ID: 1172595433

View in Genome Browser
Species Human (GRCh38)
Location 20:36148130-36148152
Sequence CTATGCACATATTGTGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172595424_1172595433 28 Left 1172595424 20:36148079-36148101 CCTACTTGCTCCCTGGCCTCTGG 0: 1
1: 0
2: 3
3: 35
4: 442
Right 1172595433 20:36148130-36148152 CTATGCACATATTGTGAACTGGG 0: 1
1: 0
2: 2
3: 6
4: 138
1172595427_1172595433 18 Left 1172595427 20:36148089-36148111 CCCTGGCCTCTGGCTTTCGGTGT 0: 1
1: 0
2: 1
3: 17
4: 221
Right 1172595433 20:36148130-36148152 CTATGCACATATTGTGAACTGGG 0: 1
1: 0
2: 2
3: 6
4: 138
1172595428_1172595433 17 Left 1172595428 20:36148090-36148112 CCTGGCCTCTGGCTTTCGGTGTG 0: 1
1: 0
2: 0
3: 18
4: 181
Right 1172595433 20:36148130-36148152 CTATGCACATATTGTGAACTGGG 0: 1
1: 0
2: 2
3: 6
4: 138
1172595429_1172595433 12 Left 1172595429 20:36148095-36148117 CCTCTGGCTTTCGGTGTGAAGAT 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1172595433 20:36148130-36148152 CTATGCACATATTGTGAACTGGG 0: 1
1: 0
2: 2
3: 6
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172595433 Original CRISPR CTATGCACATATTGTGAACT GGG Intronic
907786329 1:57616714-57616736 CTATCCAAATATTATGAAATGGG + Intronic
911948259 1:104138468-104138490 CTATGCACATCTTGTGAGTGGGG - Intergenic
913014682 1:114721060-114721082 GTTGGCTCATATTGTGAACTTGG - Intronic
914784067 1:150812331-150812353 CTTTGAAAATATTGAGAACTAGG - Intronic
917102180 1:171457503-171457525 TGATGCTCATATTTTGAACTAGG - Intergenic
923525453 1:234769117-234769139 CTTTGCACCTATTATGTACTTGG - Intergenic
1067785166 10:49240454-49240476 CTAAGCACTTACTGTGAACCAGG - Intergenic
1068534420 10:58225329-58225351 ATTTACAAATATTGTGAACTTGG - Intronic
1072210193 10:93239381-93239403 CTATGTACCTATTGTGTCCTGGG + Intergenic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1084643241 11:70438337-70438359 CTGTGCACATACTGTGTGCTGGG + Intergenic
1087587209 11:100137652-100137674 CTAGTCACTTATTGAGAACTTGG + Intronic
1088382172 11:109205657-109205679 CCATGCACTTACTGTGAACCAGG + Intergenic
1093877455 12:24366636-24366658 CTATGCAAATATTATGGAATAGG - Intergenic
1094750397 12:33399549-33399571 CTATGCACATTTAGAGAACAAGG - Intronic
1096169839 12:49459048-49459070 CTATTCGCTTATTGTGACCTAGG - Intronic
1096294083 12:50368863-50368885 CTATACACATACTGTTAACTTGG - Intronic
1096473843 12:51896122-51896144 CTATGCACATGTTTTGAGCCTGG - Intergenic
1097458188 12:59827150-59827172 TTATACACTTATTGTGAAATGGG + Intergenic
1098098318 12:66984939-66984961 TTATCCACATATTGTCAGCTGGG + Intergenic
1100844804 12:98646740-98646762 ACTTGCAGATATTGTGAACTGGG + Intronic
1101364757 12:104061669-104061691 CTTTGGACATATTATGAAATTGG + Intronic
1102143079 12:110632932-110632954 TTAAGCACATATTGTGTGCTGGG + Intronic
1106797586 13:33222737-33222759 CTATGCACATAATGTGTAAATGG + Intronic
1106799191 13:33238943-33238965 CTATGTACATGTTGTGTAATGGG + Intronic
1108716421 13:53083296-53083318 TTTTGCACATAGTGTGATCTTGG + Intergenic
1110416319 13:75257258-75257280 GTAGGCACATAGTATGAACTCGG - Intergenic
1111767382 13:92548816-92548838 ATATGCACATCTTGGGAAATGGG - Intronic
1112691255 13:101897177-101897199 CTAGGCACATATGGTGAGCGGGG - Intronic
1117263735 14:54064027-54064049 CTTTGCACATATTGTTCCCTTGG - Intergenic
1117893996 14:60459784-60459806 CTTTGCACATATTTTTAATTGGG + Intronic
1119011122 14:70990213-70990235 CAATGAACAATTTGTGAACTGGG - Intronic
1126261209 15:46694412-46694434 TTATGAACACATTATGAACTTGG - Intergenic
1126953261 15:53906441-53906463 CTATGCACATATTGTTAAAGTGG - Intergenic
1139825428 16:69753493-69753515 CTGTGCACTTACTGTGTACTAGG + Intronic
1140890803 16:79283317-79283339 GAATGTACTTATTGTGAACTGGG - Intergenic
1144041115 17:11412105-11412127 CTTTGAAGATCTTGTGAACTGGG + Intronic
1152009786 17:77705343-77705365 CTATGCACATATTTTTCACACGG - Intergenic
1152180581 17:78818517-78818539 TTCTACACATATTGTGAAGTAGG - Intronic
1156120809 18:33840833-33840855 CTATGCATATATTCCGAACAAGG - Intergenic
1156136798 18:34050135-34050157 ATCTGCATATATTGTGAAGTGGG - Intronic
1156920200 18:42513065-42513087 GTATGTACTTATTGTCAACTGGG + Intergenic
1156925623 18:42574718-42574740 CTCTGCCCCTATTGTTAACTGGG + Intergenic
1164703289 19:30301500-30301522 CTAGGCACAAACTGTGAACACGG - Intronic
926537985 2:14137341-14137363 GTTTGCACTTATTCTGAACTTGG - Intergenic
927490638 2:23518823-23518845 CTATCCCCATATCATGAACTGGG + Intronic
928230146 2:29491323-29491345 CTGAGTACATATTATGAACTCGG - Intronic
928718097 2:34086598-34086620 CTATGCACAAAATGGGAAATTGG + Intergenic
930268150 2:49224038-49224060 ATATCCACATTTGGTGAACTCGG + Intergenic
930291584 2:49500381-49500403 CTCTGCACATGTTGTGAAAGTGG + Intergenic
932187671 2:69712852-69712874 CTATCCACATTTTGTGCACCAGG + Intronic
932684738 2:73858500-73858522 GTATGCATATATTGTGGAATGGG + Intronic
935090034 2:99886259-99886281 CCATGCACATATTTTAAAGTTGG + Intronic
935340184 2:102052842-102052864 CCATTCTCATATTGTGAAGTTGG + Intergenic
937719661 2:125079272-125079294 GTATGCATATATTGTGAAAAAGG - Intergenic
940249055 2:151653578-151653600 ATATGCACATATTTTAAAATAGG - Intronic
941316438 2:163998931-163998953 CTATACACTTATTCTGAAGTTGG + Intergenic
942370191 2:175275611-175275633 CTATGCAGATAAGGTGAATTTGG + Intergenic
942719252 2:178931713-178931735 TTATGAAAATATTCTGAACTAGG + Intronic
943024509 2:182610964-182610986 CTCTGGACATATTCTGCACTTGG - Intergenic
944385625 2:199160886-199160908 TTAAGCACACATTCTGAACTTGG - Intergenic
945568812 2:211438111-211438133 TTTTGGACATATTGTTAACTAGG + Intronic
945909091 2:215626466-215626488 GCATGCACATATTGTGCACATGG - Intergenic
1170071359 20:12372624-12372646 CTCTGCGCATATTGTTTACTTGG - Intergenic
1171720625 20:28559560-28559582 CTATGAGCATCTTGTGAAGTAGG - Intergenic
1171784939 20:29455023-29455045 CTATGAGCATCTTGTGAAGTAGG - Intergenic
1171863444 20:30422649-30422671 CTATGAGCATCTTGTGAAGTAGG + Intergenic
1172595433 20:36148130-36148152 CTATGCACATATTGTGAACTGGG + Intronic
1173822104 20:46026124-46026146 CTCTCCACTTATTGTGAAATTGG - Intronic
1177227487 21:18276678-18276700 CCATGAACATATTGTTCACTAGG - Intronic
1177536645 21:22436825-22436847 GTAGGCTCATGTTGTGAACTAGG + Intergenic
1177635517 21:23782556-23782578 CTAAGCACTTATTATGCACTGGG + Intergenic
1183592422 22:38787681-38787703 GTTTGCACATAGTGGGAACTTGG - Intronic
1184360466 22:44014442-44014464 CTATGCATACATTGTACACTTGG - Intronic
1184554721 22:45226966-45226988 CTCTGCAGATATCGTGAGCTGGG - Intronic
949276394 3:2287914-2287936 GTATGAACTTATTGTAAACTTGG + Intronic
949630597 3:5921629-5921651 TTTTGCATATATTGAGAACTTGG + Intergenic
951073313 3:18359035-18359057 CTATTAAAATTTTGTGAACTTGG + Intronic
955540831 3:59974263-59974285 CTATGCACAGAATGAGAACACGG - Intronic
955682995 3:61521636-61521658 CTATTTACAAAATGTGAACTTGG - Intergenic
956190989 3:66608299-66608321 CTATGAACATGGTGTGAACTTGG + Intergenic
961250237 3:125497264-125497286 CCATGCACTCATTGGGAACTTGG - Intronic
963720738 3:148859063-148859085 CTATTTATATATGGTGAACTTGG + Intronic
965842443 3:172922539-172922561 CTATGTTCACATTGTGAAATCGG + Intronic
966096147 3:176205735-176205757 CCTTGCACATATTGTGAGTTTGG - Intergenic
967002823 3:185353242-185353264 CAATGAACAATTTGTGAACTTGG + Intronic
970743248 4:19263300-19263322 CTTTGCAAATGTTATGAACTAGG - Intergenic
971568500 4:28177978-28178000 CTATGCAGATATGCTGATCTTGG + Intergenic
974769333 4:66390210-66390232 TTATGCACATAGTGTGAATGGGG + Intergenic
975103930 4:70547290-70547312 ATATGTATATATTGTGAAATGGG + Intergenic
977407429 4:96617700-96617722 CCATGGCCATATTTTGAACTTGG + Intergenic
977655953 4:99520933-99520955 CTATGAACATATTATTAAGTTGG - Intronic
978594526 4:110362373-110362395 CTAAGCAGATATTCTGAAATGGG - Intergenic
979378187 4:119974240-119974262 ATATGTATATATTGTGAAATGGG - Intergenic
981307101 4:143258045-143258067 CTATGCACAGGTTATGATCTTGG + Intergenic
982830112 4:160048751-160048773 TTTTGCACCTATTGTGAAATGGG - Intergenic
985071712 4:186171910-186171932 TTAGGCACATATTGTGAACCTGG - Exonic
985617343 5:931444-931466 CTATGAACAGTTTGTGAAGTGGG - Intergenic
986431033 5:7681575-7681597 CTTTGAAAATATTGTCAACTGGG - Intronic
988966295 5:36421526-36421548 CTATGCACATGCTTTCAACTGGG + Intergenic
991015994 5:61933258-61933280 CAAAGCACATATTGAGAACAGGG - Intergenic
991279795 5:64899572-64899594 CTATGAACATATTATGAAACAGG + Intronic
993423570 5:87733510-87733532 CTATGCACATCATGTAAAATAGG - Intergenic
995114369 5:108462517-108462539 CTAAGCACTTATTATGGACTGGG - Intergenic
995638364 5:114222278-114222300 CCATGCAAATATTGTTTACTAGG - Intergenic
995787695 5:115847705-115847727 ATATGTATATATTGTGAAATGGG + Intronic
999047847 5:148488933-148488955 CTATGCACATATTGGGAAATAGG - Intronic
1001663684 5:173415362-173415384 TTATGCATATATAGTGAACATGG - Intergenic
1003003029 6:2354398-2354420 CTATACACATATTTTGAAAATGG - Intergenic
1005162103 6:22876033-22876055 CTATTGAAATATTGTGAAATAGG + Intergenic
1006875227 6:37289694-37289716 CTTTGCACTTCTTGTGACCTGGG - Intronic
1007291732 6:40792524-40792546 CTATGCACTCAATGTGATCTTGG + Intergenic
1007940790 6:45779340-45779362 CATTGCTCATATTGTGAACAGGG - Intergenic
1008828537 6:55729785-55729807 CTTTGTACATGTTGAGAACTAGG - Intergenic
1009452327 6:63816554-63816576 CTGTTCACACAATGTGAACTTGG - Intronic
1013689215 6:112620033-112620055 TTATGCCAATATTGTGCACTAGG - Intergenic
1014603189 6:123442023-123442045 CCATGGTCATATTGTGAGCTGGG - Intronic
1016077462 6:139814682-139814704 CTGTGTAAATATGGTGAACTTGG + Intergenic
1016532871 6:145077306-145077328 AAATGCACATATTGTGTATTTGG + Intergenic
1021187405 7:17580607-17580629 TTCTGCACATATTGTGAGCAGGG - Intergenic
1023425605 7:40032420-40032442 CTTTTCACATATTGTGATTTTGG + Intronic
1023620541 7:42067491-42067513 CTATTCACTTATGGTGAACTTGG + Intronic
1024713515 7:52045761-52045783 CAATGCACATATTGGTGACTGGG - Intergenic
1025038187 7:55615488-55615510 GTACACACATATTGTGAAATGGG + Intergenic
1025781335 7:64604459-64604481 CCGTGCATATATTGTGTACTGGG + Intergenic
1025797513 7:64753326-64753348 CTCTGCACATATTGTGCACTTGG + Intergenic
1026386104 7:69849374-69849396 CTATACACATATATTGTACTAGG - Intronic
1028612025 7:92722437-92722459 CAATACACAGACTGTGAACTTGG + Intronic
1030787079 7:113675377-113675399 ATATGCATATTTTGTCAACTAGG - Intergenic
1033818514 7:145104921-145104943 CTGTGCACATATAGTGAATAGGG + Intergenic
1034314305 7:150115874-150115896 CTATGCACATTCAGTGCACTAGG - Intergenic
1047626552 8:126662500-126662522 CTCTGTAGATATTGAGAACTCGG - Intergenic
1052464405 9:28811918-28811940 CTATGCACCCATTGTGTTCTAGG - Intergenic
1053748352 9:41224155-41224177 CTATGAGCATCTTGTGAAGTAGG + Intergenic
1057359533 9:94360539-94360561 CTATGCACCTATGGTGTTCTTGG - Intergenic
1057663795 9:97027428-97027450 CTATGCACCTATGGTGTTCTTGG + Intergenic
1059531055 9:115036090-115036112 CTTTGTACCTGTTGTGAACTTGG + Exonic
1202784482 9_KI270718v1_random:34867-34889 CTATGAGCATCTTGTGAAGTAGG + Intergenic
1203445734 Un_GL000219v1:54177-54199 CTATGAACATCTTGTGAAGTAGG - Intergenic
1186441131 X:9587434-9587456 ATGTGCAAATAATGTGAACTCGG - Intronic
1190005800 X:46736927-46736949 TTATGCAGATACTGTGAACCTGG + Intronic
1190468886 X:50755562-50755584 CTGAGCACCTACTGTGAACTTGG - Intronic
1190635872 X:52433301-52433323 CTATGCACATGTTCGGACCTTGG + Intergenic
1194422445 X:93693292-93693314 CTATACAAATATTGTACACTGGG - Intronic
1197614747 X:128678862-128678884 GTATGCACATATGGTCAGCTAGG + Intergenic
1197961803 X:132014869-132014891 CTATGCAAATATAGAGAAATGGG - Intergenic
1200849172 Y:7865085-7865107 CAATGGACATATTGTGTCCTTGG + Intergenic