ID: 1172592262

View in Genome Browser
Species Human (GRCh38)
Location 20:36126185-36126207
Sequence GGATGAGGAAGGCCTCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 1, 2: 2, 3: 36, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172592262 Original CRISPR GGATGAGGAAGGCCTCCTGT GGG Intronic
900313560 1:2046360-2046382 TGATGAGGGAGGCCTCCTCCTGG + Intergenic
901762035 1:11478083-11478105 GGATGGGGAGGGGCTGCTGTGGG + Intergenic
902559162 1:17266308-17266330 GGGTGAGGAAGGCTTCCTGGAGG + Intronic
902723523 1:18320541-18320563 GGTTGGGAAAGGCCTCCTGTGGG + Intronic
902759724 1:18573284-18573306 GGAAGAGGAGGGCTTCCTCTAGG - Intergenic
902794473 1:18792223-18792245 GGCTAAGGAAGGCTTCCTGGAGG + Intergenic
903012605 1:20342347-20342369 GGAGGAGGAAGAGCTCCTGGTGG - Intronic
904047494 1:27617214-27617236 GAATGAGAAAGGCCCCCTGGGGG + Exonic
904379548 1:30101699-30101721 GGATGAGGACGGCCTCCTGTGGG - Intergenic
904660935 1:32084283-32084305 GGAGGAGGAAGGGCTCCAGGAGG - Intronic
905620660 1:39443524-39443546 GTTTCAGGAAGTCCTCCTGTGGG - Exonic
905953710 1:41974678-41974700 GGTTCAGGAAGGCTTCCTGGAGG - Intronic
906731134 1:48082126-48082148 GGATAAAGAAGACCTACTGTGGG + Intergenic
907474561 1:54697200-54697222 GGTTAAGGAAGGCTTCCTGGAGG + Intronic
909623460 1:77690222-77690244 GGAGTAGTAATGCCTCCTGTGGG - Intergenic
912608256 1:111015400-111015422 GGATGAGGTTGGCCACCTGCTGG + Intergenic
912803901 1:112740997-112741019 GTATGAGGAAGGCATCCTAAGGG + Intergenic
914950627 1:152110642-152110664 GGAGGAGGACGGCCTCCAGGAGG - Exonic
915286603 1:154857336-154857358 GGCTGAGGAAAGTCTCCTGTGGG - Intronic
915567907 1:156726756-156726778 TGTTGAAGAAGGCCCCCTGTCGG - Intronic
915601375 1:156924839-156924861 GGATGAGGAAGGGCACCGCTGGG + Intronic
916058099 1:161081784-161081806 GGAGGAGGGAGGACTCCTGCTGG - Intronic
916853628 1:168727929-168727951 GGAGGAGGAAGCCCACCTGGAGG - Intronic
919906355 1:202081140-202081162 GCATGAGGAAGGACCCCTCTGGG - Intergenic
920690607 1:208143670-208143692 GGATGGGGAAGGCTTCATGGAGG - Intronic
921169390 1:212533065-212533087 GCATGAGGACTGCCTTCTGTGGG - Intergenic
921317492 1:213905802-213905824 GGATGAGAAATGCCACATGTTGG + Intergenic
923545852 1:234922874-234922896 GGCTGAGGAGAGCCTCCAGTGGG - Intergenic
924386029 1:243498454-243498476 GGAGGAGTGAGGCCTCCTGCCGG + Intronic
1063165169 10:3455226-3455248 GGCTAAGGCAGGCCTCATGTTGG + Intergenic
1064408220 10:15083279-15083301 GGATGGGAAAGGCCTCCTGCAGG - Intronic
1067208851 10:44242092-44242114 GGATGAGGAAGACTTGCTTTGGG - Intergenic
1067576376 10:47411171-47411193 GGGTGTGGGAGTCCTCCTGTGGG + Intergenic
1069822633 10:71236985-71237007 GGATGTGGAAGGCTTCCTGGAGG + Intronic
1071345687 10:84689999-84690021 TGATGAGGAAGACCTCCTGTCGG + Intergenic
1072715319 10:97748275-97748297 GGCTCAGGAAGGCCTCCAGCTGG - Exonic
1073352629 10:102830863-102830885 TGATGAGGAAGAGCTCCTGGCGG + Exonic
1074103967 10:110375184-110375206 GGATGAGGAAGGGCGACTGCAGG + Intergenic
1075001873 10:118804750-118804772 GGACCAGGAAGGCTTCCTGGAGG + Intergenic
1075700165 10:124464160-124464182 GGCTTTGTAAGGCCTCCTGTTGG + Intronic
1076063863 10:127433335-127433357 GGATGAGGAAGGCATCGTGAAGG - Exonic
1076463735 10:130664336-130664358 AGATGAGCCAGGCCTCCTGCTGG + Intergenic
1077385104 11:2265712-2265734 GGATGAGGAAGGGACCCTGCTGG - Intergenic
1079096917 11:17517034-17517056 GGATGCTGAAAGCCTCCTGCTGG + Intronic
1080579536 11:33631031-33631053 GGAAGAGGAAGTGCTCCTGAGGG + Intronic
1080626526 11:34035387-34035409 GGATGAGGCGGGCCTGCGGTGGG - Intergenic
1080636132 11:34125251-34125273 GGAGGAGGAAAGGCTGCTGTTGG + Intronic
1081403069 11:42665277-42665299 GGTTGAGGAATGAGTCCTGTAGG - Intergenic
1081805566 11:45888126-45888148 GGCTGAGGAGAGCCGCCTGTAGG + Intronic
1082926032 11:58548413-58548435 GGAGGAGGAAAGTCTCCTGGAGG + Intronic
1083587477 11:63870752-63870774 GGATCAGGAAAGCTTCCTGGTGG + Intronic
1083812745 11:65114906-65114928 TGGTGAGGACGGCCTCCTGCAGG - Exonic
1083902764 11:65651609-65651631 GGATCAGGAAGGCTTCATGGAGG + Intergenic
1084013270 11:66364292-66364314 TGATGAAGTAGGCATCCTGTGGG + Exonic
1084234108 11:67775269-67775291 AGATGAGGAAGGCTTCCAGGTGG + Intergenic
1084267159 11:68010920-68010942 GGATGAGAAGTGCCTCCTGCAGG - Intronic
1084471321 11:69360812-69360834 GGCTGGGGCAGGCATCCTGTGGG + Intronic
1084672646 11:70616347-70616369 GGCTGGGGAGGGCCTCCTCTTGG - Intronic
1085642980 11:78204870-78204892 GGGTGAGCAAGACCTTCTGTGGG + Intronic
1086370686 11:86152619-86152641 GGGTCAGGAAGGCTTCCTGTAGG - Intergenic
1088749150 11:112829181-112829203 GGATGGTGAAGGCTTCCTGGAGG - Intergenic
1088938350 11:114426834-114426856 GGATGTGGGAGGCATGCTGTTGG + Intronic
1089625099 11:119746088-119746110 GGATGAGCAAGGCCTACAGTAGG - Intergenic
1090865725 11:130698893-130698915 GGTCCAGGAAGGCCTCCTGGAGG + Intronic
1090922902 11:131222426-131222448 GGATGAGGAGGGCCTGCCCTGGG - Intergenic
1091595197 12:1873755-1873777 GGCTGAGAAAGGCCTCCTGCAGG - Intronic
1092203194 12:6599991-6600013 GGAGAAGGAAGGCATCCAGTGGG - Exonic
1094525683 12:31229236-31229258 GGATGAGGATGGGCTGCTTTAGG - Intergenic
1097224270 12:57467849-57467871 GGAGGATGGAGGCCTCCGGTGGG - Intronic
1097981782 12:65742656-65742678 GGATAAGGATGGACTCCTTTCGG + Intergenic
1100346307 12:93734894-93734916 GGATGAGGAAGGCCTCCCCTAGG - Intronic
1103635723 12:122303632-122303654 GGCTGAGGATGTTCTCCTGTGGG - Intronic
1103956098 12:124577733-124577755 GGCTGGGGAAGGCCTCTTGGGGG + Intergenic
1104004354 12:124881657-124881679 GGTTGAGGAAGGCCTCTTTGAGG - Intronic
1105279364 13:18954303-18954325 GACTCAGGAGGGCCTCCTGTAGG - Intergenic
1106591912 13:31105369-31105391 TGATGAGAAAGGGCTCCTGGAGG - Intergenic
1106628842 13:31448398-31448420 GGATGACCAAGGCTTCCTATAGG + Intergenic
1106906986 13:34419693-34419715 GGATGAGGAAAGCCTCCCAGGGG + Intergenic
1113752417 13:112785444-112785466 GCAGGTGGAAAGCCTCCTGTGGG - Intronic
1113886673 13:113664631-113664653 TGAGGAGGATGGCTTCCTGTTGG - Intergenic
1117362903 14:54995660-54995682 GGATGATGAAGACCTCATGATGG - Exonic
1117790102 14:59331356-59331378 GGAGGAGGAGGGCCACCTGGAGG - Exonic
1118773945 14:68961858-68961880 GGATGAGGAATGCTTCCCGTGGG - Intronic
1118875731 14:69783427-69783449 GGTTAAGGAAGGCTTCCTGGGGG + Intronic
1120397939 14:83992194-83992216 GGATGAGGGAGCCCTTATGTTGG - Intergenic
1121629127 14:95409822-95409844 GGGTGATGAGGGCCACCTGTGGG + Intronic
1121813340 14:96910782-96910804 GGACAAGGAAGGCTTCCTGGAGG + Intronic
1121813354 14:96910853-96910875 GGACAAGGAAGGCTTCCTGGAGG + Intronic
1121940611 14:98067223-98067245 GATTGAGGAAGGCTTCCTGAAGG + Intergenic
1122826371 14:104372770-104372792 GGAGGAGGAAGCTCTCCCGTGGG - Intergenic
1123999213 15:25740820-25740842 GGATGAGGATTGCATTCTGTAGG - Intronic
1124156807 15:27233157-27233179 GGGTGGGGAAGGCCTCCTGGAGG + Intronic
1125506676 15:40271451-40271473 GGAAGTGGAAGGACTCCTTTAGG + Intronic
1125723238 15:41855161-41855183 GGCTGAGGAAGGCCTGCCCTGGG - Intronic
1128367640 15:67015702-67015724 GGAGGAGAAAGGCCTCCTTGAGG + Intergenic
1128578248 15:68790754-68790776 AGATGAGGAGGGGCCCCTGTTGG + Intronic
1129250203 15:74304600-74304622 GGCTGAGCAAGGCCCCCTGCAGG + Intronic
1130918432 15:88324188-88324210 GGAGGAGAAAGTCCTCCTGCCGG + Intergenic
1131122068 15:89828900-89828922 GGAAGAGGAAGGGATCCTGGCGG + Intergenic
1133145935 16:3786669-3786691 GTATGGGGAAGGCCAGCTGTAGG + Intronic
1134005980 16:10819002-10819024 GGATGTGGAAGGCCTGGAGTGGG + Intergenic
1134006019 16:10819137-10819159 GGATGTGGAAGGCCTGGAGTGGG - Intergenic
1136367339 16:29814815-29814837 GGATGAGGCAGGCCTACAGTTGG - Intronic
1136467705 16:30456360-30456382 TGATTACGAAGGCCTCCTGCTGG - Intergenic
1136549236 16:30973745-30973767 GGGTGAGGAGGTCTTCCTGTGGG - Intronic
1137031970 16:35532354-35532376 TGGTGAGGATGGCCTCCTGGAGG + Intergenic
1138163906 16:54781773-54781795 GGATCAGGAAGACTTCCTGGAGG - Intergenic
1138400962 16:56743719-56743741 GGATGAGGAAGGCTTCAAGGGGG - Intronic
1138551390 16:57750754-57750776 GGCAGAGGAAGGGCTGCTGTGGG - Intronic
1139282956 16:65785492-65785514 GCCTGAGGAAGGGATCCTGTGGG + Intergenic
1139380160 16:66525496-66525518 GGATGAGGAAGCAGTGCTGTGGG + Intronic
1141136642 16:81469887-81469909 GGATGAGGAGGGCCTTCTTTGGG + Intronic
1141199116 16:81883546-81883568 GGATGAGAAGAGCCTCATGTCGG + Intronic
1141575217 16:84959172-84959194 GGAGGAGGAATTCCTCCTGCTGG + Intergenic
1142508410 17:380428-380450 GGATGAGGAGGGCTTCCGGGAGG - Intronic
1142508450 17:380538-380560 GGATGAGGAGGGCTTCCGGGAGG - Intronic
1142508476 17:380604-380626 GGATGAGGAGGGCTTCCGGGAGG - Intronic
1142508484 17:380626-380648 GGATGAGGACGGCTTCCGGGAGG - Intronic
1142508501 17:380670-380692 GGATGAGGAGGGCTTCCGGGAGG - Intronic
1142508536 17:380777-380799 GGATGAGGACGGCTTCCGGGAGG - Intronic
1142508562 17:380844-380866 GGATGAGGAGGGCTTCCGGGAGG - Intronic
1142508580 17:380888-380910 GGATGAGGAGGGCTTCCGGGAGG - Intronic
1142508648 17:381086-381108 GGATGAGGACGGCTTCCGGGAGG - Intronic
1142508655 17:381108-381130 GGATGAGGAGGGCTTCCGGGAGG - Intronic
1142508735 17:381310-381332 GGATGAGGAGGGCTTCCGGGAGG - Intronic
1142508788 17:381447-381469 GGATGAGGAGGGCTTCCGGGAGG - Intronic
1143200653 17:5111173-5111195 GGGTGAGGGAGGCCACCTGGGGG + Intronic
1144778802 17:17797816-17797838 AGAGGAGGAAGGCTTCCTGTGGG - Exonic
1145778447 17:27545700-27545722 GCTTGAGGAAGGCTTCCTGGAGG + Intronic
1145812156 17:27770960-27770982 GGAGGAGGAACGGCTGCTGTTGG - Exonic
1146572259 17:33962885-33962907 TGTTGAGGAAGGCTTCCTGTAGG - Intronic
1147917543 17:43897755-43897777 GGGTGAGGAGGGCTTCCTGGAGG - Intronic
1150454011 17:65292674-65292696 TGATGATGATGGCCTCCTGAAGG - Intergenic
1151654497 17:75489569-75489591 TGATGAGGAAGCCGGCCTGTTGG - Exonic
1152369594 17:79878106-79878128 GGATGGGGAAGGTCTCCTGATGG + Intergenic
1152461237 17:80443611-80443633 GGAGGAGGGAGGCATCCTGGAGG + Intergenic
1153927787 18:9849689-9849711 GGGTGAGGAAGGCCTCCCCGGGG + Intronic
1156458828 18:37309925-37309947 GGATAAGGAAGGCTTCCTGGGGG - Intronic
1156486898 18:37472105-37472127 GTATGATGTAGGCCTCATGTGGG + Intronic
1157212954 18:45759605-45759627 AGATGAGGATGGCTTCCTGGAGG + Intergenic
1157219744 18:45819945-45819967 GGATGATGATGGCCTCCTTATGG - Intergenic
1157581297 18:48775711-48775733 GGTTGAGGAAGGCTTCCTGGAGG + Intronic
1157681925 18:49614051-49614073 AGCTGAGGAAGGCTTCCTGGAGG + Intergenic
1159929869 18:74299418-74299440 GGATAAGGGGGGCCTACTGTGGG - Intergenic
1160921152 19:1521467-1521489 GGATGGGGAGGGACTGCTGTTGG - Intergenic
1161067994 19:2247914-2247936 GGCAGAGGCAGGCCTCCTGGCGG - Exonic
1161433818 19:4250072-4250094 GGATGATGGAGGCCTCCCGGAGG - Intronic
1161660117 19:5540620-5540642 GGATGAGGGAAGCATCCTTTAGG + Intergenic
1161879404 19:6937363-6937385 GGAAGATGAAGGCCCCCTGCAGG - Exonic
1163302761 19:16458092-16458114 GGATGGGTCTGGCCTCCTGTCGG + Intronic
1163784481 19:19267754-19267776 GGGTGGGGGAGGCTTCCTGTGGG - Intronic
1164081001 19:21861298-21861320 GGAGCAGGAGGGTCTCCTGTTGG - Intergenic
1164708485 19:30337618-30337640 AGATAAGGAAGGCCTCATCTAGG - Intronic
1165060881 19:33204713-33204735 AGAGGCGGAAGGCCTCCTGGCGG - Exonic
1165461818 19:35948433-35948455 GATTGAGGAAGGCTTCCTGGAGG + Intergenic
1168320884 19:55508812-55508834 GGATGGGGGAGGCCTCCTGAGGG + Intronic
1168320927 19:55508959-55508981 GGATGGGGGAGGCCTCCTGAGGG + Intronic
1168595067 19:57668840-57668862 GGATTAGGAATGCCTTCTCTGGG + Intergenic
925809064 2:7680545-7680567 AGATGAGGAAAATCTCCTGTAGG - Intergenic
928316320 2:30249518-30249540 AGAAGAGGAAGGCCTCTGGTTGG + Intronic
929831226 2:45348188-45348210 TGATGAAGAAGGCCGCCTGCAGG - Intergenic
930665105 2:54094127-54094149 GGATGAAAAAGGCCTCATGAAGG + Intronic
932193536 2:69762723-69762745 GGATGAGGAGGGCCAGCTATGGG + Intronic
932413711 2:71561551-71561573 GGGTGAGGAAGGCTTCCTGGAGG + Intronic
933971573 2:87474030-87474052 GGAGCAGGCAGGCCTCCTGCTGG - Intergenic
936322157 2:111476169-111476191 GGAGCAGGCAGGCCTCCTGCTGG + Intergenic
937017404 2:118618687-118618709 GGATGAGAAATGGCCCCTGTAGG + Intergenic
938817501 2:134918965-134918987 GGATGAGGTTGGCCGCCTGCTGG - Exonic
939833396 2:147099531-147099553 GGATGATTAAGGCTTCTTGTTGG - Intergenic
942136388 2:172930297-172930319 GGGTGAGGAAGGTGTCTTGTTGG - Intronic
946486298 2:220103653-220103675 GGATGAGGTTGGGCTCCTATCGG + Intergenic
948831222 2:240599192-240599214 GGATGAGGATGGCCTCTGGAGGG + Intronic
1170311393 20:14996620-14996642 GGATGAGGAAGGGGTGGTGTTGG - Intronic
1170566715 20:17611871-17611893 GGGTGAGGGAGGCCGCCTGCAGG - Intergenic
1170770723 20:19330212-19330234 GGCTGAGGAGGGCCTCCAATCGG + Intronic
1171345396 20:24462037-24462059 GGGAGAGGAAGGGCTCCTGGGGG - Intergenic
1171364069 20:24611640-24611662 GGCTGAGGAGGGGCTCCTGGAGG - Intronic
1172592262 20:36126185-36126207 GGATGAGGAAGGCCTCCTGTGGG + Intronic
1172846074 20:37930676-37930698 GGATGGGGCAGGGCTCCTGCTGG + Intronic
1173191664 20:40881537-40881559 GTATGAGGAAAGCCTCTTGGGGG - Intergenic
1175304770 20:57968434-57968456 GGACGAGGAAGGTCACCTGGAGG + Intergenic
1175567385 20:59991202-59991224 GAATTAGGAAAGGCTCCTGTTGG - Intronic
1178420272 21:32437694-32437716 AGATGAGGAAGGCTTCCAGGTGG - Intronic
1179978039 21:44881751-44881773 GTATGTGGGAGGACTCCTGTGGG + Intergenic
1181032270 22:20154372-20154394 GGCTAAGGAAGGCCTCTTGGAGG + Intergenic
1181308507 22:21930805-21930827 GGGTGAGGAAGGCCTCAGGGAGG - Intronic
1181511195 22:23389356-23389378 GGCTAAGGAAGGCCTCTTGGAGG - Intergenic
1182142037 22:27967777-27967799 GGGTGAGGAGGGCATCCTTTGGG - Intergenic
1183293264 22:37015734-37015756 GGATCAGGGAGGCACCCTGTAGG - Intronic
1183385170 22:37510095-37510117 GGATCAGGAAGGCCTGCAGCAGG - Intronic
1183494573 22:38135273-38135295 GCATCAGGAAGGCTTCCTGGAGG - Intronic
1183751832 22:39725305-39725327 GGAAGATGTAGGCCTGCTGTAGG - Intergenic
1184607091 22:45580407-45580429 GGATCAGGAGGGCTTCCTGGAGG + Intronic
1184648012 22:45906592-45906614 GGAGGAAGATGCCCTCCTGTGGG + Intergenic
1185409729 22:50675188-50675210 GGATGAGGAGCGGCTCCTGCAGG + Intergenic
949300826 3:2581999-2582021 GGATAAGGAACGACTGCTGTTGG + Intronic
949928166 3:9058235-9058257 GGATGAGGTAGGCTTCCTCCTGG - Exonic
950577525 3:13841709-13841731 TGCTGTAGAAGGCCTCCTGTGGG - Intronic
950653804 3:14424314-14424336 GGATGGGGAGGGCCTCTTGAAGG + Intronic
950661853 3:14471686-14471708 TGAAGAGACAGGCCTCCTGTTGG + Intronic
950672800 3:14537292-14537314 GGATGGGGAAGGCCTCCCTGAGG - Intronic
953023281 3:39129642-39129664 GGATGAGGAAGGCACCTTGGAGG - Intronic
955159619 3:56451399-56451421 GGATGAGGAATGGCTCCAATGGG + Intronic
956226304 3:66962939-66962961 GGAAGAGGATTGCCTCCTGGAGG - Intergenic
957233164 3:77547359-77547381 TGATGAGGAAGACCACCAGTAGG - Intronic
958000903 3:87747777-87747799 AGATGAGGAAGGCCTCTTGCGGG + Intergenic
958993326 3:100873039-100873061 GGAAGAGGAAGGCCTTAAGTTGG - Intronic
960610946 3:119554357-119554379 AGAGGGGAAAGGCCTCCTGTAGG - Intronic
961883734 3:130081812-130081834 AGATGAGGAAGGCTTCCAGGTGG + Exonic
963261830 3:143200425-143200447 GGAGGAGGTGGGCCTCATGTAGG + Intergenic
966222168 3:177561537-177561559 GGGTGAAGAAAGCCCCCTGTTGG + Intergenic
967160935 3:186737479-186737501 GGATGAGGAAGGCCTTTCTTAGG - Intronic
968265355 3:197358635-197358657 GGATCAAGAAGGATTCCTGTTGG + Intergenic
969606116 4:8203068-8203090 GGATGAGGAAACCCTCATGGGGG - Intronic
969619824 4:8273399-8273421 TGATGAGGGCAGCCTCCTGTGGG + Intronic
971804839 4:31342556-31342578 CCTTGAGGAAGCCCTCCTGTTGG + Intergenic
972675292 4:41254822-41254844 GGATCAGGAAGGCGTCCTGAAGG - Intergenic
972704325 4:41526887-41526909 AGATGAGGATGGCCTGCTCTGGG - Intronic
974683320 4:65193594-65193616 GGATAAGGGAGGACTACTGTAGG - Intergenic
978419522 4:108515435-108515457 GGATGAGGTTGGCCTTCTGAAGG + Intergenic
985519667 5:367659-367681 GGCTGGGGAAGGCCTCCTGAGGG - Intronic
985536291 5:467485-467507 GGATCAGGAAGGCACCCTCTAGG - Intronic
985655407 5:1129189-1129211 GGCTGAGGGAGGCCTCTTGGAGG - Intergenic
990694478 5:58400569-58400591 GGAGGAAGAAGCCCTCCTCTTGG - Intergenic
990694564 5:58401580-58401602 GGAGGAAGAAGCCCTCCTCTTGG - Intergenic
992206632 5:74436660-74436682 GGATGTGGAAGGCCTCTTCAAGG + Intergenic
994051978 5:95372681-95372703 TGATGAGGAAGATCTCCTGAGGG + Intergenic
996382635 5:122877679-122877701 GGATGGGATAGGCTTCCTGTAGG - Intronic
996885148 5:128345298-128345320 GAATGTGGAAGGCTTCCTGTTGG + Intronic
997977447 5:138448635-138448657 GGAGGAGGAAAGCCTAGTGTAGG - Intergenic
998012093 5:138703566-138703588 CAATGACGAAGTCCTCCTGTAGG + Intronic
998753040 5:145345531-145345553 TGATGAGAAAGGCTTGCTGTGGG - Intergenic
999107778 5:149088916-149088938 GCAAGAGGAAGGCCTGGTGTGGG - Intergenic
1000026404 5:157362801-157362823 GGTTGAGGAAGGACTTCTCTGGG + Intronic
1000152959 5:158521091-158521113 GGTTCAGGAAGGACTCCTGTAGG - Intergenic
1001515519 5:172352937-172352959 GGGTCAGGAAGGCTTCCTGAGGG - Intronic
1002206070 5:177563488-177563510 GGAGGAGGAAAGCCAGCTGTGGG - Intergenic
1002883508 6:1273791-1273813 GGATGTCTCAGGCCTCCTGTGGG + Intergenic
1004536628 6:16509408-16509430 GGACAAGGAAGGCCTCTTGGAGG + Intronic
1004947351 6:20630270-20630292 GGATGAGGAAGGCCTCTGTATGG - Intronic
1005956374 6:30666160-30666182 GGCTGAAGATTGCCTCCTGTTGG - Intronic
1006386397 6:33733431-33733453 GGATGAGGACAGCCTCCTGAAGG + Intronic
1006423455 6:33949603-33949625 TGATGAGTAAACCCTCCTGTCGG + Intergenic
1006807911 6:36800414-36800436 GAATCAGGAAGGCTTCCTGGAGG - Intronic
1006940560 6:37749247-37749269 GGGTGGGGAAGGCTTCCTGGGGG - Intergenic
1007078434 6:39082558-39082580 GGACCAGGACTGCCTCCTGTGGG - Intronic
1007472252 6:42098634-42098656 GGCTGGGGAAGGCTTCCTGTAGG + Intergenic
1011481102 6:87795000-87795022 AGCTGAGGAAGGCATCCTGAAGG + Intergenic
1012601697 6:101106293-101106315 GGCTAGGGAAGGCCTCCTGGAGG + Intergenic
1013034019 6:106362461-106362483 GGATCAGGGAGGCTTCCTGGAGG + Intergenic
1013100351 6:106981251-106981273 GGGGGAGGAAAGCCTCCGGTGGG + Intergenic
1016023429 6:139259541-139259563 TGACCAGGAAGGCCTCCTGGAGG - Intronic
1016552385 6:145296299-145296321 GGGGAAGGAAGTCCTCCTGTTGG + Intergenic
1017890132 6:158631087-158631109 GGCTGAGGGAGGCGGCCTGTGGG - Intronic
1018155019 6:160977647-160977669 GGGTGAGGGAGGCCACCTGGGGG + Intergenic
1018579814 6:165298685-165298707 GAATGAGCAAAGCCTCCAGTGGG - Intronic
1020317714 7:6918348-6918370 AGATGAGGAAGGCTTCCAGGTGG + Intergenic
1024587197 7:50852103-50852125 GGCTGAGGGAAGCCTCCTGCAGG + Intergenic
1024751226 7:52467664-52467686 GGATGAGGAAGTCCTGCAGAGGG - Intergenic
1025620523 7:63166102-63166124 AGATGAGGAAGGCCTACCATGGG + Intergenic
1026652334 7:72226400-72226422 GGAAGAGCAAGGACTCCTATGGG - Intronic
1029352406 7:100023599-100023621 AGATGAGGAAGACCACATGTGGG + Exonic
1029494159 7:100888280-100888302 GGGTATGGAGGGCCTCCTGTGGG - Exonic
1030600119 7:111583267-111583289 TAATCAGGTAGGCCTCCTGTTGG + Intergenic
1030971265 7:116059818-116059840 GGTTGAGAAAGTTCTCCTGTAGG - Intronic
1030992220 7:116314355-116314377 GGATGAGGAAAGCCTTCTGAAGG + Intronic
1032478093 7:132225973-132225995 GAGTGAGGGAGGCCTCCTCTGGG + Intronic
1032668601 7:134063275-134063297 GACTGAGGAAGACTTCCTGTGGG - Intronic
1034402585 7:150874770-150874792 GCCTGAGGAAGGAATCCTGTAGG + Intergenic
1034750739 7:153566693-153566715 GCAAGAGGAAGGCCTCCAGGAGG + Intergenic
1034859336 7:154582525-154582547 GGAGGAGGAAGGGACCCTGTGGG - Intronic
1035219514 7:157397524-157397546 TGAGGAGGAAAGTCTCCTGTTGG - Intronic
1035376660 7:158411105-158411127 GGAAGAGCGAGGCCTCCTCTCGG - Intronic
1035820391 8:2585080-2585102 TGATGAGCAATGTCTCCTGTGGG - Intergenic
1036204474 8:6794885-6794907 GGACAAGGAAGGCTTCCTGGTGG - Intergenic
1038436686 8:27541353-27541375 GGAAGAGCAAAGCCTCCTGCAGG - Intronic
1038679801 8:29656235-29656257 GGATGAGCAATGCCTGCTCTGGG + Intergenic
1038844559 8:31216694-31216716 GGAAGAGGAATGCCGCCTTTTGG + Intergenic
1039443550 8:37612356-37612378 GAAGGAGGAAGGCTTCCTGGAGG + Intergenic
1039676916 8:39678326-39678348 GGATGAAGAAGGTATCCAGTTGG + Intronic
1041922678 8:63200247-63200269 TGATGAAGCAAGCCTCCTGTGGG - Intronic
1043471687 8:80569303-80569325 GGAGGAGGCTGGCCTCCTGGTGG + Intergenic
1043934753 8:86130639-86130661 GGAGGAGGAAGGTGTCCTGGAGG + Intronic
1044598641 8:93982032-93982054 GGACGTGGAAGTCCTCCTTTGGG - Intergenic
1045504589 8:102769423-102769445 GCAGAAGGAAGTCCTCCTGTGGG + Intergenic
1047035340 8:120932201-120932223 GTACTAGGAAGGCCTCCTGCAGG - Intergenic
1048046828 8:130780728-130780750 GGATGAGATAGGTCTCCTCTGGG + Exonic
1048269058 8:133013607-133013629 TGATGAGACAGGCCTCATGTTGG - Exonic
1049139460 8:140939487-140939509 GGTTGATGAAGGCTACCTGTTGG - Intronic
1049335267 8:142081099-142081121 GGATGAGGAGGGCCGCGTGGTGG - Intergenic
1049587871 8:143440348-143440370 GGATGCTGAAGGCTTCCTGCAGG + Exonic
1049708778 8:144054525-144054547 GGGTGGGGCAGGCCTTCTGTAGG - Intronic
1049773684 8:144395141-144395163 GGATGGAGAAGGCCTCCTGCTGG + Exonic
1053284053 9:36839183-36839205 GACAGAGGAAGGCCTCCTGAGGG - Exonic
1053302336 9:36960942-36960964 GAAAGAGGAAGGCTTCCTGGAGG - Intronic
1053448998 9:38177686-38177708 GGATGAAGAAGGCTTCCAGGTGG - Intergenic
1056949948 9:91033955-91033977 GGATCAGCAGCGCCTCCTGTTGG - Intergenic
1057185415 9:93054941-93054963 GGTTGAGGAAGGCTTCCTGGGGG + Intergenic
1059179606 9:112199431-112199453 GTATCAGGAAGGCTTCCTGGAGG - Intergenic
1059343907 9:113615576-113615598 GGAGCAGGAAGGCTTCCTGGAGG + Intergenic
1059725308 9:117002932-117002954 GGTTCAGGAATGCCACCTGTAGG + Intronic
1060186354 9:121566405-121566427 GGTCGGGGAAGGCCTCCTGGAGG - Intergenic
1060284163 9:122234193-122234215 GGATCAGGAAGGCTTCCTAGAGG + Intergenic
1061250694 9:129424730-129424752 GGGTGAGGAAGGTCCCCTGAGGG - Intergenic
1061882128 9:133573799-133573821 GCATGGGGAAAGCCTCCTGATGG - Intronic
1061905065 9:133692535-133692557 GGATGAGCAAGGCTTCCTGGAGG - Intronic
1188974760 X:36659908-36659930 GGATGAGGGAGGGCTGGTGTTGG - Intergenic
1190532404 X:51392945-51392967 GGGTGAGGAAGGCATCCAGAAGG - Intergenic
1191004047 X:55691325-55691347 GGATGTGAAGGGCCTCCTGAAGG + Intergenic
1192314738 X:70042851-70042873 GGAGGAGGAAAGCCACCTCTGGG - Intronic
1195928067 X:110046284-110046306 GGATAAAGAAGGCCCCCTGTTGG - Intronic
1199363671 X:146952195-146952217 GGATAAGGAAGTCCTCCTATAGG + Intergenic
1199584959 X:149405059-149405081 GGAAGAGCAACGCCTCCTGTGGG - Intergenic
1201394888 Y:13537570-13537592 GGATGAGTAAGGCATCTTGTTGG - Intergenic