ID: 1172600843

View in Genome Browser
Species Human (GRCh38)
Location 20:36181868-36181890
Sequence CTGCTTGGAAGTGGCAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 353}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172600843_1172600851 5 Left 1172600843 20:36181868-36181890 CCAGCATTGCCACTTCCAAGCAG 0: 1
1: 0
2: 3
3: 37
4: 353
Right 1172600851 20:36181896-36181918 CCTTGGGCTAATTTACTGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 84
1172600843_1172600852 6 Left 1172600843 20:36181868-36181890 CCAGCATTGCCACTTCCAAGCAG 0: 1
1: 0
2: 3
3: 37
4: 353
Right 1172600852 20:36181897-36181919 CTTGGGCTAATTTACTGCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172600843 Original CRISPR CTGCTTGGAAGTGGCAATGC TGG (reversed) Intronic
900266148 1:1758215-1758237 CTGCTGGGAAGAGGCATGGCAGG - Intronic
900900236 1:5511001-5511023 CTGCTTGGCAGTAGCCATGCAGG + Intergenic
901066142 1:6495536-6495558 CTGCTAGGAAGTGGGAGAGCTGG - Intronic
901635926 1:10670105-10670127 CTGCCTGGCAGTGGGAAGGCAGG - Intronic
901750499 1:11404187-11404209 CAGCTGGGAAGTGGAAATGCAGG - Intergenic
902244830 1:15113977-15113999 CAGCTGGGAAGTGGCAGAGCAGG + Intronic
902700475 1:18168811-18168833 CAGCTTGTAAGTGACAAAGCTGG + Intronic
902711764 1:18244909-18244931 CAGCTTCTAAGTGGCAATGCTGG - Intronic
902782798 1:18715629-18715651 CAGGTAGGAAGTGACAATGCTGG - Intronic
902802450 1:18838846-18838868 CAGTTTGGAAGTGGCACTACTGG + Intergenic
903143522 1:21355042-21355064 CAGCCTGTAAGTGGCAATGAAGG + Intergenic
903221417 1:21871600-21871622 CAGCTGGGAGGTGGGAATGCCGG - Intronic
903372320 1:22844645-22844667 CAGCTAGGAAGTGGTGATGCCGG + Intronic
903376793 1:22871450-22871472 CAGCTTGGAAGGGGCCATGTGGG - Intronic
903461267 1:23522495-23522517 CAGCTAGAAAGTGGCAAAGCTGG + Intronic
904412103 1:30330722-30330744 CAGTTAGGAAGTGGCAAGGCTGG + Intergenic
905254864 1:36673941-36673963 CAGCTGGCAAGTGCCAATGCTGG - Intergenic
905472830 1:38206429-38206451 CTGCTAAGAAGTGGCAGAGCTGG + Intergenic
907451783 1:54550111-54550133 CTGGTAGGAAGTGGCAGAGCTGG + Intronic
907710916 1:56880511-56880533 CAGCTAGTAAGTGGCAAAGCTGG + Intronic
908085538 1:60628517-60628539 ATAATTGGAAGTGGAAATGCTGG + Intergenic
908783193 1:67710529-67710551 CTGCTTGCCAATGGCCATGCCGG - Intronic
909189771 1:72537923-72537945 CTGCTTGGATGTGCCATGGCAGG + Intergenic
909554021 1:76932691-76932713 CAGCTTGGAAGTGGGGCTGCAGG - Intronic
909902828 1:81159729-81159751 GTGATTTGAAGTGGCAAAGCTGG - Intergenic
910851058 1:91650350-91650372 CAGCTAGGAAGTGGCAATGCCGG + Intergenic
911699645 1:100937286-100937308 TTACTTGGAAGTGGAATTGCTGG + Intronic
912321278 1:108715968-108715990 TTGCTTGGAAGTCATAATGCAGG - Intronic
912489411 1:110053675-110053697 CTGCCTGGAAGTCCCAAGGCCGG - Exonic
915445499 1:155972322-155972344 CTGCTGGGCAGTGCCCATGCTGG - Intronic
916578478 1:166087667-166087689 CAGCTTGTAAGTGGCAGAGCTGG + Intronic
917436987 1:175031862-175031884 CTGCTTGGAAGTGGTCAGCCAGG - Intergenic
917771598 1:178285418-178285440 CCTCTTGGAAGTAGCAATGCCGG - Intronic
918416232 1:184311119-184311141 CTGCTTTGCTGTGGCCATGCTGG + Intergenic
920053538 1:203177504-203177526 CTGCTGGGGAGTGGCAGTGCAGG + Intergenic
922665420 1:227464907-227464929 CTGCTTGGGGCTGGCAATGGGGG - Intergenic
924246978 1:242094867-242094889 CAGCTTGTAAGTGTCAGTGCTGG + Intronic
1062970613 10:1645417-1645439 CTGCTAGGCAATGGCACTGCAGG - Intronic
1065427121 10:25617161-25617183 CTGCTTGCAACTAGGAATGCAGG - Intergenic
1067067985 10:43114350-43114372 CAGCTGGGAAGTGGCCATGGAGG - Intronic
1067569620 10:47361775-47361797 CTGCCTGTAAGTGGCAATGGTGG - Intergenic
1068679465 10:59803913-59803935 CAGCCAGGAAGTGGCAAGGCAGG - Intronic
1068796867 10:61093033-61093055 CAGCTAGGAAGTGGCAGAGCTGG - Intergenic
1069295600 10:66840298-66840320 CTTCTTGGAAGAAGAAATGCAGG - Intronic
1070522944 10:77270133-77270155 CTTCCTGCCAGTGGCAATGCAGG + Intronic
1071033374 10:81212343-81212365 ATATTTGGAAGTGGCATTGCTGG - Intergenic
1071495730 10:86166599-86166621 CAGCTGGGAAGTGGCAAAGTAGG + Intronic
1071735885 10:88300108-88300130 CTGCTAGGAAGTGGCAAAGCTGG - Intronic
1072782664 10:98261074-98261096 CTGCTTGGCACTGGCAAGGATGG + Exonic
1073495445 10:103886851-103886873 CAGCTAGCAAGTGGCAAAGCCGG + Intronic
1074105527 10:110386907-110386929 ATACTTGGAAGTGGAATTGCTGG + Intergenic
1075598890 10:123752825-123752847 CTGCTCAGAAGTGGCCAGGCAGG + Intronic
1076539941 10:131207472-131207494 TTCCCTTGAAGTGGCAATGCCGG + Intronic
1076734597 10:132452989-132453011 CTGCTGGGAAGTGGCCACGCAGG - Intergenic
1077918935 11:6629098-6629120 CAGCTTGGAAGTGGCAGGGCTGG - Intronic
1078553458 11:12297063-12297085 ATTCTTAGAAGTGGAAATGCTGG + Intronic
1078694763 11:13620211-13620233 CAGCTTGGCAGTGGCATGGCAGG + Intergenic
1079236933 11:18697821-18697843 CAGCATGGAAGTGGCAAAACTGG + Intronic
1079797974 11:24830692-24830714 CTGCTTGTAAGAAGCAAGGCTGG + Intronic
1080314009 11:30927553-30927575 CAGCTAGTTAGTGGCAATGCTGG + Intronic
1080320758 11:31006526-31006548 CTGCTAGTAAGTGGCAGAGCAGG - Intronic
1080658221 11:34274850-34274872 CTGGCTGGAAGTGGAAAAGCAGG - Intronic
1080773939 11:35368315-35368337 CAGCTAGGAAGTGGTAAAGCAGG - Intronic
1083430115 11:62609921-62609943 AAGCTTGGAAGAGGCAGTGCAGG + Intronic
1085187355 11:74587713-74587735 CTGCTAGTAAGTGGTAAAGCTGG + Intronic
1085321306 11:75575712-75575734 CTGCTAGGAAGTGGCAGAGCTGG - Intergenic
1085390637 11:76180380-76180402 CAGCTTGGAAGGGGCAGTGCAGG + Intergenic
1086996313 11:93360182-93360204 CTGATTGGAAGTGGGAGTTCAGG - Intronic
1087105394 11:94402315-94402337 CAGCTAGGAAGTGACAAAGCTGG - Intergenic
1087161243 11:94950001-94950023 CTCATTGGAAGTGTCCATGCAGG + Intergenic
1087992123 11:104758109-104758131 CTTTTGGGATGTGGCAATGCAGG - Intergenic
1088085527 11:105974369-105974391 CGGCTTGGGCTTGGCAATGCTGG + Exonic
1088327182 11:108612964-108612986 CTGCCAGTAAGTGGCAAAGCTGG + Intergenic
1089275810 11:117335319-117335341 CTGCTTGGAGGTGGCATGGTGGG + Intronic
1089459214 11:118642832-118642854 CTGCTTCCAAGTGTCACTGCTGG - Intronic
1089820317 11:121219933-121219955 GTGCTTGGAAGAGGCAAGGTAGG - Intergenic
1090225633 11:125070670-125070692 CTGCTTGGAAAAGGAAATGAGGG + Intronic
1090262227 11:125330051-125330073 CTGCCTGGAAGCAGCAGTGCAGG + Intronic
1091109502 11:132952682-132952704 CTGCTTGGAAGTAGCAGAGCTGG - Intronic
1092178805 12:6430373-6430395 GTGATTGGCAGAGGCAATGCAGG + Intergenic
1092203218 12:6600123-6600145 CTGGATGGAAATGGAAATGCTGG - Intronic
1092846118 12:12586775-12586797 CTGCTTGGAAATGCCAATTAGGG + Intergenic
1093155919 12:15685028-15685050 CTGCTTGAAATTGGCCATGGTGG - Intronic
1093690894 12:22107533-22107555 CTGCCTGGAAATAGAAATGCAGG + Intronic
1094545535 12:31401278-31401300 CAGCTTAGAAATGGCAATGATGG + Intronic
1096453492 12:51765955-51765977 CTGCATGGAAGTGGCAGGCCAGG + Exonic
1098566035 12:71937222-71937244 CTGCTTGGATGTGGAAATGAGGG - Intergenic
1099042753 12:77676369-77676391 CTGCCTGGAAGAGGCCATGGAGG - Intergenic
1101013143 12:100471976-100471998 CAGCTTGTAAGTGGCAGAGCTGG + Intergenic
1101522145 12:105493878-105493900 CTGCTAGTAAGTGGCAAAGCTGG - Intergenic
1102005229 12:109585482-109585504 CAGCTAGTAAGAGGCAATGCAGG + Intronic
1102143719 12:110638117-110638139 CAGCTGGGAAGTGGCAGAGCTGG + Intronic
1102432608 12:112895528-112895550 CTGCTTGAAATTGGGAAGGCTGG - Intronic
1102548933 12:113676876-113676898 CAGCTAGTAAGTGGCAGTGCTGG - Intergenic
1102686074 12:114725702-114725724 TTGCTTGTAAGTGGTAAGGCTGG + Intergenic
1102797269 12:115699601-115699623 CAGCTTGGAAGTGACAGAGCTGG - Intergenic
1103736340 12:123063280-123063302 CGGCTGGGCAGTGGCAGTGCTGG - Intronic
1103945483 12:124523843-124523865 GGGCTGGGAAGTGGCAATGTCGG + Intronic
1103953222 12:124563171-124563193 CTGCTTGTAAATGGCCAAGCTGG + Intronic
1104369269 12:128208608-128208630 CAGCTGGGAAGTGGCACAGCAGG + Intergenic
1104810943 12:131620129-131620151 CTGCTTGAAAGTGGGAGAGCTGG - Intergenic
1104926736 12:132317756-132317778 CTGGTTGGAAGGGACAAGGCTGG - Intronic
1105594053 13:21819103-21819125 CTGCTTGGAACTGGAAATGCAGG - Intergenic
1106548402 13:30750540-30750562 CAGCTAGGGAGTGGCAAAGCCGG - Intronic
1106672280 13:31918919-31918941 CGTCCTGGAAGTGGCAATGTTGG - Intergenic
1107860734 13:44658592-44658614 ATTCTTAGAAGTGGCAGTGCTGG + Intergenic
1108041683 13:46345258-46345280 CTGCTGGTAAGTGGCAGAGCCGG - Intronic
1108312518 13:49209952-49209974 CTTCCTGGTAGTGGCACTGCTGG + Intergenic
1109004920 13:56861035-56861057 CTGCTTTGAAGGGGCCAAGCTGG + Intergenic
1111034662 13:82656705-82656727 CTTCTGGGAAGTAGCAATGAAGG + Intergenic
1112353105 13:98653169-98653191 CAGCTAGGAAGTGGCAGAGCTGG + Intergenic
1112383910 13:98919986-98920008 TTCCTTGAAAGTGGCAAGGCTGG + Intronic
1112566253 13:100553265-100553287 CTGCCTGGGAGTGGAATTGCCGG - Intronic
1113132829 13:107057174-107057196 CTGTTTGGAAGTTGCAGTGCTGG - Intergenic
1115161580 14:30402425-30402447 CTGCTAGCAGGTGGCAAGGCTGG - Intergenic
1115289487 14:31753550-31753572 CCCCATGGATGTGGCAATGCAGG + Intronic
1115415349 14:33126227-33126249 CTACTTGCAAGTGGCAATAGAGG + Intronic
1118734517 14:68691857-68691879 TAGCTTGGAAGTGTTAATGCAGG - Intronic
1119824481 14:77645736-77645758 CTTCTGAGAAGTGGCACTGCGGG + Intergenic
1120443961 14:84569986-84570008 ATGCTTTGAAGTGGAAATGCTGG + Intergenic
1120763595 14:88308034-88308056 CAGCTTGGGAGTGGCAGAGCTGG + Intronic
1121459026 14:94059395-94059417 CTGCCTGGAAGTGGTAGAGCTGG - Intronic
1121685936 14:95835124-95835146 CAGCTGGGAAGTGGCACAGCAGG + Intergenic
1122548461 14:102537778-102537800 CAGCCTGGAAGTGGCAGAGCTGG - Intergenic
1124054255 15:26227136-26227158 ATGCTTGCAGGTGGCAGTGCAGG + Intergenic
1124391023 15:29257516-29257538 ATTCTTAGAAGTGGCATTGCTGG + Intronic
1127866486 15:63037381-63037403 CAGCTGGGAGGTGGCAGTGCAGG - Intergenic
1129432093 15:75506712-75506734 CTGCTTGGACATAGCCATGCTGG + Intronic
1129544553 15:76381465-76381487 CTCCTTGGGACTGGCAGTGCTGG + Exonic
1129593867 15:76943530-76943552 CAGCTAGTAAGTGGCATTGCTGG + Intronic
1129830692 15:78668017-78668039 CTGTCTGGAGGAGGCAATGCTGG - Intronic
1130313469 15:82774536-82774558 CTGCTAGGAAGTGGCAGAGTTGG + Intronic
1131077376 15:89503836-89503858 CAGCTAGGAAGTGGCAGGGCTGG - Intergenic
1131185783 15:90272812-90272834 CTGCCAGTAAGTGGCAGTGCTGG + Exonic
1131314468 15:91321263-91321285 CTGCTTGGAAGTGACTATAAGGG + Intergenic
1132332870 15:101024846-101024868 CTGGTTGACAGTGGCCATGCTGG - Exonic
1132359354 15:101199720-101199742 AAACCTGGAAGTGGCAATGCTGG + Intronic
1133211918 16:4268031-4268053 CAGCTAGTAAGTGGCAAGGCTGG - Intronic
1133398950 16:5470714-5470736 CTGCTTGTAAGTGGCAGAGCTGG + Intergenic
1134337228 16:13311765-13311787 ACGCTTGGAAGTGGAAATTCAGG - Intergenic
1135110276 16:19685539-19685561 CTGCGTGGAGGTGGCGTTGCTGG + Intronic
1136011742 16:27367989-27368011 CAGCTTGGAATTGGAAAGGCTGG - Intergenic
1136109909 16:28058203-28058225 CAGCTAGTAAGTGGCAAAGCTGG - Intronic
1137842308 16:51651593-51651615 CAGCTAGTAAATGGCAATGCTGG - Intergenic
1138431367 16:56971233-56971255 CTGCGTGGTGGTGGCAGTGCTGG - Intronic
1139916501 16:70431446-70431468 CTCCTGGGAGGTGGCATTGCGGG - Intronic
1139967547 16:70754153-70754175 CTGCAAGGAGGTGGCAAGGCTGG + Intronic
1140125768 16:72117546-72117568 CTGAATAGAAGTGGCAAAGCAGG + Intronic
1140475038 16:75235551-75235573 CTCCTTGGAGGTGGCAGGGCCGG - Exonic
1141070377 16:80949003-80949025 CTGCTGGGAAGTGGCAAGTTTGG - Intergenic
1141427317 16:83952751-83952773 CAGCTGGGAAATGGCAAAGCTGG + Intronic
1142006562 16:87692147-87692169 CTCCTTGGAAGTGGCCACCCTGG + Intronic
1142167688 16:88601480-88601502 CTGCTTGGAAGTGGTTCGGCAGG + Intronic
1143833846 17:9674158-9674180 CAGCTTGGAAGTTGGCATGCTGG + Intronic
1145292691 17:21561815-21561837 ATACCTGAAAGTGGCAATGCTGG + Intronic
1145387278 17:22424127-22424149 ATACCTGAAAGTGGCAATGCTGG - Intergenic
1146554455 17:33811772-33811794 CTGCTGGGAAGTGGTACAGCTGG + Intronic
1148849437 17:50547670-50547692 CAGCCTGGAAGTGGGACTGCAGG - Intronic
1149229131 17:54512405-54512427 ATGCTTGCAAGTGGAAATGCTGG + Intergenic
1150582604 17:66488694-66488716 CTGCTTAGAATTGGGAATACTGG + Intronic
1150788671 17:68182882-68182904 ATTCTTGGAAGTGGAATTGCTGG + Intergenic
1151148428 17:72063464-72063486 CTGCTTGTAAGTGGTGAAGCTGG + Intergenic
1151406909 17:73893860-73893882 CAGCTTGTAAGTGGCAGAGCTGG + Intergenic
1151876995 17:76872478-76872500 CTCCTTAGAAATGCCAATGCCGG - Intronic
1152386574 17:79978261-79978283 CTGCTGGGAACTGGGAAGGCAGG + Intronic
1153246520 18:3077602-3077624 CTTGGTGGCAGTGGCAATGCTGG + Intronic
1155536692 18:26825902-26825924 CAGCTGGTAAGTGGCAAAGCTGG + Intergenic
1155640986 18:28014353-28014375 CTGCTTGGAAGAGGCAGTTTGGG + Intronic
1155917031 18:31567194-31567216 CAGCTTGGCAGTGTCAAGGCTGG - Intergenic
1157539495 18:48489758-48489780 CTGCTTGTGAGAGGTAATGCTGG - Intergenic
1158322880 18:56282596-56282618 CTGCTGGGAATAGGCAAAGCTGG + Intergenic
1158559540 18:58502507-58502529 CAGGCTGGAAGTGGCAGTGCAGG + Intronic
1158729556 18:60007922-60007944 CTGCTTAGAAATGGGATTGCTGG + Intergenic
1159299088 18:66539070-66539092 ATGCTTGGAAGAGGGATTGCTGG + Intronic
1161619305 19:5289963-5289985 TTTCTTGGCAGTGGCAAGGCTGG - Intronic
1162095552 19:8307857-8307879 CGGCTTGGAGGTGACAATGGGGG + Intronic
1162351546 19:10153143-10153165 CTGCTTAGAAGTAGCGTTGCTGG - Intronic
1162517308 19:11156249-11156271 CAGCTAGTAAGTGGCAACGCTGG - Intergenic
1162882504 19:13670418-13670440 CTGCTGGAAAGTGGGAATGGGGG + Intergenic
1163170310 19:15526618-15526640 CAGCTTGTAAGTGGCAGAGCTGG + Intronic
1163751315 19:19079905-19079927 GTGCCTGGAAGTGGAATTGCTGG + Intronic
1165727129 19:38120956-38120978 CAGCTGGTAAGTGGCAGTGCTGG - Intronic
1165846380 19:38820460-38820482 CAGCTTGTAAGTGGCAGAGCTGG - Intronic
1165851592 19:38852730-38852752 CAGCTTGCAAGTGGCATGGCGGG + Intergenic
1166625943 19:44356336-44356358 CTGCTAGGAAGTGGCAGAGCTGG + Intronic
1166959089 19:46487294-46487316 CAGCTTGCAAGGGGCAATGCTGG - Intronic
1167245499 19:48370788-48370810 TTGATTGGAAGTGGCAGTGTTGG - Intronic
1167312461 19:48745077-48745099 CAGCTAGGAAGTGGCAGAGCAGG + Intronic
1167555207 19:50190364-50190386 CTACTTGGAAGTGGGATCGCTGG + Intronic
1168531894 19:57136872-57136894 GTGCTGGGAAGTGGCCGTGCAGG - Exonic
925353241 2:3217880-3217902 CTGCCTGGGAGTGGCAATGGGGG - Intronic
925601430 2:5612108-5612130 CTGCTAGAAAGTGGCAGAGCGGG - Intergenic
926060774 2:9803370-9803392 CTGATAGGAAGAGGAAATGCAGG - Intergenic
927489128 2:23509046-23509068 CTGCTTGGAAGTGCCAAGGATGG + Intronic
927510396 2:23640798-23640820 CAGCTGGGAAGGGGCGATGCAGG + Intronic
927880036 2:26683837-26683859 CTGCCTCCAAGTGGCAGTGCAGG + Intergenic
928150122 2:28819552-28819574 CTGCTTTGAAGGAGCAGTGCAGG - Intronic
929464658 2:42133739-42133761 CTGCTTGGCAGTGGTAATCGAGG - Intergenic
930202622 2:48559665-48559687 CTGCTAGGCAGTGGCAGGGCTGG + Intronic
930912083 2:56641172-56641194 TTTCTTGGAAGTGGAAATGTGGG + Intergenic
931202164 2:60108168-60108190 ATACTTGGAAGTGGAATTGCTGG + Intergenic
932484738 2:72077348-72077370 TTCCTTGGAAGTGAGAATGCAGG + Intergenic
932753302 2:74386639-74386661 CTGCTGAGAGGTGGGAATGCTGG - Intronic
934126504 2:88898029-88898051 CTGCTTGGAAGTGAAATTGTTGG - Intergenic
934159072 2:89230909-89230931 CTGCTTGGAGCTGGCAAGGATGG + Intergenic
934208201 2:89951516-89951538 CTGCTTGGAGCTGGCAAGGATGG - Intergenic
935495081 2:103770943-103770965 CTGCTTGGGAATGGAAATGTAGG + Intergenic
936279810 2:111128454-111128476 ATACTTGGAAGTGGAATTGCTGG + Intronic
936472629 2:112812544-112812566 CTCCTTGGAAGTGGCAGGTCGGG - Intergenic
937771447 2:125725058-125725080 CAGGTAGGAAGTGGCAGTGCTGG - Intergenic
938207873 2:129439269-129439291 CTTCTTGGAGGAGGCAGTGCTGG + Intergenic
938547502 2:132347812-132347834 CTGCTAGGAAATGGCAGAGCTGG - Intergenic
939730508 2:145778682-145778704 CAGCTAGTAAGTGGCAAAGCTGG + Intergenic
939736132 2:145848845-145848867 ATTCCTGGAAGTAGCAATGCTGG + Intergenic
940065636 2:149624956-149624978 CTGGTTGCAAGTAGCAATCCTGG + Intergenic
940279917 2:151978489-151978511 CTGCTGGGAAGTGGCACAGCTGG - Intronic
940283444 2:152010670-152010692 CTGCTAGCAAGTGGCAGAGCTGG + Intronic
942228595 2:173838475-173838497 CTTTTGGGAAGGGGCAATGCAGG + Intergenic
942590901 2:177545925-177545947 TAGCTGGGAAGTGGCATTGCAGG + Intergenic
942964681 2:181877122-181877144 CTGCTTGGAAGAGAGAAGGCAGG - Intergenic
943597173 2:189872267-189872289 CTGGTTGGCAGATGCAATGCTGG - Intronic
943980182 2:194539624-194539646 CTCCTGGGATGTGGAAATGCAGG - Intergenic
948705783 2:239791811-239791833 CTGCCTGGAATTGGGAGTGCGGG - Intronic
1168868260 20:1107526-1107548 CTGCTTGTAAGTGAAAAAGCCGG + Intergenic
1169501912 20:6168876-6168898 GTGCTTAGAAGTGGAATTGCAGG + Intergenic
1170166361 20:13363768-13363790 TTGCTTGTTAGTGGCAGTGCAGG + Intergenic
1170363199 20:15569998-15570020 CTACTTGGTAGTGGGATTGCTGG + Intronic
1171876369 20:30580567-30580589 CTGCTAGGAAATGGCAGAGCTGG - Intergenic
1172489369 20:35322791-35322813 CTGCTTGTAAGTGACAGTGCTGG + Intronic
1172600843 20:36181868-36181890 CTGCTTGGAAGTGGCAATGCTGG - Intronic
1172632093 20:36385517-36385539 CTGCTGGGAAATGGCATTGGTGG - Intronic
1172703632 20:36867061-36867083 CAGCTTGGATGTGGCAGGGCTGG + Intergenic
1173172645 20:40739959-40739981 CTGCAAGGGAGAGGCAATGCTGG + Intergenic
1173223665 20:41148809-41148831 CTTGTTGGAAGTGGCCAAGCAGG - Intronic
1176074483 20:63242216-63242238 CTGCTGGGAAGTGGCTCTTCAGG + Intronic
1177007710 21:15694402-15694424 GTGGTTGGAAGTGGCAGTGGAGG - Intergenic
1177010475 21:15725820-15725842 CTAATTGGAAGTGCCAATACTGG + Intergenic
1179347665 21:40575837-40575859 CTTCTGGGAAGTGACAATTCAGG - Intronic
1181316345 22:21973086-21973108 CAGGTTGGAAGTGTCAATGAAGG - Intronic
1181860483 22:25814062-25814084 ATGCTCAGAAGTGGCGATGCTGG + Intronic
1181911594 22:26242633-26242655 CTCCTTGGAAGAGGAGATGCTGG + Intronic
1181971216 22:26691612-26691634 CAGCTAGCAAGTGGCAAAGCTGG + Intergenic
1183069672 22:35387292-35387314 CAGCTAGTAAGTGGCAGTGCTGG - Intronic
1183104456 22:35606337-35606359 CTGCTAGTAAGTGGCAGAGCTGG - Intergenic
1183148053 22:36013517-36013539 CAGCTGTGAAGTGGAAATGCTGG + Intronic
1183194411 22:36343604-36343626 CTGCTTGGAAAAGGAGATGCAGG + Intronic
1183433411 22:37779635-37779657 CTTCTTGGAAGAGGAGATGCTGG + Intergenic
1183703551 22:39463296-39463318 CAGCTGGGAAGTGGCAGGGCTGG + Intronic
1183864709 22:40695001-40695023 CTTCCTGGAAGAGGCAATGACGG - Intergenic
1183939534 22:41285594-41285616 CTGCTGGGAGGTGGCTCTGCGGG + Intronic
1184059419 22:42073179-42073201 CTGCCTGGAATTGGCATGGCTGG + Intergenic
1184538512 22:45103960-45103982 CTGCCTGGAAGTGCAGATGCCGG + Intergenic
949987616 3:9552997-9553019 GTGCTTGAAAGTGGCCATGGGGG + Intronic
950310554 3:11954200-11954222 CAGCTAGGAAGTGGCAGAGCTGG - Intergenic
950411318 3:12839732-12839754 TTGCTTGGGAGTGGCAATGGTGG - Intronic
951066723 3:18275717-18275739 CAGCTAGTAAGTGGCAAAGCTGG + Intronic
955197880 3:56822266-56822288 CAGCTAGGAAGTGGCACAGCAGG + Intronic
956423535 3:69109920-69109942 CAGCTAGGAAGTGGCAGAGCAGG + Intronic
957344470 3:78944150-78944172 CAGCTGTGAAGTGGCAGTGCTGG + Intronic
958160493 3:89812069-89812091 TTGCATGGAAGTGGGACTGCTGG - Intergenic
959551158 3:107659617-107659639 CTGCTAATAAGTGGCAAAGCTGG + Intronic
959968815 3:112385276-112385298 CAGCCTAGAAGTGGCAATGGGGG - Intergenic
960093139 3:113662282-113662304 TTGCTTGGTAGGGACAATGCAGG + Intronic
960910246 3:122642572-122642594 CAGCTAGTAAGTGGCAGTGCTGG + Intergenic
962058061 3:131894841-131894863 ATGCTTGGTAGTGGGATTGCTGG - Intronic
962849846 3:139300176-139300198 CTGCTGGCAAGTGGCAAAGCTGG + Intronic
963129614 3:141846169-141846191 CTTCTTAGAAGTGGCATTGCTGG - Intergenic
963479883 3:145858785-145858807 CAGCTTGGAAGTCTCAAAGCAGG + Intergenic
966886723 3:184381125-184381147 CAGCTTGTAAGTGGCAGAGCTGG + Intronic
968441604 4:627110-627132 CAGCTGGGGAGTGGCAATCCTGG + Intronic
969255572 4:5999523-5999545 CTGCTTCACAGTGGCAATGCTGG - Intergenic
969323137 4:6425115-6425137 ATGACAGGAAGTGGCAATGCTGG + Intronic
969463975 4:7343912-7343934 CAGCTGGGAGGTGGCAGTGCCGG + Intronic
969489376 4:7490499-7490521 CTCCCTGGCAGTGGCAATTCTGG - Intronic
970872799 4:20835379-20835401 CAGCTAGGAAGTGGCAAGGCTGG - Intronic
972316596 4:37932663-37932685 ATGCTGGGCAGTGGCAAAGCTGG + Intronic
972607987 4:40631172-40631194 CAGCTGGTGAGTGGCAATGCTGG - Intergenic
977831341 4:101597319-101597341 CAGCTTGAAATTGGCAATGGCGG + Intronic
979365436 4:119816865-119816887 TTGCTTTGAGGTGGCCATGCAGG + Intergenic
979613408 4:122713988-122714010 CTACTTGGAAGTGAAATTGCTGG - Intergenic
980043758 4:127966375-127966397 CTGTGTGGAAGTGGCAAAGTTGG + Intronic
980187918 4:129485683-129485705 CAGCTTAGAAGTGGCAGAGCTGG + Intergenic
981225635 4:142290652-142290674 CAGTTGGGAAGTGGCAATGGTGG - Intronic
981577284 4:146218331-146218353 AAGCTTGGAAGTGGCAGTGAGGG + Intergenic
982969371 4:161963001-161963023 CAGCTAGCAAGTGGCAAAGCTGG - Intronic
984228200 4:177061765-177061787 CAGCTAGGAAGTGACAGTGCTGG - Intergenic
984321585 4:178204089-178204111 ATGTTAGGAAGTGGCAATGTTGG + Intergenic
984574444 4:181430894-181430916 CTGCTTATAAGTGTCATTGCAGG + Intergenic
984878996 4:184393908-184393930 CAGCGTGGAAGTGGCAATGGTGG - Intronic
985545430 5:506590-506612 CTGCTGGGAAGTGGCCAGACAGG - Intronic
985698278 5:1355356-1355378 CTGCTTAGAAGTGGAATTGAAGG + Intergenic
992150536 5:73898088-73898110 CTGCCTGTAAGTGAAAATGCAGG + Exonic
992771538 5:80053475-80053497 GTTCCTAGAAGTGGCAATGCTGG + Intronic
992777959 5:80104799-80104821 CTGCTGGGAAGGGGCTTTGCAGG - Intergenic
993076937 5:83243865-83243887 CTGCTTGTAATTAGGAATGCCGG - Intronic
998388186 5:141770400-141770422 CAGCTGGTAAGTGGCAAAGCCGG - Intergenic
999065940 5:148685580-148685602 CAGCTGGGCAGTGGCAAAGCTGG + Intergenic
999420390 5:151436870-151436892 CTGCTAGTAAGTGGCAGGGCTGG + Intergenic
999477452 5:151913746-151913768 CAGCTTGGAAGTGTCAGTGTGGG - Intronic
999610418 5:153363409-153363431 TAGCTTGAAATTGGCAATGCTGG - Intergenic
1001055768 5:168448534-168448556 ATGCTGAGAAGTGGCATTGCTGG + Intronic
1001271710 5:170317494-170317516 CTGCTCCGAACTGGCACTGCAGG + Intergenic
1002933318 6:1650066-1650088 CAGCTGTAAAGTGGCAATGCTGG + Intronic
1003469044 6:6411361-6411383 CAGCTTGGCATTGGCCATGCAGG + Intergenic
1004550830 6:16645594-16645616 CTGCTTGGAGATGGTAAAGCTGG - Intronic
1006050686 6:31341220-31341242 CAGCTTGGCAGTGGCAGTGGTGG + Intronic
1006070959 6:31497807-31497829 CTCCTTGGGGGTGGGAATGCGGG + Intronic
1006167740 6:32075105-32075127 GTGCTTGGAGGTGGCAAGGAGGG - Intronic
1006366354 6:33618422-33618444 CTGCTAGAAAGTGGCAGAGCTGG + Intergenic
1006566685 6:34964743-34964765 TTGCCTGGAAGTGGAATTGCTGG + Intronic
1006809746 6:36812199-36812221 CAGCTAGGAAGTGGCAGAGCTGG - Intronic
1008593862 6:53021393-53021415 CTGCAAGAAAGTGGCAATGCAGG - Intronic
1009912723 6:69952322-69952344 CTGCCTGGACGTGGGCATGCAGG - Intronic
1009989577 6:70825326-70825348 CAGCTGGGAAGTGTCCATGCTGG + Intronic
1011155752 6:84329229-84329251 CTGCTGGGAAGTGGCAACAGTGG + Intergenic
1013301309 6:108807556-108807578 TTGCAAGGAACTGGCAATGCTGG - Intergenic
1014282913 6:119461783-119461805 CAGATTGGAAGGGGCAAAGCAGG + Intergenic
1017311945 6:152984798-152984820 ATGCGTTGAACTGGCAATGCAGG + Intergenic
1018206852 6:161444446-161444468 ATGCATGGAAATGGAAATGCCGG - Intronic
1018449496 6:163893937-163893959 CAGCTTGGAATTGGCAATGGTGG + Intergenic
1018971387 6:168531776-168531798 GTGCTTGGAAGTGGCAGAGCTGG + Intronic
1019506058 7:1392068-1392090 ATGCTTGGAAGTGGTAAACCTGG + Intergenic
1019596955 7:1862503-1862525 CAGCTTGGGAGGGGCAAGGCAGG - Intronic
1020509334 7:9033401-9033423 CTGAATGTAAGTGGCAATTCTGG - Intergenic
1022971254 7:35519401-35519423 CCGCCAGGAAGTGGCACTGCTGG + Intergenic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1024003791 7:45210612-45210634 CTGATTGGATGTGGCATTGGGGG - Intergenic
1024690510 7:51796583-51796605 ATGCTTGCAAGAGGGAATGCTGG + Intergenic
1024709192 7:51996142-51996164 CTCTTTGGAAGTGGCCAGGCAGG + Intergenic
1026223394 7:68419810-68419832 CTGCTTGGAAGTGGAAGTTATGG + Intergenic
1026363854 7:69627760-69627782 CAGCTAGGTAGTGGCAAAGCTGG - Intronic
1026619726 7:71939680-71939702 CTGCTTGGAAGTGGTGGAGCTGG + Intronic
1027594174 7:80152161-80152183 CTGCTAGTACGTGGCCATGCTGG + Intronic
1028659656 7:93254957-93254979 CTGCTTGGAGGTAGCAGTGGTGG + Intronic
1031742810 7:125455847-125455869 CTGATTGGGAGTGGCAATGGAGG + Intergenic
1032703754 7:134404691-134404713 CTGCTTAGAAAGGGCCATGCAGG + Intergenic
1032887223 7:136153804-136153826 CAGCTGGGAAATGGCAAGGCTGG + Intergenic
1034095308 7:148402290-148402312 CTGTTTGAAATTGGAAATGCTGG + Intronic
1034477077 7:151291446-151291468 CTGGTTGGATTTGCCAATGCAGG - Intergenic
1034750444 7:153563381-153563403 CTACTTGTAAGTGGCAGAGCTGG - Intergenic
1034962218 7:155370057-155370079 CTGCTTGGGTGTGGCCGTGCAGG - Intergenic
1039346632 8:36712254-36712276 TTGCTGGGAAGTGGAAATGAAGG + Intergenic
1040072008 8:43196103-43196125 CAGCTGGGAAGTGGCAGAGCTGG - Intronic
1043302578 8:78752285-78752307 CTGCTTGGTAGTGAGATTGCAGG + Intronic
1043909344 8:85842724-85842746 TTGCCTGGAAGTGGCCCTGCAGG + Intergenic
1045418675 8:101992547-101992569 CAGCTGGTAAGTGGCAAAGCTGG - Intronic
1046474566 8:114725069-114725091 CTGCATGGAAATGGGATTGCTGG - Intergenic
1046967909 8:120187928-120187950 CAGCTAAGAAGTGGCAAAGCTGG - Intronic
1049213648 8:141398025-141398047 CTGCTTGGAGGTGCCCAGGCTGG + Intronic
1050144189 9:2548178-2548200 CAGTTTGTAAGTGGCAAAGCTGG + Intergenic
1050788804 9:9439902-9439924 CAGCTGGGAAGTGGCAGAGCAGG + Intronic
1051529585 9:18085264-18085286 CAGCTGGTAAGTGGCAAAGCTGG - Intergenic
1052280212 9:26724198-26724220 CAGCTAGTAAGTGGCAGTGCTGG - Intergenic
1052393186 9:27905334-27905356 CAGCTAGAAAGTGGCAAGGCTGG - Intergenic
1053178801 9:35949843-35949865 CTACTTGGAATTGGCAACACCGG - Intergenic
1054265736 9:62914741-62914763 ATGCCTGGAAGGAGCAATGCAGG + Intergenic
1055567894 9:77587279-77587301 ATGCTTAGAAGTGGAATTGCTGG - Intronic
1056022944 9:82460280-82460302 ATGCTTAAAAGTGGAAATGCTGG + Intergenic
1057126541 9:92620179-92620201 CTGCTTGTCAATGGCAAGGCAGG + Exonic
1057747030 9:97760682-97760704 CTGCTTGTAAGTGACAGAGCTGG + Intergenic
1057755577 9:97832246-97832268 CAGCTGGGAAGTGGCATAGCTGG + Intergenic
1057871423 9:98721057-98721079 CAGCTAGGAAGAGGCAAAGCTGG + Intergenic
1059330973 9:113535635-113535657 CAGCTGGGAAGTGGCACAGCTGG + Intronic
1059572342 9:115452596-115452618 GTGCTTGGAGGTGCCAAGGCAGG + Intergenic
1059714363 9:116899876-116899898 CTGCTTGGATATCGGAATGCAGG - Intronic
1060105863 9:120873094-120873116 CAGCTAGTAAGTGGCAAAGCTGG + Intronic
1060238777 9:121885618-121885640 CAGCTTAGAAGTGGCAAAGCCGG + Intronic
1060401531 9:123352617-123352639 CTGCTGGGAAGTGGAGAAGCCGG + Intergenic
1060410677 9:123398195-123398217 CTGCTGGGAAGTGGCAGTAGGGG - Intronic
1060545943 9:124458994-124459016 CAGCTTGTAAGTGGCAGAGCTGG + Intronic
1060605194 9:124907787-124907809 AGGCTTGGAAATGCCAATGCTGG + Intronic
1060672376 9:125481120-125481142 CTGCAGGTAAGTGGCAAGGCTGG + Intronic
1060825211 9:126683825-126683847 CAGCTAGGAAGTGGCAGAGCCGG + Intronic
1062179630 9:135184327-135184349 CTGCTGGGCAGTGGCACAGCTGG - Intergenic
1186163248 X:6800562-6800584 GTGGTTGGAAGTGGGAGTGCTGG - Intergenic
1186484768 X:9925565-9925587 CTGTTTGGAAGCAGCAATGCTGG + Intronic
1187190673 X:17031958-17031980 CAGCTAGGAAGTGGCAGGGCTGG + Intronic
1188913303 X:35878225-35878247 ATACTTAGAAGTGGAAATGCTGG + Intergenic
1192207185 X:69104277-69104299 CAGCTTGTAAGTGGCAGAGCTGG - Intergenic
1195776269 X:108409560-108409582 CTGCTAGGAAGTGGAAAAGCTGG + Intronic
1195868376 X:109458307-109458329 CAGCTGGGAAGTGGCAGAGCTGG - Intronic
1195922239 X:109995278-109995300 CTGCTTGTATGTGCCAAAGCTGG - Intergenic
1195940507 X:110163784-110163806 CTGGATGCAAGTGGAAATGCTGG + Intronic
1196026015 X:111042204-111042226 ATGAGTGGAAGTGGCAATGGAGG - Intronic
1196305606 X:114099046-114099068 CAGCTTTGAAGTGGCAGAGCTGG - Intergenic
1196480988 X:116147860-116147882 CAGCTAAGAAGTGGCAAAGCGGG - Intergenic
1197620854 X:128746186-128746208 CTGGTAGGAGGTGGCAAAGCTGG - Intergenic
1197705426 X:129631315-129631337 CTGCTTGGAGGTGGCATAGCAGG + Intergenic
1197826406 X:130595091-130595113 CAGCTAGCAAGTGGCAAAGCTGG - Intergenic
1198435976 X:136617205-136617227 CAGCTTGTAAGTGGCATAGCTGG - Intergenic
1199283964 X:146035805-146035827 CTGACAGGAAGTGGTAATGCTGG - Intergenic
1201468057 Y:14306649-14306671 TTGCTTGTAAATGGCCATGCTGG + Intergenic
1201557663 Y:15281545-15281567 GTGGTTGGAAGTGGGAGTGCTGG - Intergenic
1201941552 Y:19466009-19466031 CAGGCAGGAAGTGGCAATGCAGG - Intergenic