ID: 1172601989

View in Genome Browser
Species Human (GRCh38)
Location 20:36190417-36190439
Sequence CCATGTGTATGGAGGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172601971_1172601989 22 Left 1172601971 20:36190372-36190394 CCGGTGAGCCTGACCTTGGATGG 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1172601989 20:36190417-36190439 CCATGTGTATGGAGGGGAGCAGG 0: 1
1: 0
2: 1
3: 26
4: 270
1172601975_1172601989 14 Left 1172601975 20:36190380-36190402 CCTGACCTTGGATGGGGTAATGG 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1172601989 20:36190417-36190439 CCATGTGTATGGAGGGGAGCAGG 0: 1
1: 0
2: 1
3: 26
4: 270
1172601979_1172601989 9 Left 1172601979 20:36190385-36190407 CCTTGGATGGGGTAATGGGGATG 0: 1
1: 0
2: 2
3: 18
4: 205
Right 1172601989 20:36190417-36190439 CCATGTGTATGGAGGGGAGCAGG 0: 1
1: 0
2: 1
3: 26
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172601989 Original CRISPR CCATGTGTATGGAGGGGAGC AGG Intronic
900542095 1:3208110-3208132 CCATGTGGATGCAGAGGTGCCGG - Intronic
900680464 1:3913475-3913497 CGATGTGGATGGAGGGTGGCTGG + Intergenic
901396963 1:8988646-8988668 ACAAGTGTATGCTGGGGAGCAGG + Intergenic
902115702 1:14119216-14119238 CCATGGGTCTGTAGGGGAGCAGG + Intergenic
902245914 1:15120310-15120332 TCAAGTGAATTGAGGGGAGCTGG - Intergenic
902646789 1:17805117-17805139 CCGTGTGGCTGGAAGGGAGCTGG - Intronic
903463404 1:23534922-23534944 ACATGGGGATGGAGGGGAGGAGG - Intergenic
904014034 1:27406736-27406758 CCATGTGCAGTGAGGGGAGCTGG + Exonic
905119042 1:35667613-35667635 CCATGTGTATGCACCGGCGCAGG + Intergenic
905239936 1:36575050-36575072 CCATGTGTATAAGGGGGAGTTGG - Intergenic
905297679 1:36964422-36964444 GCATGTGTGAGGAGGGGAGAGGG - Intronic
905378965 1:37546157-37546179 CCCTGTGTATGGCAGGGAGCGGG - Intronic
906690191 1:47787502-47787524 GCATTTGTAGGGAGGGGAGGCGG - Intronic
906967421 1:50472103-50472125 CCGTAGGTCTGGAGGGGAGCTGG + Intronic
911230636 1:95357646-95357668 CCATGAGTCTGGAGGGGACATGG + Intergenic
912451679 1:109771012-109771034 CCACGGGTATGGAGGGGAGAGGG + Intronic
912732421 1:112120153-112120175 CCAGGTGTATGAAGAAGAGCTGG + Intergenic
912814958 1:112821600-112821622 TCATGTGTAGGGAAGGGAGGGGG + Intergenic
913243848 1:116854141-116854163 GCATGTGTATGGAAGGGGGAAGG - Intergenic
916577065 1:166076900-166076922 CCATCTGCATGGAGAGGATCAGG + Intronic
919834234 1:201562774-201562796 CCTGGTGGATGGAAGGGAGCAGG + Intergenic
920059099 1:203215338-203215360 CCATGAGTTTGTAGAGGAGCAGG + Intronic
920689721 1:208136603-208136625 GCCTGTATATTGAGGGGAGCGGG + Intronic
921101504 1:211932837-211932859 GCATGTGTTTGGTGGGGAGCTGG + Intergenic
922567833 1:226612433-226612455 CCATCTGGAAAGAGGGGAGCAGG + Intergenic
923513050 1:234670129-234670151 CCCTGTGAATGAAGGTGAGCTGG - Intergenic
923770461 1:236933811-236933833 CGATGTGTAGGGAAGGGAGGGGG + Intergenic
1064691603 10:17924147-17924169 CCATGTGGGTAGAGAGGAGCAGG + Intergenic
1064710510 10:18119135-18119157 CCATGTGTTTGGGAGGGACCTGG + Intergenic
1064886712 10:20120714-20120736 TCATGTGTAGGGAAGGGAGGGGG + Intronic
1065550372 10:26863484-26863506 TCATGTGGCAGGAGGGGAGCAGG - Intergenic
1067725951 10:48771093-48771115 CCATGTGTTTGGAAGGCAGGCGG + Intronic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1068931624 10:62596220-62596242 CCATCTGCATGGAGGGCAGAAGG - Intronic
1069421096 10:68247277-68247299 CCATGTGTGTTGCGGGGAGGGGG + Intergenic
1069686990 10:70324731-70324753 CCCTGTGCAGGGAGGAGAGCTGG + Intronic
1070893819 10:79964731-79964753 TAATGTGTAGGGAAGGGAGCGGG - Intronic
1070967978 10:80541414-80541436 AAATGTGTAGGGAGGGGACCAGG - Intronic
1071523719 10:86346404-86346426 GCCTGTGTTTGGAGGGCAGCTGG + Intronic
1071897456 10:90082582-90082604 TCATGTGTAGGGAAGGGAGGGGG + Intergenic
1072713773 10:97735924-97735946 CCAGAAATATGGAGGGGAGCAGG + Intergenic
1072736266 10:97881686-97881708 CTATGTGTTTGGAGTGGGGCTGG + Intronic
1073290528 10:102411039-102411061 CCATGTGAGTGGAGGCGGGCGGG - Exonic
1074253469 10:111777120-111777142 CCATCTGTGTGTAGGGGGGCTGG - Intergenic
1074529918 10:114290049-114290071 CCATGAGTCTGTAGGAGAGCTGG + Intronic
1075089638 10:119436518-119436540 CCATCTGGGTGCAGGGGAGCAGG + Intronic
1075399659 10:122151769-122151791 CCGTGGGGATGGAGGGGACCTGG + Intronic
1076798954 10:132811888-132811910 CCCTGTTGATGGAGCGGAGCAGG - Intronic
1076891858 10:133288615-133288637 CCCTGGGCAAGGAGGGGAGCTGG + Intronic
1077549082 11:3191829-3191851 CCCAGTGTCTGGAGGGGACCAGG + Intergenic
1078517055 11:12031799-12031821 CCTTGTCTCTGGAGGAGAGCAGG + Intergenic
1078733241 11:13995589-13995611 CCATGTGTAGGGGAGGGACCTGG - Intronic
1079089068 11:17468118-17468140 ACATGAGTATGAATGGGAGCTGG - Intronic
1080399614 11:31921930-31921952 ACATGTCCATGGAGAGGAGCTGG - Intronic
1081191188 11:40104600-40104622 CCATCTGGAAAGAGGGGAGCAGG - Intergenic
1083267979 11:61555661-61555683 CCACGCCCATGGAGGGGAGCGGG + Intronic
1083366917 11:62146935-62146957 CCATGTGTGTGGAAGAGAGACGG + Intronic
1088422593 11:109665907-109665929 CCATGTGTATAGTAAGGAGCAGG + Intergenic
1091539467 12:1446074-1446096 CCATATGAATTGAGGGGAGGAGG + Intronic
1094297961 12:28928896-28928918 GCCTGTGTATGGAGTGGAGAGGG + Intergenic
1094401059 12:30060910-30060932 TGATGTGTAGGGAGGGGAGGAGG - Intergenic
1095837455 12:46654269-46654291 CCAGGTGGATGGAGGTGGGCGGG - Intergenic
1096981772 12:55732267-55732289 CCATGTGTTTGCTGGGGTGCAGG + Intergenic
1097029891 12:56082635-56082657 CCATGTGTGGGGTGGGGAGTAGG - Intronic
1097178719 12:57158662-57158684 CCATGGGGATGGAAGGGGGCTGG + Intronic
1099534638 12:83828622-83828644 CCATCTATAAAGAGGGGAGCAGG + Intergenic
1100738973 12:97570546-97570568 GAATGTGTATGGAGGGGTGGTGG - Intergenic
1100823624 12:98454986-98455008 CCACGAGTCTGGAGGGCAGCTGG - Intergenic
1102205027 12:111084305-111084327 CCATCTGTTTCTAGGGGAGCAGG + Intronic
1103260306 12:119582488-119582510 CCATCTGTATGGGAGGGACCTGG + Intergenic
1103767720 12:123293540-123293562 CAGTGTGAATGGATGGGAGCTGG - Exonic
1104299890 12:127555079-127555101 CCATGTGCATGGAGTTTAGCTGG + Intergenic
1106416056 13:29546868-29546890 GCATGTGTGTGGCGTGGAGCTGG - Intronic
1107388728 13:39941513-39941535 GCATGTGCAAGGAGAGGAGCTGG - Intergenic
1107417228 13:40211873-40211895 CTACCTGGATGGAGGGGAGCAGG - Intergenic
1107835571 13:44410102-44410124 CCACGTGGAGGGAGGGAAGCAGG - Intergenic
1110137323 13:72084224-72084246 CCATAGGTATGAAGAGGAGCTGG + Intergenic
1114438287 14:22726252-22726274 CCATGGGGGTTGAGGGGAGCAGG + Intergenic
1114479744 14:23025356-23025378 GCATATGTGTGGAGGGGAGAGGG - Intronic
1119704558 14:76775750-76775772 CCAGGCGTATGGAGATGAGCAGG + Intronic
1121788940 14:96684173-96684195 GAATGTGTAAGGAGAGGAGCAGG + Intergenic
1127075222 15:55318976-55318998 CCCGGTCTCTGGAGGGGAGCAGG - Exonic
1127358376 15:58223672-58223694 GTATGTGTATTGAGGGGAGGGGG - Intronic
1127632724 15:60841684-60841706 CCAGGTGTGTGGAGGGGTGTTGG - Intronic
1127783195 15:62333544-62333566 ACATGTGTCTGGAGGGGATCTGG + Intergenic
1130897818 15:88184292-88184314 CTATGTGTCTGCAGGGGAGGAGG + Exonic
1131095533 15:89652365-89652387 CCATCTCTATGGAGGTGAGAAGG + Intronic
1133586962 16:7205010-7205032 CCATGTGTAACAAGGGGAGGTGG + Intronic
1135094721 16:19555623-19555645 CCATGTTTGTGAAGGGCAGCTGG - Exonic
1135830732 16:25770589-25770611 CCAGGTGTGTGGAGTGGAACAGG + Intronic
1136616555 16:31401940-31401962 CCATGTGGGAGGAAGGGAGCAGG + Intronic
1139016537 16:62696324-62696346 CCACTTCTATGGAAGGGAGCTGG + Intergenic
1140484986 16:75286663-75286685 CCACGTGTATGGGAGGGACCTGG - Intergenic
1142308520 16:89299162-89299184 CCCTGTGTATCGAGGAGAGGAGG + Intronic
1142408402 16:89903831-89903853 CCATGTGTGTGGAGGGTGGTGGG + Intronic
1142461337 17:95885-95907 AGATGTGCATGGAGGTGAGCTGG - Intergenic
1142986377 17:3697464-3697486 CCAGGGGTAGGGAGAGGAGCAGG - Intergenic
1143026815 17:3945855-3945877 CCAGGAGTAGGGAGGAGAGCGGG - Intronic
1144242432 17:13326425-13326447 CCATTTGTTTGGAGGAGAGGAGG - Intergenic
1144762561 17:17715599-17715621 CCATGTGAATGGAAGGGGCCGGG - Intronic
1146086879 17:29838244-29838266 CCCAGTGTGTGGAGGGGACCAGG - Intronic
1149052066 17:52317253-52317275 CTATATGTATGGAAGGTAGCGGG - Intergenic
1149076273 17:52598603-52598625 CTATGTGTATGCAGGGCACCTGG - Intergenic
1149988707 17:61368232-61368254 CCCTGGGTATGGAGAGGAGCGGG + Intronic
1150008732 17:61486206-61486228 CCATGTGTTTGGAGAGAACCTGG - Intergenic
1151124683 17:71832105-71832127 CCCTGTCTTTGGAGGGGATCTGG + Intergenic
1151139961 17:71981974-71981996 ACATGTGTGTGGAGGGTAGGTGG - Intergenic
1151342100 17:73478081-73478103 CCCTGTGTATGTTGGGGATCAGG - Intronic
1151541507 17:74767234-74767256 CCTTCTGTATGGTGGGGAGTTGG - Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1153252429 18:3135984-3136006 CCATGTGTGTGGGAGGGACCTGG + Intronic
1158288929 18:55917090-55917112 CCATGTGTGTGGGAGGGACCTGG + Intergenic
1159096399 18:63907086-63907108 GCATGTGTATGGAGGAAGGCGGG - Intronic
1160088442 18:75802323-75802345 CCATGTGTCTGTGGTGGAGCTGG - Intergenic
1160403688 18:78629676-78629698 CCATGGGAGTGGAGGGGAGATGG + Intergenic
1160525446 18:79532979-79533001 CCATCTGGATGGGGAGGAGCTGG + Intergenic
1160696255 19:486038-486060 GGATGAGGATGGAGGGGAGCTGG - Intergenic
1160734985 19:658308-658330 CCAGGCGCATGGAGGGGAGTGGG + Intronic
1162207394 19:9065891-9065913 CCATGGGCATTGAGGGGAGCGGG + Intergenic
1164692309 19:30220446-30220468 CCATGTGTTAGGTGGGGAGTTGG - Intergenic
1164813221 19:31174759-31174781 ACATTGGTATGGAGGGGAGAGGG + Intergenic
1165073607 19:33269117-33269139 CCATGTGCCTGGGAGGGAGCAGG - Intergenic
1166905374 19:46104675-46104697 TGATGTGTAGGGAAGGGAGCGGG + Intergenic
1168147861 19:54429779-54429801 CCCTGGGTGGGGAGGGGAGCTGG + Intronic
925059256 2:878481-878503 GCATGTGTATGTAGGGGTGAGGG - Intergenic
925293828 2:2765278-2765300 CCCTGTGTGTGGAGGGGCACGGG - Intergenic
925725423 2:6866118-6866140 CCGGGTGCATGGAGGGGGGCGGG + Intronic
926266176 2:11323747-11323769 CTATGTGTATGCAGGGGTGAGGG - Intronic
926413873 2:12630666-12630688 TGATGTGTATGGAAGGGAGGGGG - Intergenic
927541768 2:23918511-23918533 CAGTGTGTAGGGAGAGGAGCAGG - Intronic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
929670778 2:43875310-43875332 CCATGTGGAAGGTGGGGAGCAGG - Exonic
930409698 2:51009595-51009617 ACATGTGTATGAAGTAGAGCAGG + Intronic
930766476 2:55090556-55090578 CCAGGTGGATAGAGGGGAGGTGG - Intronic
931253812 2:60553976-60553998 CCGCGTGTGTGGGGGGGAGCAGG - Intergenic
932272897 2:70426171-70426193 CCAAGTGTTTGCAGGGGAGCTGG - Intergenic
932326301 2:70864267-70864289 CCATGTGGATGGAGAGAAGTAGG - Intergenic
932760360 2:74435750-74435772 CACAGTGTATGGAGGAGAGCTGG - Intronic
933743263 2:85551725-85551747 CCATGTGGTGGGAGGGGAGAGGG - Intronic
935363519 2:102267405-102267427 CCCTGTGAATGGAGGTCAGCAGG - Intergenic
936386275 2:112032418-112032440 CCCTGTGTAAGAAGGGGAGGAGG + Intergenic
936598183 2:113869506-113869528 CCTTCTGTATGGTAGGGAGCAGG - Intergenic
937048014 2:118862937-118862959 TCATGTGTGTGGAGGGGACATGG - Intergenic
938669469 2:133573340-133573362 ACATGTGTGTTGAGGGGACCAGG - Intergenic
938775743 2:134539972-134539994 GCCTGTGCATGGAGGTGAGCGGG - Intronic
939589689 2:144048775-144048797 GCATGTGCATGCGGGGGAGCAGG - Intronic
941149236 2:161893248-161893270 ACATGTGTGCGGAGGGGAGGTGG + Intronic
941378916 2:164766754-164766776 CCATGTGCATGGAGGAAAGCAGG - Intronic
941566662 2:167117301-167117323 GTATGTGTATGGCGGGGAGTGGG - Intronic
943450457 2:188037595-188037617 TCATGTGTAGGGAAGGGAGGGGG - Intergenic
944302992 2:198145910-198145932 CCATGAGAATGGAGAGGAGAGGG + Intronic
944557052 2:200897619-200897641 CCATGTGTCAGGAAGAGAGCTGG + Intronic
945761128 2:213916659-213916681 CCATGTGTCATGGGGGGAGCAGG - Intronic
947948942 2:234131055-234131077 TCATGTGTGTGGAGGGCAGTGGG + Intergenic
1169194589 20:3676320-3676342 CCATCTACAGGGAGGGGAGCAGG - Intronic
1170783669 20:19449233-19449255 CCCTGGGAATGCAGGGGAGCTGG - Intronic
1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG + Intergenic
1171256579 20:23693219-23693241 ACATATGAATGGAGGGGAGTAGG + Intergenic
1171263935 20:23755151-23755173 ACATATGAATGGAGGGGAGTAGG + Intergenic
1171273132 20:23831997-23832019 ACATATGAATGGAGGGGAGTAGG + Intergenic
1171852053 20:30316020-30316042 GCATGTGTATGGGAGGGAGGAGG + Intergenic
1172601989 20:36190417-36190439 CCATGTGTATGGAGGGGAGCAGG + Intronic
1173037836 20:39429706-39429728 CCATGGGAATGGATGGGAACTGG - Intergenic
1173366013 20:42385842-42385864 ACATGTCCATGGAGGGGGGCAGG - Intronic
1174558462 20:51413002-51413024 CCATGTGTTTGGCGGGGAGGGGG - Intronic
1175109117 20:56633805-56633827 GCATCTGTATTGAGGGGAGGTGG + Intronic
1175959335 20:62627169-62627191 CCATGTGTTGGGAGGAGGGCTGG + Intergenic
1177336026 21:19728935-19728957 CCATGTGTATGGACGTGGGTAGG - Intergenic
1179385505 21:40938200-40938222 CCATGTGTAGGGTGGAGAGTGGG - Intergenic
1179661630 21:42879504-42879526 ACATGTGTATGGCGGTGAGGCGG - Exonic
1179962334 21:44775248-44775270 CCATCTGTAGGGAGTGAAGCAGG - Intronic
1180959492 22:19756163-19756185 CCACGTGTGTGCAGGGGAGGCGG + Intergenic
1184312063 22:43652168-43652190 CCATGTGTTTGGGAGGGACCTGG + Intronic
1184427044 22:44416325-44416347 CCATGTGTTTGGGAGGGACCTGG + Intergenic
1184994685 22:48196885-48196907 CCATGTGTTTGGGAGGGACCCGG + Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
950250436 3:11460881-11460903 CCATGTGTATGGAGCCCAGAGGG + Intronic
950363731 3:12468453-12468475 CCAGCTGTAGGGAGTGGAGCAGG + Intergenic
951987579 3:28638099-28638121 CCATCTGTATGTAGGTGAGCTGG + Intergenic
952954580 3:38549188-38549210 CTCTGTGTCTGGAGAGGAGCTGG + Exonic
954105654 3:48408569-48408591 GGATGTGTGAGGAGGGGAGCTGG - Intronic
955695584 3:61632805-61632827 CCATGGGCAGGGAGGGGAGGGGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
959170275 3:102835933-102835955 CCATGAGTACAGAGGGTAGCTGG + Intergenic
961577489 3:127849624-127849646 CCATGTGAAAGAAAGGGAGCTGG + Intergenic
961819851 3:129570469-129570491 CCATGTAGAGGCAGGGGAGCAGG - Intronic
962403532 3:135081306-135081328 CCATATGTATGGAGGGTGGAGGG + Intronic
962875952 3:139536194-139536216 ACTTGTGAATGGAGGGGAGCTGG - Intronic
964890070 3:161523947-161523969 ACATGTTTTTGGTGGGGAGCTGG + Intergenic
967099900 3:186207721-186207743 CCATGTGTCTACAGGTGAGCAGG + Intronic
969653741 4:8483957-8483979 TCATGTGTAGGGAAGGGAGGGGG + Intronic
970421119 4:15906347-15906369 CCCTTTGTATGGAGGGGAAGCGG - Intergenic
972027869 4:34409710-34409732 CCAGGTGTATAGAGAAGAGCTGG - Intergenic
972430286 4:38975216-38975238 GGATGTGTGTGGAGGAGAGCAGG - Intronic
973989195 4:56387142-56387164 CCATTTGAATGGAGGGGCGGAGG + Intronic
974913702 4:68153611-68153633 CCATGTGTATGGGGGTGATGAGG + Intergenic
976558886 4:86478958-86478980 TCATGTGTAGGGAAGGGAGGGGG - Intronic
976946479 4:90775907-90775929 CCATGTGTGTGAAGGAGAGTTGG + Intronic
977565314 4:98574774-98574796 CCATGTGTCTGTTGGGGATCAGG - Intronic
978493591 4:109334763-109334785 CAATGTGTGTGGAGGGGTGGGGG - Intergenic
979639401 4:122996249-122996271 CCATGTGTATGGAAGGCATGAGG - Intronic
981115105 4:140980554-140980576 CCATGTGTAGTGGGAGGAGCTGG + Intronic
981196668 4:141929117-141929139 CCATGTGTGGGGTGGGGAGGGGG + Intergenic
982168780 4:152640880-152640902 ACATGTATATGGCGGGGGGCGGG - Intronic
982750568 4:159156632-159156654 CCATGTGGGTGGTTGGGAGCTGG - Intronic
984137534 4:175959698-175959720 GCATGTGTGTGGAGCGGGGCAGG - Intronic
985843273 5:2325703-2325725 ACATCTGTGTGGGGGGGAGCAGG - Intergenic
985854616 5:2415370-2415392 CCAGGTGTGTGCAGGTGAGCTGG + Intergenic
986264452 5:6180656-6180678 CCATCAGGATGGAGGGGAGGAGG - Intergenic
989125536 5:38049097-38049119 CCTTGGGTATGCAGGGGAGTGGG + Intergenic
990358500 5:54995137-54995159 GCAGGTGGATGAAGGGGAGCAGG - Intronic
990369214 5:55100078-55100100 CCATATGTATAAAGAGGAGCTGG + Intergenic
990782302 5:59378870-59378892 GGATGTGTGTGGAGAGGAGCTGG - Intronic
993861868 5:93145987-93146009 CTGAGTGTATGCAGGGGAGCTGG - Intergenic
993907265 5:93637082-93637104 CCAAGGGTAAGGAGGGGAGCTGG - Intronic
994149746 5:96433589-96433611 TCATGTGTGTGGCGGGGAGGGGG + Intronic
995632741 5:114151395-114151417 CCAAGTGGAAGGAAGGGAGCTGG - Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
999389582 5:151180481-151180503 CCCTGTATGTGGAGGGGACCTGG + Intergenic
1002130747 5:177080051-177080073 CAAAGTGGATGGAGGGGAACTGG - Intronic
1002838122 6:882641-882663 GATTGTTTATGGAGGGGAGCAGG + Intergenic
1003100996 6:3176432-3176454 CCACCTGAGTGGAGGGGAGCTGG + Intergenic
1004045782 6:12021487-12021509 GCATGTCTGTGGAGGGGAGGAGG - Intronic
1004525348 6:16402122-16402144 CCATGTGTGTGGGAGGGACCTGG - Intronic
1005729322 6:28681845-28681867 CTATGTGTAGGGTGGGGAGATGG - Intergenic
1005781988 6:29201879-29201901 CCCTGGCTATGGAGAGGAGCGGG + Intergenic
1006561630 6:34917912-34917934 CCAGGTGAAAGGAGGGCAGCTGG - Intronic
1006914439 6:37585307-37585329 CCATGTGAATGTAGGAGAGGAGG + Intergenic
1007300572 6:40864887-40864909 CGATGTGTAGGGAAGGGAGGGGG + Intergenic
1007323713 6:41044475-41044497 GCATGTGAATGGAGGCGAGCTGG - Intronic
1007774371 6:44216787-44216809 CCTGGTATATTGAGGGGAGCGGG - Intergenic
1008476913 6:51942878-51942900 TGATGTGTAGGGAGGGGAGGGGG - Intronic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1009632213 6:66214055-66214077 CCATCTATATGGAGGCAAGCAGG - Intergenic
1011848832 6:91600933-91600955 CCATCTGTAGGGAGAGGAGTGGG + Intergenic
1013289665 6:108709133-108709155 CCCTGGGAATGGTGGGGAGCAGG + Intergenic
1013619433 6:111873365-111873387 CCATCTGTCAGGAGCGGAGCCGG - Exonic
1014665641 6:124233504-124233526 CCATGGCTTTGGAAGGGAGCTGG + Intronic
1015143359 6:129959198-129959220 CCTTGGCTATGGAGAGGAGCGGG + Intergenic
1016607549 6:145949342-145949364 AAATGTGTGTGGAGGGGGGCAGG + Intronic
1018258709 6:161948744-161948766 CCATGTGTTTGGAGGGCAAGAGG + Intronic
1018812578 6:167308464-167308486 CCCTGTGGATGTGGGGGAGCAGG + Intronic
1018916752 6:168137159-168137181 CTAGGTGTATAGAGGGGGGCTGG - Intergenic
1019267355 7:125297-125319 CCAGGAGCCTGGAGGGGAGCAGG - Intergenic
1021761532 7:23906722-23906744 CCAAGTGTGTGGAAGGCAGCAGG + Intergenic
1022896782 7:34758034-34758056 GTATTAGTATGGAGGGGAGCTGG - Intronic
1023703168 7:42912155-42912177 CCATGTTTATTGAGGGCACCTGG + Intronic
1024951050 7:54860663-54860685 GCAAGTTTATGGAGGGGAGTAGG + Intergenic
1025730548 7:64103189-64103211 CGATGTGTAGCAAGGGGAGCTGG - Intronic
1026172841 7:67969581-67969603 CCATGTTTATGGAGTGGTGCTGG - Intergenic
1027026075 7:74852501-74852523 CTATGTGTGTTGAGGGGAGATGG + Intergenic
1027061681 7:75091618-75091640 CTATGTGTGTTGAGGGGAGATGG - Intergenic
1028293955 7:89104312-89104334 CCAGGTGTATGAAGAAGAGCTGG - Intronic
1028589485 7:92480396-92480418 TGATGTGTAGGGAGGGGAGGGGG + Intergenic
1032010359 7:128342937-128342959 GCATGTGTATAGTGGGGAGAGGG - Intronic
1033965046 7:146965135-146965157 CCATGTGTACAGAGGAGAGGGGG + Intronic
1034378024 7:150663916-150663938 CCATGTGTAGGGAGGGGACATGG + Intergenic
1035100180 7:156389772-156389794 GGATGAGTCTGGAGGGGAGCGGG + Intergenic
1035359455 7:158300771-158300793 CCGTGTGGAGGGAGGGGAGGTGG + Intronic
1038388861 8:27175927-27175949 CCATGTGTTTGGGAGGGACCTGG + Intergenic
1039170699 8:34741599-34741621 CCAGGGGTACAGAGGGGAGCTGG + Intergenic
1039847810 8:41338191-41338213 TCATGTATCTGGAGGGGGGCTGG - Intergenic
1045381552 8:101632387-101632409 CCCTGTGGATGGATGGGAGGTGG - Intronic
1045441192 8:102213248-102213270 ACATGACTATGGAAGGGAGCTGG + Intronic
1045771322 8:105743486-105743508 CCAGGTATATGCAGGGGTGCAGG + Intronic
1047853013 8:128879319-128879341 CCATGTGCAAGGACTGGAGCTGG + Intergenic
1048168151 8:132081778-132081800 TCATGTGTACGGAAGGGAGGGGG + Intronic
1048303861 8:133269996-133270018 GCATGTGTATGGTGGGTAGCAGG - Intronic
1051055568 9:12981009-12981031 CCATGTTTATGGAGGGTGGAGGG - Intergenic
1053789835 9:41679276-41679298 GCATGTGTATGGGAGGGAGGAGG + Intergenic
1054155305 9:61635480-61635502 GCATGTGTATGGGAGGGAGGAGG - Intergenic
1054178175 9:61890966-61890988 GCATGTGTATGGGAGGGAGGAGG + Intergenic
1054659354 9:67689858-67689880 GCATGTGTATGGGAGGGAGGAGG - Intergenic
1055111624 9:72565881-72565903 CCATGTGTCTTGAGGGGAGCTGG - Intronic
1055433255 9:76266541-76266563 GCATGTGCATGGAGGGGATCAGG - Intronic
1055810337 9:80141579-80141601 TCATGTGTAGGGAAGGGAGGGGG - Intergenic
1059246894 9:112856459-112856481 GCATGGGTGTGGAGGGGAGTGGG + Intronic
1059580629 9:115544357-115544379 CAATGTTTGTAGAGGGGAGCTGG - Intergenic
1061699827 9:132407430-132407452 GCATGTGAATGCAGGGGAGGGGG + Intergenic
1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG + Intergenic
1062623512 9:137433136-137433158 CCCTGTGGGTGGAGGGCAGCCGG - Intronic
1186215712 X:7298367-7298389 CCATATGGATGGAGGAGATCAGG + Intronic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1188580034 X:31700366-31700388 CAATGTGTATGGAGAGGAGTTGG + Intronic
1189992321 X:46607063-46607085 CCACGAGTCTGGAGGGCAGCCGG - Exonic
1190136895 X:47806217-47806239 CCATGTGCAGTGAGGGGAGCTGG - Intergenic
1190508638 X:51154685-51154707 CCGTGTGTATGGTGGGGATAAGG + Intergenic
1191719585 X:64218250-64218272 ACATGGGTAGGGAGGGGATCTGG + Intergenic
1192759333 X:74079196-74079218 CCATTTTAATGGAGGGGACCAGG - Intergenic
1193814021 X:86084383-86084405 GCATGTATAGGGAGGGGAGGGGG - Intergenic
1195144952 X:102003980-102004002 CCATATGTATAAAGAGGAGCTGG + Intergenic
1195509018 X:105693054-105693076 CCATGGGTATAGAGAGGACCAGG - Intronic
1196892572 X:120305659-120305681 CCATGGGGAGGGAGGGGAGAGGG + Intronic
1198847585 X:140929348-140929370 GTATGTGTGTGGAGGGGAGGAGG + Intergenic
1199094344 X:143722635-143722657 CCTTGTGTCTGGAGGTCAGCGGG - Intergenic
1199571890 X:149274534-149274556 CCATATATATGGAGGGAACCTGG + Intergenic
1199942654 X:152640224-152640246 CCATGGGGAGGGAGGGGAGCAGG + Intronic
1200105243 X:153708472-153708494 CCATGTGTATGCAGGGGCTGGGG - Intronic