAGGAACAGGGGGAGG - Exonic
987224609 5:15827031-15827053 CATGGGGCAGGAAGTGCGGAAGG - Intronic
987334529 5:16887159-16887181 CTGTGGGCAGGATAAGGGGAAGG - Intronic
988907945 5:35809395-35809417 TTTTGTGCTGGAAGTGTGGAGGG + Intronic
990684387 5:58284934-58284956 CAGAGGGCAGGTAGTGGGGAAGG - Intergenic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991198195 5:63960285-63960307 CGTGGAGCAGGAAGTGGGGAGGG + Intergenic
991684290 5:69167388-69167410 ATTTGGGGAGGAAGGTGGGAGGG + Intronic
992102300 5:73419426-73419448 ATTTGGCCGGGTAGTGGGGAGGG + Intergenic
992493453 5:77268483-77268505 GGTGGGGCAGGAACTGGGGATGG - Intronic
993731492 5:91428319-91428341 CTATGTGCAGGGAGTGGGCATGG - Intergenic
995322119 5:110847365-110847387 TAGTGGGCGGGAAGTGGGGATGG - Intergenic
995594597 5:113734306-113734328 ATTTTGCCAGGAAATGGGGAAGG + Intergenic
995748673 5:115430823-115430845 GTTTGGGAAGGAGCTGGGGAAGG - Intergenic
996432577 5:123398082-123398104 CTTAGGGGAAAAAGTGGGGAGGG + Intronic
996988910 5:129604099-129604121 CGGTGGGGAGGAGGTGGGGAGGG + Intronic
997282405 5:132657015-132657037 GTTCGGGGAGGAAGTGGGTAGGG + Intronic
997518899 5:134509520-134509542 CCTTGGGCAGGACTTGGGGCTGG + Intergenic
997787391 5:136726040-136726062 CTTTGGGCAGGAAGGAAGGCAGG + Intergenic
997943875 5:138182325-138182347 CTTTGGGCCAGAAGTGGGACAGG + Exonic
997977609 5:138449515-138449537 CTTTGGGTAGGGACTGGGGCAGG + Intergenic
998142412 5:139707614-139707636 CTTCAGGCAGGCAGTGGGGGAGG + Intergenic
998173767 5:139887595-139887617 CTTTGGGCTGGAACTGGGGAAGG + Intronic
998902338 5:146869659-146869681 CTTTGGGTAGGAAAGTGGGATGG + Intronic
999262402 5:150245887-150245909 CTCTGGCCAGGAGGTGAGGAGGG - Intronic
999605913 5:153315642-153315664 CTTTCAGCAGGATGTGGGCAGGG - Intergenic
999631651 5:153577540-153577562 CTTTGGGATGGAAGTGAGCAAGG - Intronic
1000462855 5:161544725-161544747 GTTGGGGCAGGAATGGGGGATGG + Intronic
1001088860 5:168722162-168722184 CTTTGGGCAGAGAGTGGGGAAGG + Intronic
1001697557 5:173683286-173683308 ATTTGGGGAGCAAGTGGGTAGGG - Intergenic
1001932454 5:175683073-175683095 TTTTGGCCAGGGGGTGGGGAAGG - Exonic
1002173505 5:177388254-177388276 CTGTGGGCAAGATGTGGGCAGGG - Intronic
1002896649 6:1383637-1383659 CTTTGGCCAGGCTGCGGGGAGGG + Intergenic
1003563980 6:7206899-7206921 CTTTGGGATGGAAGAGGGCAGGG + Intronic
1003646102 6:7913916-7913938 CTTTGAGCAGGGAGCAGGGAGGG - Intronic
1004181191 6:13381775-13381797 CTTGGGGGAGGAGGAGGGGAGGG - Intronic
1004183959 6:13406102-13406124 CTTTTGGCAGGAGGTGGAGATGG + Intronic
1004782305 6:18923196-18923218 GGTGGGGTAGGAAGTGGGGATGG - Intergenic
1004823242 6:19392819-19392841 CTTTGGGCAGGGAGCAGGTAAGG - Intergenic
1005997469 6:30940116-30940138 CTTTAGGCAGGAAGTGAGGAAGG + Intergenic
1006108113 6:31728784-31728806 CTTTGGGGAAGAATTGAGGATGG - Intronic
1006308654 6:33241297-33241319 CCATGGGCAGGGAGTGGGGATGG - Intergenic
1006472934 6:34238159-34238181 CCTCTGGCAGGAAGTGGGGCCGG + Intronic
1006596955 6:35200661-35200683 GCTTGGGTAGGAGGTGGGGAGGG - Intergenic
1006929003 6:37676291-37676313 CCTGGGCCAGGAAGTGGGGATGG + Intronic
1007144601 6:39615716-39615738 CTTTGGGCATGAAGTGGAACAGG - Intronic
1007240427 6:40420860-40420882 CTGTGGTAAGGAAGTGTGGAAGG + Intronic
1007652833 6:43433828-43433850 CTTTGGGTAGGCTGAGGGGAAGG + Intronic
1007777530 6:44232152-44232174 AGTTGGGCTGGAAGTGGGGAAGG + Intronic
1007806897 6:44457102-44457124 CTTTGGGGAGGCAGAGTGGAAGG + Intergenic
1007916114 6:45563199-45563221 GGTTGGGGAGGAAGGGGGGAGGG - Intronic
1009269277 6:61598087-61598109 CTTGTGGCAGGGAGTGGGGTGGG - Intergenic
1009369872 6:62885731-62885753 CTCTGGGTAGGAAATGGAGAAGG + Intergenic
1009616559 6:66015756-66015778 ATTGGGGTGGGAAGTGGGGATGG - Intergenic
1009823158 6:68830807-68830829 CATGGGTCAGGGAGTGGGGAGGG + Intronic
1010007698 6:71013211-71013233 ATTTGGGGAGGAAGCGGGGGTGG + Intergenic
1010053776 6:71539723-71539745 CTTTGGGGACTCAGTGGGGAAGG + Intergenic
1010346027 6:74811659-74811681 TTTTGGGCAGGAAGGGAGAAAGG - Intergenic
1010585143 6:77650184-77650206 CTTTGGGAAGGAAATGGCGCAGG - Intergenic
1012697035 6:102398701-102398723 GGTTGTGGAGGAAGTGGGGATGG - Intergenic
1012840558 6:104324314-104324336 CTTTGGGGTGGCAGGGGGGAGGG - Intergenic
1013342117 6:109225114-109225136 CTTTTGACAGGAAGTGAGGAAGG - Intergenic
1013583165 6:111555697-111555719 TTTTGGGGTGGAAGTGGGGTAGG - Intergenic
1013864244 6:114675535-114675557 TTTTGGGTAAGATGTGGGGAAGG + Intergenic
1014331713 6:120075930-120075952 TTTTGAACAGGAAGTAGGGAAGG - Intergenic
1015352727 6:132241681-132241703 GTTTGGGCAGGGAATGGAGATGG - Intergenic
1015354034 6:132255906-132255928 CTCTGGGCAGGGCGTGGAGAGGG - Intergenic
1015669244 6:135669122-135669144 CTGTGGGGAGGAAGTGGGGCAGG - Intergenic
1015696885 6:135990468-135990490 CTTTGGGAAACAAGTGGTGAGGG + Intronic
1015710032 6:136129492-136129514 CTTCGGGTGGGGAGTGGGGAGGG - Intronic
1015966454 6:138699060-138699082 CTTTGGGCAAGCAGTGAGTAGGG + Intergenic
1017156194 6:151324547-151324569 CTTGGGGCAGGGAGGAGGGAGGG - Intronic
1017900570 6:158715648-158715670 CTCTGGGCAGGGGGTGGGGGTGG - Intronic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018374877 6:163201511-163201533 CTTTGGGCATGAGGTGGGGCTGG + Intronic
1019021139 6:168918684-168918706 CTTCGGGCAGGAGATGGGGGAGG + Intergenic
1019705637 7:2495969-2495991 CTGTGGGGAGGGAGTGGGGCGGG + Intergenic
1020074496 7:5248767-5248789 CTCTGGGCAGGAGATGAGGAAGG - Intergenic
1020339947 7:7099545-7099567 CTGTGGGGTGGGAGTGGGGATGG - Intergenic
1020359681 7:7314932-7314954 CTATGAGCAGGAATGGGGGATGG - Intergenic
1020642064 7:10767890-10767912 CCTTGGGAAGGAAGTGGGGGAGG - Intergenic
1020976762 7:15015947-15015969 CTTTGGCAAGGAACCGGGGAAGG + Intergenic
1021396389 7:20153905-20153927 ATTGGGCCAGTAAGTGGGGATGG - Intronic
1021440800 7:20672402-20672424 CTGTTGGCAGGATGAGGGGAGGG + Intronic
1021472741 7:21024337-21024359 GGCTGGGCAGGAGGTGGGGAAGG - Intergenic
1022300773 7:29100216-29100238 GTTTAGGAAGGAAGTGGGGCTGG - Intronic
1022968681 7:35497532-35497554 CCTGGGGCAGGAAGTTTGGAAGG + Intergenic
1023665040 7:42514144-42514166 CTTTAAGCAGGGAGTGGGTAAGG + Intergenic
1023786484 7:43713480-43713502 ACTTGGGCAGGGAGAGGGGAAGG - Intronic
1024020332 7:45362555-45362577 CTATGGGGTGGGAGTGGGGATGG + Intergenic
1024250153 7:47500301-47500323 CTTAGAGCAAGAAGTGGGGAGGG + Intronic
1025204606 7:56985040-56985062 CTCTGGGCAGGAGATGAGGAAGG + Intergenic
1025667331 7:63591895-63591917 CTCTGGGCAGGAGATGAGGAAGG - Intergenic
1027821778 7:83055237-83055259 CATTGGGCAGTAAGAGAGGATGG + Intronic
1028154568 7:87415207-87415229 TACTGGGCAGGGAGTGGGGAGGG - Intronic
1028792849 7:94873271-94873293 CTCTGGGCTGGCAGTGGGCAGGG + Intergenic
1029107101 7:98186712-98186734 TTCTGGGCAGAAAGTGGGTAAGG - Intronic
1029372713 7:100159416-100159438 CTTGGGGCAGGAAAGGGGAAGGG + Exonic
1029686992 7:102155851-102155873 CTGGGTGCAGGGAGTGGGGAAGG - Intronic
1029724970 7:102396670-102396692 CTTTGGGGAGGAGGAGGAGAAGG + Intronic
1030145171 7:106345740-106345762 CTGGGGGCAGGAGGTGGGGCAGG - Intergenic
1030890180 7:114990491-114990513 CGTGGGGCAGGCAGAGGGGAGGG - Intronic
1031865968 7:127039533-127039555 CCTTGGGGAGGAAATGAGGAGGG + Intronic
1032508242 7:132451998-132452020 CTTGGGGAAGGAAGTGGGCAGGG - Intronic
1032520314 7:132538825-132538847 CTTAGGGCAGGATGTTAGGAGGG - Intronic
1032564279 7:132925530-132925552 ACTTGGGGATGAAGTGGGGATGG - Intronic
1032753188 7:134863170-134863192 ATGTGGGCAGGAGTTGGGGAGGG + Intronic
1033045880 7:137961861-137961883 CATTGGGCATGAAGAGGGCATGG - Intronic
1033157561 7:138970149-138970171 CGTCTGGGAGGAAGTGGGGATGG - Intronic
1033419975 7:141196905-141196927 CCTTGGGCTGTGAGTGGGGATGG + Intronic
1033608794 7:142946155-142946177 CTTTGGGTAGGAAGGGGTGGAGG + Intronic
1034159577 7:148983174-148983196 CGTTGGGAAGGAAAAGGGGAGGG + Intergenic
1034500336 7:151446708-151446730 CATGGAGAAGGAAGTGGGGAAGG - Intergenic
1034528471 7:151681042-151681064 CTCTCGGCAGGGGGTGGGGAGGG - Intronic
1034886044 7:154799577-154799599 ATTTGGGCTGGAAGGGGGGTTGG + Intronic
1035041495 7:155931503-155931525 CTTGGGTCAGAAAATGGGGAAGG - Intergenic
1035201880 7:157272961-157272983 CAGTGGGCAGGAACTGAGGACGG - Intergenic
1035593580 8:836613-836635 CTGTGGGCAGGGGGTGGGGTTGG + Intergenic
1036066900 8:5390647-5390669 CTTGGGGCAGGCCTTGGGGAAGG + Intergenic
1037228813 8:16629128-16629150 GTTGGGGGAGAAAGTGGGGATGG + Intergenic
1037805619 8:22056742-22056764 CTATCAGCTGGAAGTGGGGAGGG + Intronic
1037920549 8:22802405-22802427 CTTTGGGCAGAAACTGGAGAAGG - Intronic
1038196554 8:25373399-25373421 CTTTGGGAACTCAGTGGGGAAGG - Intronic
1038626923 8:29203005-29203027 CTTTATGTAGGAATTGGGGAAGG - Intronic
1038661648 8:29502698-29502720 ATTTGGGAAGGAATTGGAGAAGG - Intergenic
1038930808 8:32191672-32191694 CACTGGACAGGAAATGGGGATGG + Intronic
1038950399 8:32408148-32408170 CTTGGGGTAGGCAGTGGGGAAGG + Intronic
1039412774 8:37369399-37369421 CTTGGGGCAGGAAGGAAGGATGG - Intergenic
1039995839 8:42532350-42532372 GTTTGGGGTGGAGGTGGGGAAGG - Intronic
1040523568 8:48198544-48198566 CTGAGGGCAGCAAGTGGAGAAGG - Intergenic
1040551908 8:48444255-48444277 CTTTGGGCAGGGAGGGGCTATGG + Intergenic
1041418009 8:57635066-57635088 TTTTGGGGTGGAATTGGGGATGG - Intergenic
1041778295 8:61548989-61549011 CATGGTGCAGGAAGTGGGCAGGG - Intronic
1042163246 8:65919788-65919810 GGGTGGGGAGGAAGTGGGGATGG + Intergenic
1042307499 8:67346695-67346717 TTTTGGGCAGACAGTGGGGCTGG - Intergenic
1042722257 8:71839388-71839410 AAGTGGGCAGGAAGTGGGGTGGG - Intronic
1043197042 8:77308301-77308323 CTTTGCCCAAGAAGTGGGCAGGG + Intergenic
1043960850 8:86416934-86416956 CCTTGGGCAGCAAGGGAGGAAGG - Intronic
1044277771 8:90322135-90322157 CAGTGGGCAGGAGGTGGGAAGGG + Intergenic
1045444162 8:102242745-102242767 TTTTGGTTAGGATGTGGGGAGGG + Intergenic
1046785678 8:118263811-118263833 CTGTGGTCAGGCAGTGGAGATGG + Intronic
1047298059 8:123588678-123588700 TTTTTGGCAGGGTGTGGGGATGG - Intergenic
1047381938 8:124372330-124372352 TTTTGGAAAGGAAGTGGGGACGG - Exonic
1047393557 8:124474193-124474215 ATCTGGGCAGGAGGTGGGAAGGG + Intergenic
1047424593 8:124733776-124733798 AGTTTGGCAGGAAGCGGGGAGGG + Intergenic
1047695014 8:127394898-127394920 GTTTTGGCAGTAGGTGGGGAAGG - Intergenic
1048044056 8:130756700-130756722 CCTTGGGGAGGAAGAGGAGATGG + Intergenic
1049282496 8:141757174-141757196 CTTGGGGCAGGAATCGGGCAGGG + Intergenic
1049494676 8:142924178-142924200 CTATGGGCAGGGAGAGGGGCCGG - Intergenic
1049533188 8:143166665-143166687 ATCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533262 8:143166935-143166957 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533357 8:143167274-143167296 ATCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533368 8:143167308-143167330 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533379 8:143167342-143167364 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533390 8:143167376-143167398 ATCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533412 8:143167444-143167466 ATCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533422 8:143167478-143167500 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533441 8:143167546-143167568 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533452 8:143167580-143167602 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533462 8:143167614-143167636 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533492 8:143167716-143167738 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533502 8:143167750-143167772 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533512 8:143167784-143167806 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533523 8:143167818-143167840 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533533 8:143167852-143167874 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533552 8:143167920-143167942 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533563 8:143167954-143167976 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533582 8:143168022-143168044 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533604 8:143168090-143168112 ATCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533615 8:143168124-143168146 GTCTGGGGAGGAAGTGGGGAGGG + Intergenic
1049533625 8:143168158-143168180 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533647 8:143168226-143168248 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533666 8:143168294-143168316 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049541329 8:143210504-143210526 CTGTGGGCAGGGAGCGGGGGTGG + Intergenic
1050330943 9:4545576-4545598 CTTTGAGTAGAAAGTGGGTAAGG - Intronic
1050712902 9:8486089-8486111 CTTTGGGGAGGAGATGGTGAAGG - Exonic
1051065119 9:13093617-13093639 TATTTGGCAGGAATTGGGGACGG - Intergenic
1051167016 9:14273763-14273785 CATTGGGAAGGAAGTAGGGGTGG - Intronic
1051233845 9:14978502-14978524 CACAGGGCAGGAAGAGGGGAGGG - Intergenic
1051312868 9:15795199-15795221 CTGGGGGAAGGAAGTAGGGAAGG + Intronic
1051822669 9:21186093-21186115 ATGTGGGGAGGAAGTGGAGAGGG - Intergenic
1051827670 9:21238495-21238517 ATGTGGGGAGGAAGTGGAGAGGG - Intronic
1052801297 9:32970581-32970603 CTCTGGGCATGAAGAGGGAACGG + Intergenic
1053015323 9:34658617-34658639 ACTTGAGCAGGAAGTGGGGCTGG - Exonic
1053380328 9:37644213-37644235 CTATTTGCAGGAAGTGGGCAGGG + Intronic
1053781973 9:41619147-41619169 CTCTGCTAAGGAAGTGGGGAAGG - Intergenic
1054169924 9:61829301-61829323 CTCTGCTAAGGAAGTGGGGAAGG - Intergenic
1054457138 9:65438876-65438898 CATTGGGCAGAGAGTGGGGATGG - Intergenic
1054667614 9:67751514-67751536 CTCTGCTAAGGAAGTGGGGAAGG + Intergenic
1054853757 9:69875655-69875677 CTTTGAGTAGGAAGAGGGTAGGG + Intronic
1055498016 9:76875155-76875177 CTCTGGGCAGACAATGGGGAAGG - Intronic
1055604185 9:77950592-77950614 CTCTAGGGAGGAAATGGGGAAGG + Intronic
1056455212 9:86752957-86752979 CAATGGGCAGGAAGTGGAAATGG + Intergenic
1056599699 9:88036975-88036997 CTCTGGGCAGGGGCTGGGGAAGG + Intergenic
1057711288 9:97447698-97447720 CCTTGGGCAGGAGTTGGGGCAGG - Intronic
1057810266 9:98251977-98251999 CTGGGTGCAGGAAGAGGGGAAGG + Intronic
1058750713 9:108035911-108035933 CCCTGGGCAGGAGGTGGGGGAGG + Intergenic
1058782979 9:108357296-108357318 TTTTGGGAAGGCAGTGAGGATGG - Intergenic
1058946013 9:109857060-109857082 CTCAGGGCAGGAAGCGGGGGTGG - Intronic
1059074906 9:111182367-111182389 CTTCGTGGGGGAAGTGGGGATGG + Intergenic
1059228258 9:112693298-112693320 CTTTAGGCAGAAAGTGGGGAGGG - Intronic
1059337736 9:113579833-113579855 ATGTGGGCAGGATGTGTGGATGG - Intronic
1059441694 9:114310993-114311015 CTTTGGGCAGGAAGCTGGGGAGG - Exonic
1059548298 9:115201354-115201376 GTTTGGTCAGGCAGTGGGGTAGG + Intronic
1060082246 9:120660547-120660569 TGGTGGGGAGGAAGTGGGGATGG - Intronic
1060872065 9:127050623-127050645 CCGGGGGCAGGAGGTGGGGATGG - Intronic
1060903226 9:127280320-127280342 CACTGGGCAAGAAGTAGGGAGGG - Intronic
1061088269 9:128411889-128411911 CTTGGAGCCGGAGGTGGGGAGGG + Intronic
1061183504 9:129038418-129038440 CTTGGAGCTGGAAGTGGGGGAGG + Intronic
1061200663 9:129136679-129136701 CCCTGGGCAGGAAGAAGGGAAGG - Intronic
1061627172 9:131847613-131847635 CTTGGACCAGGAAGTGGGAATGG - Intergenic
1061751287 9:132778984-132779006 CATTGGCTTGGAAGTGGGGAAGG - Intronic
1061751294 9:132779021-132779043 CATTGGCTTGGAAGTGGGGAAGG - Intronic
1061837707 9:133340476-133340498 CACTGGGCAGGAAGTGTGGGGGG - Exonic
1061847298 9:133394901-133394923 CTGTGGGCAGGAAGGAGGGGAGG + Intronic
1061861596 9:133471228-133471250 TTTTTGGCAGGGGGTGGGGACGG + Exonic
1062024791 9:134335379-134335401 TGTTGGGTGGGAAGTGGGGAAGG + Intronic
1062254583 9:135614936-135614958 GTGGGGGCAGCAAGTGGGGAAGG + Intergenic
1062341790 9:136096681-136096703 CTGTGGGAAGGAGGTGGGGTAGG + Intergenic
1062532148 9:137006730-137006752 CTGTGGGCAGGAGATGGGGGAGG - Intergenic
1062601422 9:137320217-137320239 CTGGGGGCAGGACGTGGGGAAGG - Intronic
1186249128 X:7647015-7647037 CTTGGGGCCTGAAGTGGGGTGGG + Intergenic
1186688952 X:11954568-11954590 CTTTAGGTAGGAAGTAAGGAGGG + Intergenic
1187786653 X:22895975-22895997 CTTTGGGCAGGAAGGGGTGGTGG + Intergenic
1188265878 X:28073755-28073777 GGGTGGGGAGGAAGTGGGGATGG - Intergenic
1188633743 X:32401580-32401602 GGTTGGGGAGGAAGTGGGGATGG + Intronic
1189935624 X:46065661-46065683 GGTTGAGCTGGAAGTGGGGATGG - Intergenic
1190790682 X:53697172-53697194 CTGTGGGGAGGAGGTGCGGAGGG - Intergenic
1191735896 X:64387551-64387573 CTTTGAGTAGAAAGAGGGGAGGG - Intronic
1192145684 X:68680720-68680742 CTAAGGCCAGGAAGTGGGGGTGG + Intronic
1192240669 X:69325151-69325173 CTTAGGGCTGGGAGTGGGGTGGG - Intergenic
1192340571 X:70260095-70260117 CTGTAGGCAGGCAGTGGGGAAGG - Intergenic
1192896385 X:75447013-75447035 CATTGGGCAGTAACTGGGGTGGG - Intronic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1193137152 X:77984674-77984696 CTTTGGGCAGGAAGTCAAAATGG - Intronic
1193567882 X:83101114-83101136 TTTAAGGCTGGAAGTGGGGAAGG + Intergenic
1193835957 X:86343924-86343946 GGCTGGGGAGGAAGTGGGGATGG + Intronic
1194899777 X:99496525-99496547 TTTTGGGCAGGAGGTTTGGAAGG + Intergenic
1195250760 X:103044349-103044371 GTTTGGGAAGGAAGTGGGGATGG - Intergenic
1195284261 X:103367860-103367882 CTCTGAGCTGGAAGTGGGGAGGG + Intergenic
1195386561 X:104318991-104319013 CTTTTGGGAGACAGTGGGGAGGG + Intergenic
1195751729 X:108166110-108166132 CTTTGGCCAAAAAGGGGGGAGGG - Intronic
1195900523 X:109792891-109792913 CTTGGGGGAGAAAGTGGGGAAGG - Intergenic
1196532913 X:116810510-116810532 CTGTGGCCAGGAGGTAGGGAAGG - Intergenic
1196777782 X:119356172-119356194 TTTTGGGCAGGCAGTGAGGTAGG - Intergenic
1197032437 X:121833593-121833615 GGTTGGGAGGGAAGTGGGGATGG + Intergenic
1197508281 X:127336550-127336572 CTTTGGGAAAGAAGTCGGGGTGG - Intergenic
1198658663 X:138942558-138942580 CTTTTCCAAGGAAGTGGGGAAGG - Intronic
1198769947 X:140119687-140119709 CTTTGAGGAGGAAAGGGGGAAGG - Intergenic
1199216329 X:145263640-145263662 CTTTGGCCAGTAAGTGGGCATGG - Intergenic
1202366407 Y:24168673-24168695 CTTGGGGCAGCAAGAGGGGAGGG - Intergenic
1202504375 Y:25501450-25501472 CTTGGGGCAGCAAGAGGGGAGGG + Intergenic