ID: 1172593789

View in Genome Browser
Species Human (GRCh38)
Location 20:36135629-36135651
Sequence TCAGATATGTAGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172593789_1172593795 -3 Left 1172593789 20:36135629-36135651 CCTGCTTCCCTCTACATATCTGA 0: 1
1: 0
2: 1
3: 17
4: 205
Right 1172593795 20:36135649-36135671 TGAGGCTCTGGCCACCCTGGAGG 0: 1
1: 1
2: 3
3: 38
4: 280
1172593789_1172593794 -6 Left 1172593789 20:36135629-36135651 CCTGCTTCCCTCTACATATCTGA 0: 1
1: 0
2: 1
3: 17
4: 205
Right 1172593794 20:36135646-36135668 ATCTGAGGCTCTGGCCACCCTGG No data
1172593789_1172593801 24 Left 1172593789 20:36135629-36135651 CCTGCTTCCCTCTACATATCTGA 0: 1
1: 0
2: 1
3: 17
4: 205
Right 1172593801 20:36135676-36135698 CCACGCATAGCTCTTAGCTTAGG 0: 1
1: 0
2: 0
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172593789 Original CRISPR TCAGATATGTAGAGGGAAGC AGG (reversed) Intronic
900075109 1:808181-808203 TCAGATATGTACAGGTAGGCAGG + Intergenic
901303173 1:8214405-8214427 ACAGATATGTAAAGGGAATGTGG - Intergenic
907123820 1:52031773-52031795 TGAGATATGTGGTGAGAAGCCGG - Intronic
908714655 1:67056209-67056231 TCAATTATGTAGAGGGAAGTGGG - Intergenic
909473956 1:76061513-76061535 GCAGAACTGTAGATGGAAGCGGG - Intergenic
910163610 1:84299301-84299323 TCAGATAGGGAGAGGGGAGGCGG - Intronic
910323440 1:85976365-85976387 TCAGAGAAGTAGGGGAAAGCCGG - Intronic
915370995 1:155350364-155350386 TCAGATATGTAGATAAAGGCAGG + Intronic
916803643 1:168237807-168237829 TAAGATATGGAGAAGGATGCTGG + Intronic
920039872 1:203088633-203088655 TCAGATGAGGAGAGGGGAGCAGG + Intergenic
920656733 1:207882155-207882177 TCCGATATGTAGAGAGAAGAAGG + Intergenic
920899394 1:210091746-210091768 ATAGATATGAAGAGTGAAGCTGG + Intronic
921838214 1:219800037-219800059 TAAAATATGTAGAGGGAAAGTGG - Intronic
922270949 1:224033080-224033102 TCAGATATGTACAGGTAGGCAGG + Intergenic
923493588 1:234506023-234506045 TCAGATATTCAGAGGGGGGCAGG - Intergenic
923741220 1:236656825-236656847 TCAGAAATGTATATGGAGGCTGG + Intergenic
923872124 1:238006794-238006816 TCAAAAATGAAGAGAGAAGCTGG - Intergenic
923920580 1:238559994-238560016 TCAGAATTGTAGAGGTGAGCAGG + Intergenic
1064154324 10:12891079-12891101 TCAGGTAGGAAGGGGGAAGCTGG + Intergenic
1068431840 10:56943109-56943131 TCAGAAATGAAGAGGAAAGATGG - Intergenic
1069112763 10:64467548-64467570 CCAGGTATGTAGAGGGAAAGGGG + Intergenic
1071214167 10:83379337-83379359 TGACATAAGTAGAGGGAAGGTGG + Intergenic
1071472461 10:85993310-85993332 GCAGATGTGTAGTGGGGAGCAGG + Intronic
1071506273 10:86233722-86233744 TGAGATTTATGGAGGGAAGCAGG - Intronic
1071614874 10:87066246-87066268 GGGGATATGAAGAGGGAAGCAGG - Intronic
1073303775 10:102487076-102487098 TCAAAAATGTAAAGGGAGGCTGG - Intronic
1080554331 11:33402299-33402321 TCAGATATGCAGGGTGAAGGAGG - Intergenic
1080760234 11:35241779-35241801 TTAGATATGTAGAGGTTAGGAGG - Intergenic
1081265869 11:41020519-41020541 ACAGACATGCAGAGGGAAGATGG + Intronic
1087785986 11:102354600-102354622 TCAGATATGTACACAGAAGTGGG + Intronic
1090134183 11:124178855-124178877 TCAAATCTGTAAAGGGATGCTGG + Intergenic
1093949601 12:25150013-25150035 TCAGAAATGAAGGGGGAAGGTGG + Intronic
1094636246 12:32229336-32229358 GCAGATATGTAGAGAGAAAAGGG + Intronic
1096454000 12:51770367-51770389 TCAGAAATGGAGAGGGTGGCAGG - Intronic
1097894361 12:64809727-64809749 TCACAGATGCAGAGGGAAGCTGG - Intronic
1098143347 12:67473078-67473100 TTAGAAATATAGAGAGAAGCTGG - Intergenic
1099533517 12:83817613-83817635 TCAGAAATGTAGACAGCAGCAGG - Intergenic
1100519991 12:95365323-95365345 TCAGATATGAAAAATGAAGCTGG - Intergenic
1100562111 12:95757544-95757566 TAAGAGATGTAGTGGGGAGCAGG + Intronic
1104139108 12:125969702-125969724 TCAGAAATGTGGAGAGAAGAAGG + Intergenic
1104204224 12:126621113-126621135 TCAGATATGTTGAGGGCTGGGGG + Intergenic
1105408380 13:20150335-20150357 ACAGAGATGAAGAGGGAGGCAGG + Intronic
1106079051 13:26485462-26485484 ACACATATCAAGAGGGAAGCTGG + Intergenic
1106171761 13:27294739-27294761 AGAGATATGCAGAGGGAAGATGG + Intergenic
1106480889 13:30136052-30136074 GCAGATGTGTAGTGGGCAGCTGG + Intergenic
1110154841 13:72303900-72303922 TTAAATATGTGGAGGGAAGGTGG + Intergenic
1112090408 13:96077413-96077435 ACAGATATTGAGAGGGGAGCTGG + Intergenic
1112129166 13:96502419-96502441 TCTGATATGGAGAGGGAAATGGG + Intronic
1112675939 13:101701789-101701811 TCAGATATATAGACAGAAGCTGG + Intronic
1112970128 13:105251616-105251638 ACAGATAAGTAGAGTGAAGTAGG + Intergenic
1113742514 13:112721429-112721451 TTGGATATGTCGAGGGAAGCCGG + Intronic
1115951362 14:38726072-38726094 CCAGAAATGTAGAAGGATGCAGG - Intergenic
1118286437 14:64478252-64478274 TCAGAAATGAAGGGGGAGGCAGG + Exonic
1119190623 14:72679630-72679652 TCAGACCTGTAGAGGGACACGGG - Intronic
1119399661 14:74354240-74354262 TCAGATATATAGATGGAAAAAGG + Intronic
1119454025 14:74738719-74738741 TCACATGTGTACAAGGAAGCAGG + Intergenic
1121367199 14:93324567-93324589 TCAGAGAGGTAGAGGGTATCTGG - Intronic
1121670614 14:95708176-95708198 TAAAATATGTAGAGGGAGGCTGG + Intergenic
1121951600 14:98175596-98175618 AGAGACATGTAGAAGGAAGCAGG - Intergenic
1122356048 14:101123609-101123631 TGAGGTATGGAGGGGGAAGCAGG - Intergenic
1123770907 15:23527457-23527479 TCAGTTATAGAGAGGGAAGGTGG + Intergenic
1124723904 15:32137772-32137794 TCACATATGTATAGGAATGCAGG + Intronic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1126404677 15:48311481-48311503 TCAGCTATGAAGAGCCAAGCTGG + Intergenic
1126906818 15:53376540-53376562 GCATATATGTGGAGGGAAGTTGG - Intergenic
1129168839 15:73795690-73795712 TGAGAGATGTAGAGGGAACAGGG + Intergenic
1130743041 15:86621983-86622005 TGAATTATTTAGAGGGAAGCTGG - Intronic
1131256488 15:90866045-90866067 TCAGTTATAGCGAGGGAAGCAGG - Intergenic
1131302129 15:91209004-91209026 TCACCTATGTAGCAGGAAGCAGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133621212 16:7528431-7528453 TCAGCTATGCAGAGGGAATTAGG - Intronic
1135244062 16:20839185-20839207 TCAGATATATAGAGAAAAGGTGG - Intronic
1137771953 16:51023588-51023610 TGAGATATGGTGAGGGCAGCTGG + Intergenic
1140518614 16:75563212-75563234 CCAGCTCTGTAAAGGGAAGCAGG + Intergenic
1141393093 16:83680948-83680970 GCACATCTGTAGAGGGAAGAGGG + Intronic
1203140564 16_KI270728v1_random:1762812-1762834 TCAGATATTTAGAAGGTGGCTGG + Intergenic
1144144210 17:12381686-12381708 TGAGGTATGTAGAGTGGAGCTGG + Intergenic
1144426903 17:15151711-15151733 TCTGAAATGGAGAGGGAAGAGGG - Intergenic
1147563768 17:41524360-41524382 CCGGGTAGGTAGAGGGAAGCAGG - Exonic
1151330402 17:73403143-73403165 TCACACAGGTAGGGGGAAGCTGG + Intronic
1151851622 17:76694069-76694091 CCAGATAAGTAGATGGAAGGGGG - Intronic
1154046960 18:10915241-10915263 TCACGTGTGCAGAGGGAAGCAGG + Intronic
1154174702 18:12077787-12077809 TCACGTGTGCAGAGGGAAGCAGG - Intergenic
1156067709 18:33164759-33164781 TCAGATATGTAGCCGGAAATGGG + Intronic
1156423013 18:36976552-36976574 ATAGATATGTAGAGAGAAGGAGG + Intronic
1157325019 18:46662713-46662735 ACAAATATGTAGTGGGAAGGTGG + Intergenic
1158851461 18:61499192-61499214 TCAGATATGGACAGGGGAGACGG + Exonic
1159866491 18:73712142-73712164 TAAGATATTTAGGGGGAAACTGG - Intergenic
1162660714 19:12166844-12166866 TGAGGTATGTAAAGGGAAGTGGG + Intronic
1163312750 19:16523721-16523743 ACAGACATGTAGAGAGAAGACGG + Intronic
1163826891 19:19528993-19529015 TCAGCTGGGGAGAGGGAAGCTGG + Intronic
1165225201 19:34349814-34349836 TCAGATAGGCAGTGGGGAGCGGG + Intronic
1167909354 19:52689585-52689607 GCAGAAATGTAGAGAAAAGCTGG - Intronic
1167999452 19:53432829-53432851 GCAGAAATGTAGAGAAAAGCTGG + Intronic
925367850 2:3323367-3323389 TCAGATTTGTCGTAGGAAGCCGG - Intronic
925743641 2:7027206-7027228 GCAGATGAGGAGAGGGAAGCAGG - Intronic
927320067 2:21733340-21733362 AGAGACATGTAGAGCGAAGCGGG + Intergenic
929571203 2:43024274-43024296 TCAGATATCCAGTGGGCAGCAGG + Intergenic
930034927 2:47079408-47079430 TGAGGTAGGCAGAGGGAAGCGGG + Intronic
931430467 2:62205112-62205134 TCACATATGTGGAGGGACGAGGG - Intronic
931431417 2:62211815-62211837 TCAGAAATGTAGAGAGAAGCAGG - Intronic
933277496 2:80299758-80299780 TCAGATTTCTAGAGGGTAGGAGG + Intronic
934850887 2:97700479-97700501 TCAGATGGGTAGGAGGAAGCAGG - Intergenic
936372864 2:111917545-111917567 TCTGAAAGGTAGAGAGAAGCAGG - Intronic
937340318 2:121086936-121086958 TCAGGGATGTAGAGGGAAGATGG + Intergenic
939448304 2:142337888-142337910 TGGGAGATGAAGAGGGAAGCAGG - Intergenic
940853905 2:158714964-158714986 TCTGAAAGGTAGAGGGAAGAAGG - Intergenic
941111351 2:161421739-161421761 TAAGAGAAGTAGAGGGAGGCAGG - Intronic
946577636 2:221093632-221093654 TGAGATATTTAGTGAGAAGCAGG + Intergenic
946846720 2:223865669-223865691 TAATATATGTAGAAGGATGCTGG + Intronic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
949082613 2:242116603-242116625 TCAGATATGTACAGGTAGGCAGG - Intergenic
1169413189 20:5392260-5392282 TCAACTATGCAGAGGGAAGAGGG - Intergenic
1170708339 20:18766445-18766467 TCAGAAAAGAAGAGGGAGGCCGG + Intergenic
1172593789 20:36135629-36135651 TCAGATATGTAGAGGGAAGCAGG - Intronic
1173388483 20:42610012-42610034 TCAGATGGGTGGCGGGAAGCAGG + Intronic
1174932326 20:54829413-54829435 GCAGACATGTAGCGGGATGCCGG + Intergenic
1175500692 20:59448469-59448491 ACAGATTTAAAGAGGGAAGCAGG + Intergenic
1175659260 20:60798100-60798122 TCAGATAGGAAGAGAGAAACTGG + Intergenic
1175871484 20:62211435-62211457 TCATATCTGTAGAACGAAGCAGG + Intergenic
1176983071 21:15405300-15405322 TCAGATAAGTAAAGGGTAGCAGG + Intergenic
1177859991 21:26441056-26441078 TCTGCTATGGAGAGGGGAGCTGG + Intergenic
1178030861 21:28523988-28524010 GCAGATCTTTAGATGGAAGCGGG - Intergenic
1183864245 22:40691595-40691617 TCTGATATTTCAAGGGAAGCTGG - Intergenic
1184404711 22:44293272-44293294 ACAGCTATGGAGAGGGAAGGCGG + Intronic
1185101911 22:48845141-48845163 TCAGAGATGTAGAAGTAAGAAGG - Intronic
949655645 3:6215402-6215424 TTGGATAGATAGAGGGAAGCAGG + Intergenic
950185386 3:10942041-10942063 TCAGACATGAGGAGGGAAGATGG - Intergenic
951050373 3:18086843-18086865 TCAGAAATGTATAGGCAAGAGGG + Intronic
954344263 3:49983139-49983161 TAAGAAATGTAAAGGGCAGCTGG - Intronic
954670863 3:52290737-52290759 CCAGATAGATAGAGGGAGGCAGG - Intronic
955343007 3:58140156-58140178 TCAAACTTATAGAGGGAAGCAGG - Intronic
957117969 3:76050691-76050713 TCAGGTATGGAGAGAGAAGAGGG - Intronic
959211204 3:103383881-103383903 TAGGATATGTACAGAGAAGCTGG - Intergenic
959874777 3:111369975-111369997 TCAAATATTCAGAGAGAAGCAGG - Intronic
959962981 3:112321756-112321778 TCAAAGTTGTAGAGGTAAGCAGG - Intergenic
960972441 3:123149474-123149496 TGAGTTATAGAGAGGGAAGCAGG + Intronic
961993907 3:131220749-131220771 TTAGATATGCAGAGAGAGGCAGG + Intronic
962140342 3:132783784-132783806 TAGCATATGTAGAGAGAAGCAGG - Intergenic
962383997 3:134918228-134918250 TCAGGTGTGTAGAGGGGAGGAGG + Intronic
964160623 3:153640958-153640980 TCAGGGAAGTAGAGGAAAGCTGG - Intergenic
967309064 3:188089078-188089100 TCAGGCAAGAAGAGGGAAGCAGG - Intergenic
967408372 3:189142245-189142267 GCAGAAATGGAGAGGAAAGCTGG + Intronic
967456261 3:189689993-189690015 GCAGAGAGGTAGAGGGAAGGAGG - Intronic
968335879 3:197913150-197913172 GCAGATGGGAAGAGGGAAGCAGG - Intronic
969191655 4:5526195-5526217 TCCTGTATGTAGAGGGAAGAAGG - Exonic
969348060 4:6581563-6581585 TCAGATATGTTGGGGTAAGAGGG + Intronic
969352110 4:6603963-6603985 TCTGATTTGGAGAGGGAGGCTGG - Intronic
971040085 4:22742193-22742215 GCAGATGTGTTGAGAGAAGCTGG + Intergenic
972275724 4:37555853-37555875 TGAGATGTGAAGAGGGAAGAAGG - Intronic
972710399 4:41589409-41589431 TCAGAAATGTAGTGGGTAACAGG + Intronic
973998902 4:56490162-56490184 CCACACATGTAGAGGAAAGCAGG - Intronic
975167134 4:71189021-71189043 TCATATATGTAGATGGAGACAGG + Intronic
975524871 4:75337924-75337946 TCAGATGTGTTGGGAGAAGCAGG + Intergenic
976447673 4:85150514-85150536 TCAGAAATGTGGAGGGAAAAGGG + Intergenic
977715270 4:100175101-100175123 CCAGACATGAAGAGGGAACCTGG - Intergenic
978060539 4:104331650-104331672 TCAGATACGCAGTGGCAAGCTGG - Intergenic
978612779 4:110562558-110562580 TCAGATATGCAGAGTCATGCTGG - Exonic
982241946 4:153308755-153308777 GCAGATATTTTGAAGGAAGCTGG + Intronic
985697398 5:1348465-1348487 GCAGATATTTATAGGAAAGCAGG + Intergenic
985845952 5:2347125-2347147 AAAGAAATCTAGAGGGAAGCTGG - Intergenic
986130391 5:4924542-4924564 TAAGATGTGTAAAGGGAAGAGGG + Intergenic
989158584 5:38368613-38368635 ACAGATATTTAGAGGAAGGCAGG - Intronic
989503048 5:42191788-42191810 TAAGATATGAAGAGTGAAGTAGG + Intergenic
991481794 5:67089247-67089269 TTAAACATGCAGAGGGAAGCAGG + Intronic
993274367 5:85837634-85837656 TAAGATTTGAAGAGGGAATCTGG + Intergenic
993823227 5:92646790-92646812 TATGATATTTAGAGGAAAGCAGG + Intergenic
997601915 5:135145329-135145351 TCAGATGTGTAGTTGGAAGAGGG + Intronic
999664470 5:153898286-153898308 TCAGCTATGGCAAGGGAAGCAGG + Intergenic
1000645597 5:163757024-163757046 TCAGAGAGGTGGAGGGAAGATGG - Intergenic
1001960477 5:175877687-175877709 TCAGGGATGTAGGGGGAAGATGG + Intronic
1002198516 5:177513891-177513913 TCACCTATCTAGAGGCAAGCAGG + Intronic
1003604411 6:7545989-7546011 TTGGATAGGCAGAGGGAAGCTGG + Intronic
1003711937 6:8602464-8602486 TCAGAGAAGTAGGGGAAAGCTGG + Intergenic
1004041266 6:11978411-11978433 TCTGACATGTAAAGGCAAGCTGG - Intergenic
1005750606 6:28878732-28878754 TCAGAAATAGAGTGGGAAGCAGG + Intergenic
1005955752 6:30662296-30662318 TCACATATTTAGAGGGAACCAGG + Intronic
1006312613 6:33271593-33271615 TCAGATATGGAGGAGGAAGAGGG - Exonic
1007238038 6:40405144-40405166 TCAGATGTGTAATGGGTAGCTGG - Intronic
1010489595 6:76459525-76459547 TCAGTCATGTAGAGCAAAGCAGG - Intergenic
1014204383 6:118641188-118641210 TAAGATATTAAGAGAGAAGCTGG - Intronic
1014776700 6:125519258-125519280 TGAGATGAGAAGAGGGAAGCTGG - Intergenic
1014880223 6:126714797-126714819 TTAGATCTGCCGAGGGAAGCTGG + Intergenic
1017134207 6:151134059-151134081 GCAGAGACGTGGAGGGAAGCAGG - Intergenic
1017429965 6:154361247-154361269 TCAGAGATGGAGAGGGGAGCCGG + Intronic
1018775864 6:167015256-167015278 TCAGAAATGTACAGGGAAAAAGG - Intronic
1021378749 7:19940594-19940616 TCAGATGGGCAGAGGGAAACCGG + Intergenic
1022273125 7:28829762-28829784 TCAGCTATGTGTGGGGAAGCAGG + Intergenic
1023049076 7:36235515-36235537 ACAGAGATGCAGAGGGGAGCCGG - Intronic
1024622203 7:51170735-51170757 TCACAGAAGTAGAGAGAAGCTGG + Intronic
1027708647 7:81568529-81568551 TGGGATATGTAGAGGGACACAGG - Intergenic
1029054868 7:97731823-97731845 TCAGATCTGCAGACGGAAGCAGG + Intergenic
1029094003 7:98070792-98070814 TCAGATAGGAAGAAGGAATCAGG + Intergenic
1033175351 7:139118690-139118712 TCAGATATGTTACGGGAAGAGGG - Intergenic
1035026756 7:155831344-155831366 TCAGGGAGGGAGAGGGAAGCCGG + Intergenic
1035540538 8:433306-433328 TCAGATATGTACAGGTAGGCAGG - Intronic
1036194503 8:6702040-6702062 ACAGACATGTAGGGGGAAGATGG - Intergenic
1037395292 8:18435267-18435289 TTATATATATATAGGGAAGCTGG - Intergenic
1040790852 8:51228228-51228250 CAAGATATGTGGAGGGAAGCCGG + Intergenic
1043883514 8:85571944-85571966 TCAGATCTTTAGAGAAAAGCAGG + Intergenic
1050966648 9:11812620-11812642 TGAGAAAGGTAGAGGGAAGGAGG - Intergenic
1051143444 9:14002783-14002805 TCAGATTTGTTGAGGCAAGAAGG + Intergenic
1051497506 9:17740432-17740454 TCAAATACTTAGAGGGAAACAGG - Intronic
1056797823 9:89670678-89670700 TCAGACATGTGGAGGGTAGATGG + Intergenic
1056848869 9:90064000-90064022 TCAGATCTGTCAAAGGAAGCAGG + Intergenic
1057901494 9:98952405-98952427 TAAGATGAGTAGAGAGAAGCTGG - Intronic
1058203081 9:102067571-102067593 GAAGATATGTAGAAGAAAGCCGG + Intergenic
1059053299 9:110952484-110952506 TCAGATATGTGGAGAGAGGAGGG - Intronic
1062121841 9:134838110-134838132 TCAGCCATGCAGAGGGAACCGGG + Intronic
1185554989 X:1014087-1014109 TCAGATATTTAGAAGGCGGCTGG - Intergenic
1189052660 X:37663046-37663068 TGAGAGATGTAGAAGGAAGAAGG - Intronic
1190464866 X:50716195-50716217 GCAGATAAGTAGGGGGAAGGGGG + Intronic
1190486110 X:50927028-50927050 TCAGATATGTGGATTGGAGCAGG + Intergenic
1190796076 X:53743871-53743893 TCAGATGTGAAGAGGGAAGTAGG - Intergenic
1193871907 X:86808584-86808606 TCAGTTTGTTAGAGGGAAGCAGG + Intronic
1193976143 X:88121337-88121359 TCAGATATATAAAGAGGAGCTGG + Intergenic
1194777361 X:97981455-97981477 TCAGAGAGGTAGTGGGAGGCAGG + Intergenic
1196742319 X:119036038-119036060 TGAAATGTGTAGAGGGCAGCTGG - Intergenic
1197291637 X:124665808-124665830 CCAGATATGGCGAGGGAAGGGGG - Intronic
1197654306 X:129099672-129099694 CACGATATGTAGAGGGAGGCAGG - Intergenic
1197929266 X:131678421-131678443 GCAGCTATGGAGAGGGGAGCAGG - Intergenic
1197946061 X:131841029-131841051 GCAGCTATGGAGAGGGGAGCAGG + Intergenic
1198231215 X:134691464-134691486 TAAGATTTGGAGAGAGAAGCAGG + Intronic
1200017585 X:153178725-153178747 TGAGATCGGTGGAGGGAAGCGGG + Intergenic