ID: 1172591778

View in Genome Browser
Species Human (GRCh38)
Location 20:36122788-36122810
Sequence CAGTTTCAGCACCTGTACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3770
Summary {0: 1, 1: 1, 2: 33, 3: 480, 4: 3255}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172591771_1172591778 2 Left 1172591771 20:36122763-36122785 CCAGCCCCTTTCCCTTCTTGGAC 0: 1
1: 0
2: 3
3: 39
4: 427
Right 1172591778 20:36122788-36122810 CAGTTTCAGCACCTGTACAATGG 0: 1
1: 1
2: 33
3: 480
4: 3255
1172591773_1172591778 -3 Left 1172591773 20:36122768-36122790 CCCTTTCCCTTCTTGGACCTCAG 0: 1
1: 1
2: 4
3: 43
4: 475
Right 1172591778 20:36122788-36122810 CAGTTTCAGCACCTGTACAATGG 0: 1
1: 1
2: 33
3: 480
4: 3255
1172591774_1172591778 -4 Left 1172591774 20:36122769-36122791 CCTTTCCCTTCTTGGACCTCAGT 0: 1
1: 3
2: 10
3: 70
4: 582
Right 1172591778 20:36122788-36122810 CAGTTTCAGCACCTGTACAATGG 0: 1
1: 1
2: 33
3: 480
4: 3255
1172591768_1172591778 9 Left 1172591768 20:36122756-36122778 CCCTTGGCCAGCCCCTTTCCCTT 0: 1
1: 0
2: 5
3: 47
4: 519
Right 1172591778 20:36122788-36122810 CAGTTTCAGCACCTGTACAATGG 0: 1
1: 1
2: 33
3: 480
4: 3255
1172591775_1172591778 -9 Left 1172591775 20:36122774-36122796 CCCTTCTTGGACCTCAGTTTCAG 0: 1
1: 0
2: 4
3: 35
4: 349
Right 1172591778 20:36122788-36122810 CAGTTTCAGCACCTGTACAATGG 0: 1
1: 1
2: 33
3: 480
4: 3255
1172591772_1172591778 -2 Left 1172591772 20:36122767-36122789 CCCCTTTCCCTTCTTGGACCTCA 0: 1
1: 0
2: 3
3: 55
4: 842
Right 1172591778 20:36122788-36122810 CAGTTTCAGCACCTGTACAATGG 0: 1
1: 1
2: 33
3: 480
4: 3255
1172591776_1172591778 -10 Left 1172591776 20:36122775-36122797 CCTTCTTGGACCTCAGTTTCAGC 0: 1
1: 0
2: 8
3: 66
4: 436
Right 1172591778 20:36122788-36122810 CAGTTTCAGCACCTGTACAATGG 0: 1
1: 1
2: 33
3: 480
4: 3255
1172591769_1172591778 8 Left 1172591769 20:36122757-36122779 CCTTGGCCAGCCCCTTTCCCTTC 0: 1
1: 1
2: 7
3: 124
4: 899
Right 1172591778 20:36122788-36122810 CAGTTTCAGCACCTGTACAATGG 0: 1
1: 1
2: 33
3: 480
4: 3255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172591778 Original CRISPR CAGTTTCAGCACCTGTACAA TGG Intronic
Too many off-targets to display for this crispr