ID: 1172600029

View in Genome Browser
Species Human (GRCh38)
Location 20:36177181-36177203
Sequence AGAGTCCCTGCCTCTTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 1, 2: 9, 3: 29, 4: 256}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172600016_1172600029 21 Left 1172600016 20:36177137-36177159 CCCGAGGGCCCAGCCAGACCTTA 0: 1
1: 0
2: 3
3: 13
4: 215
Right 1172600029 20:36177181-36177203 AGAGTCCCTGCCTCTTTGGGTGG 0: 1
1: 1
2: 9
3: 29
4: 256
1172600021_1172600029 13 Left 1172600021 20:36177145-36177167 CCCAGCCAGACCTTACAGGGGTC 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1172600029 20:36177181-36177203 AGAGTCCCTGCCTCTTTGGGTGG 0: 1
1: 1
2: 9
3: 29
4: 256
1172600024_1172600029 3 Left 1172600024 20:36177155-36177177 CCTTACAGGGGTCTCACTCCCTC 0: 1
1: 0
2: 0
3: 24
4: 167
Right 1172600029 20:36177181-36177203 AGAGTCCCTGCCTCTTTGGGTGG 0: 1
1: 1
2: 9
3: 29
4: 256
1172600023_1172600029 8 Left 1172600023 20:36177150-36177172 CCAGACCTTACAGGGGTCTCACT 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1172600029 20:36177181-36177203 AGAGTCCCTGCCTCTTTGGGTGG 0: 1
1: 1
2: 9
3: 29
4: 256
1172600022_1172600029 12 Left 1172600022 20:36177146-36177168 CCAGCCAGACCTTACAGGGGTCT 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1172600029 20:36177181-36177203 AGAGTCCCTGCCTCTTTGGGTGG 0: 1
1: 1
2: 9
3: 29
4: 256
1172600017_1172600029 20 Left 1172600017 20:36177138-36177160 CCGAGGGCCCAGCCAGACCTTAC 0: 1
1: 0
2: 1
3: 14
4: 213
Right 1172600029 20:36177181-36177203 AGAGTCCCTGCCTCTTTGGGTGG 0: 1
1: 1
2: 9
3: 29
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172600029 Original CRISPR AGAGTCCCTGCCTCTTTGGG TGG Intronic
900572884 1:3368062-3368084 AGGTTCCCTGACTCTTTGAGGGG - Intronic
900747091 1:4367761-4367783 GGGGTCCCTTCCTCTTTGGGGGG + Intergenic
901099310 1:6707066-6707088 AGATTCTCAGCCTCTCTGGGCGG - Intergenic
901236231 1:7669093-7669115 AGTGGCCCAGCCTCTCTGGGTGG - Intronic
901975164 1:12938655-12938677 TGAATGCCTGCCTATTTGGGTGG - Exonic
902010012 1:13263109-13263131 TGAATGCCTGCCTATTTGGGTGG + Exonic
902030882 1:13421256-13421278 TGAATGCCTGCCTATTTGGGTGG + Exonic
903135646 1:21307820-21307842 AGAGGCCCTGCCCCCTTGAGAGG + Intronic
903140354 1:21335426-21335448 GGAGGCCCTGCCTCATTGTGGGG - Intronic
903328099 1:22582763-22582785 AGAGGCCCTTCCTCTTTCTGGGG - Intronic
903735129 1:25525001-25525023 AGAGATCCTGCCTATGTGGGAGG - Intergenic
904128769 1:28260350-28260372 GGAGTCCCTTCCTCTTCGCGGGG + Intronic
905016201 1:34780628-34780650 GGAGTCCCTGGATCTTAGGGTGG - Intronic
908667702 1:66510660-66510682 AGAGTGCCTGCCTCTGTGCCTGG - Intergenic
909465970 1:75974412-75974434 AGAGTACCTTCCTCCATGGGTGG + Intergenic
909528741 1:76657885-76657907 AGACTCCCTGCCTTCTTTGGTGG + Intergenic
910911751 1:92241815-92241837 ATAGTCCCAGCTACTTTGGGAGG + Intronic
914685011 1:149970748-149970770 AGAGTCATTACCTCTTTGGGGGG - Intronic
915600816 1:156922221-156922243 ATACTCCCTGCCTCCTTGAGGGG - Intronic
916123876 1:161551927-161551949 TGAGACCCTGACTCTTGGGGGGG + Intergenic
916133760 1:161633290-161633312 TGAGACCCTGACTCTTGGGGGGG + Intronic
917341217 1:173979901-173979923 TGAGACCCTGTCTCTTTAGGGGG - Intronic
918378546 1:183932838-183932860 TGAGTCCCCACCTCCTTGGGTGG + Intronic
918765011 1:188470179-188470201 AAAGTCTCTGTCTATTTGGGTGG - Intergenic
922158066 1:223055455-223055477 AGAGTAGTTGCCTCTTGGGGTGG - Intergenic
1063099452 10:2936601-2936623 GCAGTGCCTGCCTGTTTGGGCGG + Intergenic
1067368785 10:45662262-45662284 AGAGTCCTTGTCTCTGTAGGAGG - Intronic
1067542362 10:47165378-47165400 GGAGCCCCTCCCTCTGTGGGAGG + Intergenic
1068742110 10:60485393-60485415 AGATTCCCTGCCTGTTTGCATGG - Intronic
1070160698 10:73865239-73865261 AGTGTCCCTCCCTGTTTTGGCGG + Intronic
1070198909 10:74184449-74184471 ATAGTCCCAGCCTCTCTGGAGGG - Intronic
1070654596 10:78262608-78262630 AGGCTCCCTGCATCTTTGGAGGG + Intergenic
1070827416 10:79399323-79399345 AGAGGCCGTGCCTTTCTGGGAGG - Intronic
1073931857 10:108585582-108585604 AGATTCTGTGCCTCATTGGGAGG - Intergenic
1074680115 10:115897617-115897639 AGAGTGCCTGTCCCTTTGTGAGG - Intronic
1077141950 11:1028622-1028644 TGAGTCCCTGCCTCTCCAGGTGG - Intronic
1078707919 11:13763020-13763042 TGAGTGCCTGTCTCTTTGTGGGG + Intergenic
1079650697 11:22925238-22925260 AGAATCCCTGTTTATTTGGGAGG - Intergenic
1083294641 11:61708721-61708743 ACAGTGCCTCCCTCTTGGGGTGG - Intronic
1083305333 11:61759135-61759157 AGAGACCCTGCAGCTTGGGGTGG - Intronic
1083924109 11:65795632-65795654 ACAGTGCCTGTCTCTGTGGGCGG - Exonic
1084587274 11:70069650-70069672 AGTGTCCCTGCCTCTTAAGCAGG - Intergenic
1085519669 11:77130656-77130678 AGTGTTCCCACCTCTTTGGGTGG + Intronic
1085740932 11:79077888-79077910 AGAGGCCCTGCTGCCTTGGGAGG + Intronic
1089222061 11:116881186-116881208 AGAGGCCCTGCCTTTTGGGTGGG - Intronic
1089817422 11:121188987-121189009 AGAGCCACTGCCTCTTTTAGAGG + Intronic
1090809864 11:130228113-130228135 AGATTGCCTGCCTCTTTGTAGGG - Exonic
1092195687 12:6548469-6548491 GGAGACCCTGCTGCTTTGGGAGG - Exonic
1093976141 12:25424392-25424414 AAATTCCCTGACTCATTGGGTGG + Intronic
1094838802 12:34334490-34334512 AGTCTCCCTGTCTCTTTGGGTGG - Intergenic
1094838852 12:34334659-34334681 AGCATCCCTGCCACTTTGTGCGG - Intergenic
1094839114 12:34335573-34335595 AGCCTCCCAGCCCCTTTGGGCGG - Intergenic
1094839353 12:34336469-34336491 AGCCTCCCTGCCTCTTTGAGAGG - Intergenic
1094839396 12:34336637-34336659 AGCTTCCCTGCCGCTTTGGGTGG - Intergenic
1094839549 12:34337187-34337209 AGCCTCCCTGCCGGTTTGGGCGG - Intergenic
1094839590 12:34337358-34337380 AGCCTCCCTGTCTCTTTGGGTGG - Intergenic
1094839646 12:34337547-34337569 AGCCTCCCTGCCCCTTTAGGCGG - Intergenic
1094839700 12:34337754-34337776 AGCCTCCCTGCCTCTTTGGGCGG - Intergenic
1094839814 12:34338145-34338167 AAACTCCCTGCCGCTTTGGACGG - Intergenic
1094839910 12:34338522-34338544 AGTCTCCCTGCCTCTTTGGGCGG - Intergenic
1094840252 12:34339811-34339833 AGTGTCCCTGCTGCTTTGGGCGG - Intergenic
1094840310 12:34340002-34340024 AGCCTCCCTGCACCTTTGGGCGG - Intergenic
1094840622 12:34341297-34341319 ATCCTCCCTGCCGCTTTGGGCGG - Intergenic
1094840681 12:34341487-34341509 AGCCTCCCTGACTCTTTGGGCGG - Intergenic
1094840973 12:34342594-34342616 AGACTCCCTGCCTCTTTGGGCGG - Intergenic
1094841032 12:34342784-34342806 AGCATCCCTGCCGCTTTGGGCGG - Intergenic
1094841084 12:34342973-34342995 AGCCTCCCTGCCTCTTTGGGCGG - Intergenic
1094841147 12:34343164-34343186 AGCCTCCCTGCCGCTTTGGCCGG - Intergenic
1094841164 12:34343226-34343248 AGACTCCCTGACTCTTTGGGCGG - Intergenic
1094841280 12:34343639-34343661 AGCCTCCCTGCCTCTTTGGGCGG - Intergenic
1094841331 12:34343832-34343854 AGCCTGCCTGCCTCGTTGGGCGG - Intergenic
1094841527 12:34344483-34344505 GGCCTCCCTGCCGCTTTGGGAGG + Intergenic
1094841738 12:34345209-34345231 AGACTCCCTGCCGCCTTTGGCGG + Intergenic
1094841888 12:34345734-34345756 GGCGTCCCTGTCTCTTTGGGCGG + Intergenic
1094841945 12:34345925-34345947 AGCCTCCCTGCCGCTTTGGGCGG + Intergenic
1094842039 12:34346272-34346294 AGCCTCCCTGCAGCTTTGGGCGG + Intergenic
1094842095 12:34346462-34346484 AGCCTCCCTGCCTCTTTAGGCGG + Intergenic
1094842147 12:34346651-34346673 AGCCTCCCTGACGCTTTGGGCGG + Intergenic
1094842491 12:34347959-34347981 AGTCTCCCTGCCTCTTTGGGAGG + Intergenic
1094842700 12:34348722-34348744 AACCTCCCTGCCCCTTTGGGCGG + Intergenic
1094842811 12:34349099-34349121 AGCCTCCCTGCCTCTTTGGGCGG + Intergenic
1094842865 12:34349288-34349310 AGCATCCCTGTCCCTTTGGGCGG + Intergenic
1094842917 12:34349484-34349506 AGCCTCCCTGCCTCTTTGGGCGG + Intergenic
1094843068 12:34350032-34350054 AGCCTTCCTGCCACTTTGGGCGG + Intergenic
1094843123 12:34350221-34350243 AGACACCCTGCCTATTCGGGCGG + Intergenic
1094843220 12:34350583-34350605 AGCCTCCCTGCCGCTTTGAGCGG + Intergenic
1094843490 12:34351615-34351637 AGCCTCCCTGCCTCTTTGGGCGG + Intergenic
1094848534 12:34372113-34372135 AGACTTCCTGCCTCCTTGGACGG + Intergenic
1096258577 12:50077335-50077357 CGAGTACCTGCCTGTGTGGGGGG + Exonic
1096793762 12:54061247-54061269 TGAGGCTCTGCCCCTTTGGGTGG + Intergenic
1097284651 12:57868117-57868139 AGCATGCCTGCCCCTTTGGGAGG + Intergenic
1101757978 12:107636049-107636071 ACAGTGCCTGCCTCTTGGGGTGG - Intronic
1101759832 12:107649436-107649458 AGAAGCCCTTCCTGTTTGGGAGG - Intronic
1101768038 12:107721444-107721466 TGAGATCCTGTCTCTTTGGGAGG - Intergenic
1102214234 12:111148983-111149005 CGAGACCCTGCCTCTAAGGGTGG + Intronic
1102407982 12:112690698-112690720 AGGGTTCCTGCCTCTTGGGGAGG + Intronic
1102431592 12:112888296-112888318 ACAGTACCTGCCTCTTGGGAGGG + Intronic
1103524716 12:121560124-121560146 ATAGTCCCAACCTCCTTGGGAGG - Intronic
1104018988 12:124979245-124979267 ACAGTCCCAGGCTCTTTGGGAGG + Intronic
1104118190 12:125771139-125771161 AGAGTACCTGGTTCATTGGGTGG - Intergenic
1104185217 12:126423940-126423962 ACAGTCCCTGCCTCTCAGGCAGG - Intergenic
1104686460 12:130788083-130788105 GGAGGCCCTGCCTCCTTGGGTGG - Intergenic
1104892630 12:132147821-132147843 CCAGTCCCTGCCTCCCTGGGAGG - Intronic
1106201719 13:27543586-27543608 ATAATCCCAGCCACTTTGGGAGG - Intergenic
1106584805 13:31047720-31047742 AAATTGCCTGCCTCTTTTGGGGG + Intergenic
1109330116 13:60918723-60918745 AGTGTCTCTGCCTCTGTGGCAGG + Intergenic
1109538281 13:63742084-63742106 TGAGTCCCTGCCTCTCGGGGGGG + Intergenic
1109545557 13:63837688-63837710 TGAGTCCCTGCCTCTCGGGGGGG - Intergenic
1109737791 13:66509348-66509370 AGGGTCCCAGTCTCTGTGGGAGG + Intronic
1110656714 13:78008485-78008507 AGAGTCCCAGCCTGTGTGGTGGG - Intergenic
1112618762 13:101034018-101034040 AGAGACCCTGTTTGTTTGGGAGG - Intergenic
1113897459 13:113775424-113775446 AGGGTCTCCGCCCCTTTGGGTGG + Intronic
1116793686 14:49366614-49366636 ATAGTCCCAGGCTCTGTGGGAGG + Intergenic
1117034396 14:51713199-51713221 ATAATCCCAGCCACTTTGGGAGG + Intronic
1118210690 14:63763420-63763442 AGAGTCTCTGCCTGGTTTGGTGG + Intergenic
1119889854 14:78174604-78174626 AGGCTGCCTGCCTCTTTGTGTGG + Intergenic
1121425076 14:93844846-93844868 AGAATCTCTGGCACTTTGGGAGG + Intergenic
1122366248 14:101196483-101196505 AGTGTGCCTGCCTTTATGGGTGG - Intergenic
1122978763 14:105181713-105181735 ACAGTCCCTCCCTCCCTGGGGGG - Intergenic
1125047985 15:35264853-35264875 AGAGTGCCTAACTCTTTTGGGGG + Intronic
1125748261 15:42011988-42012010 AAAGTCCCTGGCCCTTTGGTTGG + Intronic
1128815790 15:70607138-70607160 AGAGTCTCTGGCTCTGTGAGTGG + Intergenic
1129658892 15:77542186-77542208 ACAGTCCCTGGCTCTTTGCCTGG - Intergenic
1129893221 15:79085682-79085704 AGAGTCCCAGGCTCTTCAGGAGG + Intronic
1132563770 16:611164-611186 AGAGGCCCCGGCTCTGTGGGTGG + Intronic
1132700969 16:1221991-1222013 AGACTCCCGGCCTGTTGGGGCGG + Exonic
1133434145 16:5764838-5764860 AGAGTGCCTGCTTCTGTGGCTGG - Intergenic
1133476997 16:6133438-6133460 ACATTCCCTGCCTCTTGGGATGG + Intronic
1133834040 16:9350875-9350897 AGAGACCCTGTTTGTTTGGGGGG - Intergenic
1136160923 16:28418084-28418106 AGAATCCCAGCCTCTGTGCGGGG + Intergenic
1136202043 16:28696917-28696939 AGAATCCCAGCCTCTGTGCGGGG - Intronic
1136218384 16:28811096-28811118 AGAATCCCAGCCTCTGTGCGGGG - Intergenic
1138048588 16:53752261-53752283 ACAGTGGCTACCTCTTTGGGAGG + Intronic
1140749592 16:78011094-78011116 AGTGTCCCTTCCTCTTGGGAAGG + Intergenic
1141428202 16:83957110-83957132 TGAGTCCCTACCTCCTAGGGTGG - Intronic
1142191631 16:88720813-88720835 AGAATGCCAGCCTCTTAGGGTGG - Intronic
1142233672 16:88911400-88911422 AGATGCAGTGCCTCTTTGGGTGG + Intronic
1142689136 17:1594368-1594390 AGAACCTGTGCCTCTTTGGGAGG - Intronic
1143637957 17:8177116-8177138 ACAGTCCCTGCGTCTCTGGGAGG + Intergenic
1144263315 17:13544544-13544566 ACAGCCCCAGCCTCTTTGTGTGG + Intronic
1144423993 17:15123916-15123938 ACAATTCCTGCCTCTATGGGTGG + Intergenic
1145235607 17:21206030-21206052 TGAGTCCCTGCTTTTTTTGGGGG + Intronic
1145263063 17:21366157-21366179 ACACCCCCTGCCTCTTAGGGAGG - Intergenic
1147741946 17:42675003-42675025 AGAGACCCTGCCCCTTTGCTGGG + Intronic
1147861654 17:43527529-43527551 AGTCTCCCTGCCCCTGTGGGCGG - Intronic
1148499234 17:48076869-48076891 AGAATCCCTTCCACTTTAGGAGG + Exonic
1148877067 17:50695190-50695212 TGAGACCCTGTCTCTATGGGCGG + Exonic
1150205937 17:63407413-63407435 AGAGTTCCTGCCTCTTTCAGTGG - Intronic
1150300964 17:64046624-64046646 TGTGTCCCTGCCTCCTAGGGAGG - Intronic
1150615095 17:66764331-66764353 GGAGTCCCATCCTCTCTGGGAGG + Intronic
1151725457 17:75881284-75881306 AGGGACCCAGCCTCTTGGGGAGG + Intronic
1152078162 17:78171121-78171143 AGGGTCTCGGCCTCTCTGGGAGG + Intronic
1152640899 17:81448797-81448819 AGAGTCCCTGCTTCTGGGTGGGG + Intronic
1152723109 17:81932497-81932519 GGAGGCCCTGCCTGTGTGGGAGG - Intronic
1152784886 17:82242381-82242403 AGAGTCCCTGCCTTCTCGGGCGG - Intronic
1153908141 18:9682110-9682132 AGAGCCTCTGACTTTTTGGGTGG + Intergenic
1157215871 18:45782992-45783014 AGAGTCCCACCCTCTTCTGGAGG + Intergenic
1157564333 18:48669439-48669461 ACAGTTCCTCCCTCTCTGGGTGG - Intronic
1158521833 18:58177490-58177512 CGAGTCCCTTCCTCCTGGGGTGG - Intronic
1160233721 18:77068885-77068907 ACACTCTCAGCCTCTTTGGGAGG + Intronic
1161835055 19:6640273-6640295 AGAGTCCCTTCATCTTCAGGTGG - Intergenic
1161914433 19:7218053-7218075 AGAGTCCCTGCCTTGTGGCGGGG + Intronic
1163619364 19:18349017-18349039 ATAATCCCAGCTTCTTTGGGAGG - Intronic
1164877995 19:31706256-31706278 GGAGTCCCTGCATCCCTGGGAGG + Intergenic
1165393757 19:35552892-35552914 AGACTCCCTGCCAGTTCGGGGGG - Intronic
1165701701 19:37943128-37943150 AGAATCCCAGCAACTTTGGGAGG - Intronic
1167649837 19:50723278-50723300 GGAGGCCCTGCCTCTGTGGCCGG - Intergenic
926538760 2:14148090-14148112 AGAGTCTCTCCCACTTTGGAGGG - Intergenic
927234716 2:20860467-20860489 AAAGTCCCTGTCTTTTTGAGGGG - Intergenic
929844998 2:45515621-45515643 AGAGTCACTGCCTCCTTAGGAGG - Intronic
930590860 2:53324163-53324185 AGAGCTGCTGCCCCTTTGGGAGG - Intergenic
934547576 2:95231373-95231395 AGAGTCACTGCTACTTTGAGGGG + Intronic
937977532 2:127590733-127590755 GGAGTCCCTGCTCCATTGGGTGG + Intronic
938226985 2:129624839-129624861 AGTGTTCCCGCCTCTTGGGGAGG + Intergenic
940225125 2:151393253-151393275 ATAATCCCGGCCACTTTGGGAGG + Intergenic
941676290 2:168346453-168346475 AGAGAACCTGTCTCTTGGGGTGG + Intergenic
943277854 2:185891115-185891137 TGAGACCCTGTCTCTATGGGGGG - Intergenic
943330218 2:186550060-186550082 ACAGTCCCAGCTGCTTTGGGAGG - Intergenic
946684494 2:222253909-222253931 ATATTCCCAGCCACTTTGGGAGG - Intronic
948086694 2:235256454-235256476 ATAGTCCCAGCTACTTTGGGAGG - Intergenic
948579542 2:238975063-238975085 AGGGGCCCTGCCTCTGTGAGGGG - Intergenic
948725983 2:239934285-239934307 AGAGTCACTGCCATGTTGGGAGG + Intronic
948904172 2:240970355-240970377 AGAGTCTCTGCCTCTTCTGGGGG + Intronic
1168990965 20:2095403-2095425 TGAGTCCCTGCCTCGTTATGGGG + Intergenic
1170567739 20:17616311-17616333 ACAGGCCCTGCCTCTTGGTGAGG + Intronic
1172600029 20:36177181-36177203 AGAGTCCCTGCCTCTTTGGGTGG + Intronic
1172629744 20:36370045-36370067 GGAGTCCCTGGCCCTTTGCGGGG - Intronic
1174381143 20:50156075-50156097 AGAATCCCTGCTTTCTTGGGAGG + Intergenic
1175173120 20:57093484-57093506 ACAGTGCCTGCCTCATAGGGTGG - Intergenic
1175478800 20:59296850-59296872 AGAGTTCCTGCTGCTGTGGGTGG + Intergenic
1176361480 21:6000356-6000378 AGAATACCTGCATCTTTGGGTGG + Intergenic
1179206416 21:39284464-39284486 AGAGAACCTGCCTCTGGGGGAGG + Intronic
1179328153 21:40370876-40370898 ACACTCCCTGGCACTTTGGGAGG - Intronic
1179762038 21:43538194-43538216 AGAATACCTGCATCTTTGGGTGG - Intronic
1181899415 22:26140492-26140514 ACAGTCCTGGCCACTTTGGGAGG + Intergenic
1182429525 22:30291662-30291684 GGAGTCCCTGCCCCCTTGGTGGG + Intronic
1182978153 22:34642682-34642704 ATCTTCCCTGCCACTTTGGGAGG + Intergenic
1183617992 22:38956650-38956672 AGTGTCCCTGCCATTTTGGTGGG - Intronic
1184417974 22:44363257-44363279 AGAGACTCGGCCTCGTTGGGTGG + Intergenic
1184656888 22:45946391-45946413 AAACTCCCTGCCTTGTTGGGGGG + Intronic
949575765 3:5337977-5337999 ATAGTACCTGCCTTTTAGGGTGG + Intergenic
950484448 3:13264758-13264780 ACAGTCTCTGCCTCTCTCGGGGG + Intergenic
950867060 3:16197517-16197539 ATAAGCCCTGCCTCTCTGGGTGG - Intronic
953547631 3:43875364-43875386 GGAGTGCCTGCCTCTTGGGCTGG - Intergenic
953649811 3:44792218-44792240 GTAATCCCAGCCTCTTTGGGAGG + Intronic
956918211 3:73896996-73897018 AGTATCCTTGGCTCTTTGGGTGG + Intergenic
959943501 3:112104114-112104136 AGAGTCCATGACTGATTGGGTGG + Intronic
959991442 3:112636704-112636726 AGAGTGTCTGTCTCTTTTGGTGG + Intronic
960942049 3:122941322-122941344 AGTGTCCCTCCATCTTTGTGTGG + Intronic
961424703 3:126835828-126835850 AGAATCCCTGCCTGTGAGGGAGG - Intronic
961576460 3:127840834-127840856 GGAGGTCCTGCCTCTCTGGGGGG + Intergenic
963678175 3:148340496-148340518 ATAATACCTGCCTCTTAGGGTGG - Intergenic
964323158 3:155518826-155518848 GAAGTCTCTGCCTCTTTGTGAGG - Intronic
968185700 3:196632485-196632507 AGGGCCTCTGCCTCTTCGGGGGG + Intergenic
968775132 4:2535989-2536011 AGAATCCCTGCCTCGTGGGCTGG - Intronic
969302550 4:6305704-6305726 AGAGCCCCTGCCCCACTGGGAGG + Intergenic
970202843 4:13627389-13627411 AGAGCCCCTGGCTCTTGAGGTGG + Exonic
970445954 4:16123533-16123555 AGAGCACCTGCCTCTCTGAGGGG + Intergenic
971383962 4:26126235-26126257 GTAGTCCCTGCCTCTTATGGAGG + Intergenic
976225165 4:82790094-82790116 AGTGTCCCTGACTCTTTAGTGGG - Intronic
977904216 4:102456927-102456949 AGAGTGCCTGTGCCTTTGGGTGG - Intergenic
978385538 4:108172725-108172747 TGCGTCCCTGCCTCGCTGGGTGG + Intergenic
978528636 4:109692384-109692406 AGAGCACCTGCCTCATGGGGTGG - Intronic
985726668 5:1519870-1519892 AGAGTGCCTGTCCCTTGGGGAGG - Intronic
987258948 5:16184346-16184368 AGGGTCCCTGCCTCTTTCTTGGG + Intergenic
995455684 5:112349340-112349362 AGAGGCCCTGCCTCTTTCCAAGG - Intronic
997028726 5:130097446-130097468 AGAGTCCCAGCCTCTCCTGGAGG - Intronic
998430060 5:142062952-142062974 ATAGTCCCAGCTACTTTGGGAGG + Intergenic
999508409 5:152222363-152222385 AGAGGCCCAGACTCTTAGGGAGG + Intergenic
999796717 5:154995720-154995742 AGAGTCCCTGCCCTGTTTGGTGG - Intergenic
1000512952 5:162206298-162206320 AGAGGCCCTGCCTCTAAGGGAGG + Intergenic
1001940394 5:175735972-175735994 AGGGTCCCAGCCTCTCAGGGTGG + Intergenic
1002545902 5:179945018-179945040 ATAATCCCAGCCACTTTGGGAGG + Intronic
1002990220 6:2231435-2231457 TGAGTACCTGCGACTTTGGGTGG - Intronic
1003082483 6:3032621-3032643 TGAGACCCATCCTCTTTGGGTGG - Intergenic
1007308211 6:40923593-40923615 GGAGGCCCTGCCTCTAGGGGAGG - Intergenic
1007655733 6:43450062-43450084 GGAGTCCCTGCCTCACTCGGAGG + Exonic
1007885806 6:45228758-45228780 GTAGTCCCAGCTTCTTTGGGAGG - Intronic
1010253352 6:73731284-73731306 ATAATCCCAGCATCTTTGGGAGG - Intronic
1012451393 6:99355986-99356008 ATAGTCCCAGCCACTTGGGGTGG - Intergenic
1012998221 6:105994239-105994261 AGAGCCCGGGCCTCTTTAGGCGG - Intergenic
1015785950 6:136921961-136921983 AGAGCCGCTGGCTCTGTGGGGGG + Intergenic
1017700332 6:157063333-157063355 AGAGCACCTGCCTCTTAAGGTGG - Intronic
1018990918 6:168673109-168673131 AGAAACCCTGCATCTCTGGGAGG + Intronic
1019367438 7:642023-642045 GGAGTCCCAGCCACTTGGGGAGG - Intronic
1019388674 7:773293-773315 AGCGTCCCTTCCTCTTCTGGAGG - Intronic
1022209612 7:28195666-28195688 ACGGTACCTGCCTCTGTGGGAGG - Intergenic
1023558694 7:41449887-41449909 AGGGTCCCTCCCACTGTGGGAGG - Intergenic
1025664137 7:63573169-63573191 AGAGGCCCTGCTGCTCTGGGAGG - Intergenic
1026446207 7:70487054-70487076 ACAGCCCCTCCCTATTTGGGAGG + Intronic
1028350257 7:89838304-89838326 AGAATTCATGCCTCTTTGTGAGG - Intergenic
1028893656 7:96016374-96016396 CTAGTCCATGACTCTTTGGGTGG + Intronic
1030309570 7:108055744-108055766 AGAGACCCTGCCTGTCTGTGAGG - Exonic
1031030849 7:116733130-116733152 AGAGTGCATGTCTCTGTGGGAGG - Intronic
1031589339 7:123570418-123570440 ACAGTCCCTGCCACTCTCGGTGG - Intronic
1032509429 7:132460235-132460257 GGAGTCCCAGCTACTTTGGGAGG + Intronic
1032680298 7:134175766-134175788 AGAAGCCATGCCTCTTTGAGGGG - Intronic
1035569350 8:661925-661947 AGAATCCCTGCCACTGCGGGGGG - Intronic
1035758411 8:2051323-2051345 AGAATCCCTGCCTCTGGGGCTGG + Intronic
1040560377 8:48518330-48518352 AAAGTACCTGCCTCATTTGGTGG + Intergenic
1041288883 8:56289208-56289230 GAAGTTCCTCCCTCTTTGGGAGG - Intergenic
1042010045 8:64233862-64233884 ACAATACCTGCCTCTTTGGAGGG + Intergenic
1045063487 8:98427040-98427062 CGGGTTCCTGCCTCTCTGGGTGG + Exonic
1045476209 8:102555108-102555130 ACACTGCCTGCCTCTTGGGGAGG - Intronic
1046053270 8:109048642-109048664 ACAGTCTATGCCTTTTTGGGGGG - Intergenic
1047966230 8:130048863-130048885 AGAGGCCAGGCCTCTGTGGGAGG + Intergenic
1048390398 8:133958231-133958253 AGAGTCCCTGATGATTTGGGGGG + Intergenic
1049069093 8:140343473-140343495 CGCGGCCCTGCCTCTGTGGGTGG - Intronic
1049625990 8:143621538-143621560 ACAATCCCAGCATCTTTGGGAGG + Intergenic
1050821947 9:9890018-9890040 GAAATCCATGCCTCTTTGGGAGG - Intronic
1052880259 9:33597484-33597506 AGAGTCTCTGCCTCTGCAGGAGG + Intergenic
1053255361 9:36612636-36612658 GTAATCCCAGCCTCTTTGGGAGG - Intronic
1053545057 9:39014217-39014239 ACAGTCCCTAGCACTTTGGGAGG - Intergenic
1053809457 9:41837410-41837432 ACAGTCCCTAGCACTTTGGGAGG - Intergenic
1054621135 9:67350018-67350040 ACAGTCCCTAGCACTTTGGGAGG + Intergenic
1055281749 9:74682182-74682204 ACAGTCCCTGCCTCAGAGGGAGG - Intronic
1056388158 9:86116398-86116420 TGAGTCACTGCCATTTTGGGTGG + Intergenic
1057413412 9:94839342-94839364 ATAATCCCAGCCACTTTGGGAGG - Intronic
1058360599 9:104142248-104142270 AGAGTCCCAGTCTCTGTGGGAGG - Intergenic
1061136506 9:128737238-128737260 AGAATCCCAGCCACTTTGGGAGG - Intronic
1061247262 9:129406949-129406971 ATAGTGCCTACCTCTTAGGGTGG + Intergenic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1187031419 X:15492389-15492411 AAAGTCTTTTCCTCTTTGGGAGG + Intronic
1187197328 X:17100182-17100204 AGAATCCCTTCCACTTTAGGAGG + Intronic
1187473675 X:19590762-19590784 ATAGTCCCAGCTACTTTGGGAGG - Intronic
1188161116 X:26804404-26804426 AGAGACCCTGATTGTTTGGGTGG + Intergenic
1188483118 X:30653881-30653903 AGAGTCCCTGCTCCCTTTGGGGG - Intronic
1191628852 X:63299537-63299559 AGAATCCCTTCCACTTTAGGAGG + Intergenic
1192177259 X:68893906-68893928 AAAGTCCCTCTCTCTCTGGGGGG + Intergenic
1195177663 X:102326633-102326655 AGAGCAACTGGCTCTTTGGGTGG - Exonic
1195181201 X:102360460-102360482 AGAGCAACTGGCTCTTTGGGTGG + Exonic
1196689746 X:118546731-118546753 GTAGTCCCTCCTTCTTTGGGAGG + Intronic
1198145074 X:133847740-133847762 AGAGTGCCTGACTTGTTGGGTGG + Intronic
1200008685 X:153105414-153105436 ATAGTCCCTGTCTCTGTTGGTGG - Intergenic
1200031224 X:153297447-153297469 ATAGTCCCTGTCTCTGTTGGTGG + Intergenic
1201012000 Y:9556756-9556778 AGATTCCCTGTCTTTTTGGGGGG + Intergenic