ID: 1172602602

View in Genome Browser
Species Human (GRCh38)
Location 20:36194341-36194363
Sequence TACCTTTAGCTCCTTGATCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172602602_1172602609 17 Left 1172602602 20:36194341-36194363 CCAAGATCAAGGAGCTAAAGGTA 0: 1
1: 0
2: 0
3: 19
4: 199
Right 1172602609 20:36194381-36194403 TACTCTCTGCCCTGGGGATCAGG 0: 1
1: 0
2: 1
3: 13
4: 207
1172602602_1172602607 10 Left 1172602602 20:36194341-36194363 CCAAGATCAAGGAGCTAAAGGTA 0: 1
1: 0
2: 0
3: 19
4: 199
Right 1172602607 20:36194374-36194396 TTTCTCATACTCTCTGCCCTGGG 0: 1
1: 0
2: 2
3: 24
4: 334
1172602602_1172602608 11 Left 1172602602 20:36194341-36194363 CCAAGATCAAGGAGCTAAAGGTA 0: 1
1: 0
2: 0
3: 19
4: 199
Right 1172602608 20:36194375-36194397 TTCTCATACTCTCTGCCCTGGGG 0: 1
1: 1
2: 2
3: 23
4: 306
1172602602_1172602606 9 Left 1172602602 20:36194341-36194363 CCAAGATCAAGGAGCTAAAGGTA 0: 1
1: 0
2: 0
3: 19
4: 199
Right 1172602606 20:36194373-36194395 CTTTCTCATACTCTCTGCCCTGG 0: 1
1: 0
2: 3
3: 28
4: 274
1172602602_1172602610 20 Left 1172602602 20:36194341-36194363 CCAAGATCAAGGAGCTAAAGGTA 0: 1
1: 0
2: 0
3: 19
4: 199
Right 1172602610 20:36194384-36194406 TCTCTGCCCTGGGGATCAGGAGG 0: 1
1: 0
2: 2
3: 24
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172602602 Original CRISPR TACCTTTAGCTCCTTGATCT TGG (reversed) Exonic
900006061 1:52643-52665 AACATTTATCTTCTTGATCTGGG + Intergenic
903942518 1:26941602-26941624 ATCAGTTAGCTCCTTGATCTGGG - Exonic
906559049 1:46741030-46741052 TATCTTTATCACTTTGATCTAGG - Intergenic
908880146 1:68722850-68722872 TCCCTTTAGCTTCCTGATTTAGG - Intergenic
909701883 1:78534146-78534168 TTCCTTTAGCTCCATGTACTGGG + Intronic
910133086 1:83932845-83932867 CCCTTTAAGCTCCTTGATCTGGG - Intronic
911346864 1:96707772-96707794 CAACTTTAGCTCATTTATCTTGG + Intergenic
915047258 1:153028668-153028690 TACCTCTTTCTTCTTGATCTGGG - Intergenic
915651657 1:157316260-157316282 TACCTTTTGGTCTTTGATGTTGG - Intergenic
919832832 1:201554099-201554121 TGCCTTTATCTCCTGGAGCTGGG + Intergenic
921352995 1:214256695-214256717 TACTTTTAGGTCCATGCTCTTGG + Intergenic
921534477 1:216329318-216329340 TAACTTTAGATCCTGGATCCAGG - Intronic
1064588917 10:16868317-16868339 TACCTTCAACTTCTTGATATTGG - Intronic
1065238855 10:23685561-23685583 TGCCTTGATCTCCTTGATCTTGG - Intergenic
1066994073 10:42546922-42546944 TACCTTTAGTTCTTAGATTTAGG - Intergenic
1068094231 10:52470220-52470242 TACCTCTAGCTGAGTGATCTAGG + Intergenic
1068564556 10:58558764-58558786 TACTGTTAGCACCTTGATCTTGG - Intronic
1070301531 10:75207486-75207508 TCCCTTTAGCTTAATGATCTTGG + Intergenic
1072012755 10:91318046-91318068 TACTGTGAGCTCCTTGATGTAGG - Intergenic
1074077516 10:110142437-110142459 TAGCTCTAGCTCCTGGCTCTGGG - Intergenic
1074952203 10:118348382-118348404 TGCATTAAGCTCCTTGAACTAGG - Intergenic
1076087218 10:127644244-127644266 TCCTATTAGCACCTTGATCTTGG + Intergenic
1077534715 11:3118191-3118213 TCCCTTTAGCTTCGTGATTTTGG - Intronic
1077961321 11:7079185-7079207 TACGTTTATCTTCTTCATCTTGG + Intergenic
1078626059 11:12959299-12959321 TAGCTTTAGCTCCTTCATTTAGG + Intergenic
1078876857 11:15407929-15407951 TATATTTAGCTCCTTGATGAGGG + Intergenic
1080707751 11:34713815-34713837 GACCTTTAGCCCCTTGGTTTTGG + Intergenic
1081362137 11:42193138-42193160 AACCTCTAGATCCTTGATCTCGG + Intergenic
1084073584 11:66754631-66754653 TATCTTTAGGTCTTTGCTCTTGG + Intronic
1085548154 11:77340318-77340340 TTCCTTTATCTCTTTTATCTGGG - Intronic
1086188486 11:84049694-84049716 TTTCTTTATCTCCTTAATCTGGG + Intronic
1086991901 11:93313051-93313073 GACCTTTAGCCCCTTCATTTTGG - Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1088149572 11:106727479-106727501 TGACCTTAGCTTCTTGATCTTGG + Intronic
1088617746 11:111648341-111648363 CACCATTGGCACCTTGATCTAGG - Intronic
1089682633 11:120127792-120127814 TACCTGTGGCTCCTTCCTCTTGG + Intronic
1092908295 12:13122438-13122460 ATCTTCTAGCTCCTTGATCTTGG - Intronic
1094112190 12:26873752-26873774 TTGCTTTATCTCTTTGATCTGGG - Intergenic
1095601607 12:44019478-44019500 GATCTTTAGCTTCCTGATCTGGG + Intronic
1095701804 12:45198270-45198292 TACGTTTAGCACCCAGATCTTGG - Intergenic
1096060173 12:48691649-48691671 TAGCTTTAGGTTCTTGATCGAGG - Exonic
1096345877 12:50846264-50846286 TAGCTTTAGCTCTTAGATTTAGG + Intronic
1097735881 12:63180077-63180099 TGCCTTTAGCCCCTTCATTTTGG + Intergenic
1098497878 12:71157618-71157640 TACCTTCAACTTCTTGTTCTGGG - Exonic
1099454710 12:82849826-82849848 TGCCTTTATCTCCTTGATTTTGG + Intronic
1099543040 12:83938759-83938781 TACCATTAGCTTCATGATGTTGG - Intergenic
1100079829 12:90835181-90835203 TCCCTTTAGCTCAGTGATTTTGG - Intergenic
1104030248 12:125059910-125059932 TCCCTTTAGCTTCATGATTTTGG + Intergenic
1104348240 12:128021823-128021845 TACCTTTAAGTCCTTGCTTTTGG - Intergenic
1104495969 12:129239347-129239369 TACATTTAGGTCTTTAATCTAGG + Intronic
1104659398 12:130599847-130599869 TACCTTTAGCTTAGTGATTTGGG - Intronic
1105748547 13:23400080-23400102 TACAATTATCTCCTGGATCTGGG + Intronic
1106000166 13:25714815-25714837 TACTTTTATCTCCATGTTCTTGG + Intronic
1108757312 13:53519411-53519433 TATTTTTAGCACCTTGGTCTTGG - Intergenic
1108847471 13:54694837-54694859 TACCTTTAGCTTAGTGATTTTGG - Intergenic
1108943907 13:55997160-55997182 TTCCTCTAATTCCTTGATCTTGG + Intergenic
1109434144 13:62276257-62276279 TCCCTTTAGCTTCCTGATTTTGG + Intergenic
1110910383 13:80953951-80953973 TGCCTTTAGCTTCTTCATTTGGG - Intergenic
1110969301 13:81740757-81740779 TCCCTTTAGCTTCGTGATTTGGG - Intergenic
1111343191 13:86914462-86914484 GTCCTTTAGCCCCTTGATTTTGG + Intergenic
1113233676 13:108243801-108243823 TACTTGGAGTTCCTTGATCTTGG - Intergenic
1113334862 13:109367909-109367931 TTCCTGTAGCCCCTTGCTCTTGG + Intergenic
1114046794 14:18882335-18882357 TGCCTTTAGCTCCTGGATCCTGG - Intergenic
1114117419 14:19637111-19637133 TGCCTTTAGCTCCTGGATCCTGG + Intergenic
1114548617 14:23520729-23520751 CAGCTTTAGCTCCTTGCTATGGG - Intergenic
1115068749 14:29296453-29296475 GACCTGTAGCTCCTTCATTTTGG - Intergenic
1116378622 14:44235221-44235243 TTCCTATAGGTCATTGATCTTGG - Intergenic
1116637743 14:47418422-47418444 AACTTTCAGCACCTTGATCTTGG - Intronic
1117188070 14:53262014-53262036 TACCTTTAGCTTAGTGATTTTGG + Intergenic
1118199240 14:63657005-63657027 TACTTTTAGTTGCTGGATCTTGG + Intergenic
1120759592 14:88273715-88273737 CACCTTTAGGGCCTTGATCATGG - Intronic
1124616714 15:31247570-31247592 TGCCTTTTGCTCCCTCATCTCGG + Intergenic
1124962660 15:34410091-34410113 TACCTTTAGCCCCGTGACCATGG - Intronic
1124979285 15:34556313-34556335 TACCTTTAGCCCCGTGACCATGG - Intronic
1127043538 15:55002648-55002670 GGCCTTTAGCTCCTTCATTTTGG - Intergenic
1127727963 15:61769062-61769084 TGCCTTTAACTCCCTGTTCTGGG - Intergenic
1129186045 15:73907196-73907218 TATATTTAGCTGCTTGCTCTGGG - Intergenic
1130832176 15:87612158-87612180 CACTTGTAGCTCCTGGATCTGGG - Intergenic
1132447457 15:101938280-101938302 AACATTTATCTTCTTGATCTGGG - Intergenic
1135618317 16:23931253-23931275 CACCTTTAGCTCCAGAATCTTGG - Intronic
1138011816 16:53388370-53388392 AACCTTTAGCTCTTTGTTGTAGG + Intergenic
1138643496 16:58405275-58405297 TCCCTTTTCCTCCTTTATCTGGG - Exonic
1141214425 16:82010466-82010488 TCCCTTTAGCTTAGTGATCTTGG - Intronic
1142138846 16:88463642-88463664 GAGCTTGAGCTCCTAGATCTGGG + Intronic
1143248319 17:5503862-5503884 TACCTTTAGCTCCTGCTTCTGGG + Intronic
1143709713 17:8725918-8725940 TACCTTCATCTTCTTGTTCTTGG + Intergenic
1148503412 17:48108771-48108793 TAACTTTAGTTCTCTGATCTGGG - Intronic
1149214501 17:54338142-54338164 TACCTTTAGCTTCTTAATCAAGG - Intergenic
1149278451 17:55072442-55072464 TAACTTTAGCCCCTGGAGCTTGG + Intronic
1149902442 17:60492633-60492655 GGCCTTTAGCTCCTTCATTTTGG + Intronic
1151026684 17:70685400-70685422 TAATCTTAGCTCCTTAATCTTGG - Intergenic
1154941547 18:21117882-21117904 TATGTGTAACTCCTTGATCTGGG - Intergenic
1159738110 18:72129430-72129452 TAGCTTTAGCTCTTTTATGTAGG + Intergenic
1159918201 18:74204268-74204290 TCCCTTTAGCTCAGTGATTTTGG - Intergenic
1160637816 19:94253-94275 AACATTTATCTTCTTGATCTGGG + Intergenic
1163210829 19:15838973-15838995 TCCCTTTAGCTCAGTGATTTTGG + Intergenic
1165399290 19:35587403-35587425 TCCCTTTAGCTCCTTGACACTGG + Intergenic
928132003 2:28658704-28658726 TACCCTTCTCTTCTTGATCTTGG - Intergenic
929776744 2:44935016-44935038 CACTCTTAGCTCCTTGGTCTGGG - Intergenic
931390838 2:61842622-61842644 TACCTTTTGTTGGTTGATCTGGG - Intronic
931926314 2:67076398-67076420 TACCATTGGCTCCTTGTTCAAGG - Intergenic
935922957 2:108034814-108034836 TGCCTTTAGCTCCTTGAGGCAGG + Intergenic
937702935 2:124884598-124884620 TATCTTTAGCTCATTTATCTTGG + Intronic
939541179 2:143496084-143496106 AACCTTAAGCTTCTTTATCTCGG + Intronic
942212334 2:173684103-173684125 AAACTTGAGCTCCTTTATCTTGG - Intergenic
942678711 2:178454735-178454757 ATCAGTTAGCTCCTTGATCTGGG - Intronic
942733288 2:179082320-179082342 GGCCTGTAGCTCCTTGATTTTGG - Intergenic
942894729 2:181038490-181038512 TAGCTTTAGCTCCTACATTTAGG - Intronic
944385659 2:199161214-199161236 TATGTTTAGCTCCTTGCACTGGG - Intergenic
944589073 2:201200494-201200516 GACCTGTAGCTCCTGGAGCTTGG + Intronic
945869645 2:215213359-215213381 TGCCTTTAGCTTATTGATTTGGG - Intergenic
1169052193 20:2589554-2589576 TTTCTTTATCTCCTGGATCTTGG + Intronic
1172602602 20:36194341-36194363 TACCTTTAGCTCCTTGATCTTGG - Exonic
1173350984 20:42245338-42245360 TACCTTTGGCTGTTTGAACTGGG - Intronic
1175537916 20:59728236-59728258 TTCGTTTAGCACCATGATCTTGG + Intronic
1176421880 21:6522755-6522777 TCCCTTTAGCTTCGTGATTTTGG + Intergenic
1178603079 21:34011959-34011981 CACATTTAGCACCTAGATCTTGG - Intergenic
1179697370 21:43131071-43131093 TCCCTTTAGCTTCGTGATTTTGG + Intergenic
1180465330 22:15604974-15604996 TGCCTTTAGCTCCTGGATCCTGG - Intergenic
1181661720 22:24355309-24355331 CACATTTAGCACCTGGATCTTGG - Intronic
1181951887 22:26560043-26560065 TAACTTTGGGTCCTTGAGCTCGG + Intronic
1182089910 22:27587329-27587351 CAGATGTAGCTCCTTGATCTTGG - Intergenic
1183758518 22:39793630-39793652 TACATTTAGCTCTTTAATCCGGG + Intronic
1184530576 22:45052639-45052661 TCCCTTTAGCTTAGTGATCTGGG - Intergenic
1185282331 22:49978702-49978724 TAGCTTTAGCTCTTTCATTTAGG + Intergenic
949590617 3:5490632-5490654 TACCTGAATCTCCTTTATCTGGG - Intergenic
949695169 3:6685699-6685721 TAGCTTAACTTCCTTGATCTGGG + Intergenic
951185846 3:19712207-19712229 AAACCTTAGCTCCTTCATCTGGG + Intergenic
952202593 3:31147072-31147094 GACCTTTAGCCCCTTCATTTTGG - Intergenic
954518137 3:51198307-51198329 TCTCTTTACCTCCTTGTTCTGGG + Intronic
955251465 3:57287292-57287314 TATCTTTAGCTCTTTCTTCTTGG + Intronic
957816193 3:85300603-85300625 GACCTCTAGTTTCTTGATCTTGG - Intronic
959716512 3:109439331-109439353 AATCTTTGGCACCTTGATCTTGG + Intergenic
960254038 3:115491252-115491274 TACCTGTGGCTCCTGGCTCTGGG - Intergenic
962766458 3:138568207-138568229 TGCCTTTAGCTCTTTGTTCCAGG - Intronic
963564098 3:146906102-146906124 TACCATTGGCACCTTGATCTTGG - Intergenic
963669251 3:148231344-148231366 TCCCTTTAGCTTCGTGATTTTGG - Intergenic
965355199 3:167664791-167664813 TTCCTATGGCTCCATGATCTAGG - Intergenic
970353419 4:15228779-15228801 TGCCTTTATCTCCATGGTCTTGG + Intergenic
972802517 4:42491989-42492011 TACCATTAGCTGCTTCATGTCGG - Intronic
972866953 4:43244482-43244504 TTCCTGTAGCTCCTTGACATGGG - Intergenic
974088666 4:57287877-57287899 TTCCTTTAGTCCTTTGATCTGGG - Intergenic
974350468 4:60737528-60737550 TACATGTAGTTCCTTTATCTAGG + Intergenic
974430007 4:61784251-61784273 TAATTTTAGATCCTTGATATAGG - Intronic
976802525 4:89008455-89008477 TACTTCCAGCACCTTGATCTTGG + Intronic
977265019 4:94843810-94843832 CACCTTTGCCTCCTTGATTTTGG + Intronic
977502532 4:97859277-97859299 TACCTGTAGATTCTTGATATTGG + Intronic
978262750 4:106781158-106781180 TACTTTTAGCTCTTTCATTTAGG + Intergenic
978951322 4:114562520-114562542 TCCCTTTAGCTCAGTGATTTTGG + Intergenic
981670213 4:147278225-147278247 TACCTTTAGAACCTTGCACTTGG + Intergenic
982631518 4:157835504-157835526 TACCTCTTGCTCATTGATGTTGG - Intergenic
984730866 4:183066794-183066816 TCCCTCCAGCACCTTGATCTTGG + Intergenic
987987321 5:25163746-25163768 TCCCTTTAGCTTAGTGATCTTGG + Intergenic
990077900 5:51873598-51873620 GACCTTTAGCCCCTTCATTTTGG + Intergenic
991282314 5:64929251-64929273 TACATTTAGCACCCAGATCTTGG + Intronic
992367557 5:76108721-76108743 TATCTTTTGCTGCTTGACCTGGG + Intronic
993426103 5:87765981-87766003 TACTTTTATCTCCTTCATTTCGG - Intergenic
993618684 5:90142972-90142994 CATCTTTAGCTCCTGGACCTTGG - Intergenic
994488810 5:100415509-100415531 TACTTTTCTCTCCATGATCTTGG - Intergenic
994570810 5:101511308-101511330 TATCTTTAGTTCTTTCATCTTGG - Intergenic
995380357 5:111524825-111524847 AACCTGCAGCTCCTTGATCTTGG + Intergenic
1000586796 5:163110171-163110193 TACCTTTGGCTCCCTTTTCTGGG - Intergenic
1002658531 5:180773185-180773207 TTCCTTTAGCTCCGTGATTTTGG - Intergenic
1004646831 6:17570314-17570336 TTCCTTTAGCTTCGTGATTTTGG + Intergenic
1005390226 6:25325314-25325336 TACCATGAGCTGCTTAATCTGGG + Intronic
1006597169 6:35201954-35201976 AACCTTAACCTCCCTGATCTGGG + Intergenic
1006597870 6:35206711-35206733 TACCTCTGGCTGCTTTATCTAGG + Intergenic
1010457293 6:76072419-76072441 TACCTTTGGTTCCTTGAACTTGG + Exonic
1014102384 6:117526137-117526159 AACCTTTATCTACTTGTTCTAGG + Intronic
1014934252 6:127367788-127367810 TACCTTTAGCTCTTACATTTAGG + Intergenic
1017562558 6:155644609-155644631 TGCCTTTAGCTCCTCAATCAAGG - Intergenic
1018108303 6:160510160-160510182 TTCCTTTATTTCCTTGATTTGGG + Intergenic
1018135489 6:160774810-160774832 TTCCTTTATTTCCTTGATTTGGG - Intergenic
1019889103 7:3931461-3931483 TACTTATAGTTCCTTGATGTTGG - Intronic
1020865933 7:13562319-13562341 TAAATTTAGTTCCTTTATCTGGG - Intergenic
1022087660 7:27084603-27084625 CATCTTTAGCTCCTTTATCATGG + Intergenic
1022398011 7:30008276-30008298 TACCTCCAGCTCCTTGCTTTAGG - Intergenic
1023306387 7:38833038-38833060 TACCTTTTTCTAGTTGATCTGGG + Intronic
1023335569 7:39165672-39165694 TATCTTAAGCATCTTGATCTTGG - Intronic
1023477110 7:40592789-40592811 TCTCTTTACCTCCTTGATCATGG - Intronic
1023584899 7:41719001-41719023 TTCCTGCGGCTCCTTGATCTGGG - Intergenic
1024013415 7:45290286-45290308 TCCCTTTAGCTTGTTGATTTGGG - Intergenic
1027419291 7:78004240-78004262 TACCATTAGGTCCTTGATGATGG + Intergenic
1027444082 7:78252538-78252560 TACCTTTAGCTCTTTTATTTAGG - Intronic
1027730831 7:81870300-81870322 AATCTGTAGCTCCTTGATATTGG - Intergenic
1030766463 7:113416257-113416279 TAGCCATAGCTCCTTGCTCTAGG + Intergenic
1031089183 7:117333133-117333155 AACTTTTACCTCCTTCATCTTGG - Intergenic
1032531948 7:132629105-132629127 TACCTTTAGATCTTTTCTCTTGG + Intronic
1033475662 7:141689677-141689699 TTCTTTCAGCTTCTTGATCTGGG - Intronic
1036066540 8:5387090-5387112 CTCCTTTTGTTCCTTGATCTGGG + Intergenic
1036986872 8:13542186-13542208 TACCTTTAGCTCTTATATTTTGG + Intergenic
1039313344 8:36344066-36344088 TACTGCTAGCACCTTGATCTTGG - Intergenic
1042500657 8:69505021-69505043 TACCTGTAGCTCATTGAACTTGG + Intronic
1042804922 8:72760768-72760790 TACTTTGAGCTGCATGATCTTGG + Intronic
1044477453 8:92645228-92645250 TCCTGTTAGCACCTTGATCTTGG - Intergenic
1047679339 8:127237855-127237877 TACGTTTAGTACCTTGGTCTTGG + Intergenic
1055900650 9:81230485-81230507 TACTTTTAGCTCCTGCATTTAGG + Intergenic
1187137789 X:16565033-16565055 TACATTTAGCTCATTGCTTTGGG - Intergenic
1189023219 X:37364160-37364182 TACCATTAGCTCCTTAATATAGG - Intronic
1189126912 X:38457994-38458016 TACCTTTGGCTCCATCCTCTGGG + Intronic
1189551448 X:42097857-42097879 TAACTTAAGCTACTTGCTCTAGG + Intergenic
1189662352 X:43314303-43314325 TATCTTTACCTCCTTGGTCTTGG + Intergenic
1190284726 X:48954589-48954611 TGTCTTGAGCTCCTTGTTCTTGG - Intronic
1190984244 X:55487088-55487110 TACCTTTATCTCCTTTCCCTTGG - Exonic
1191612708 X:63134244-63134266 TCCCTTTAGCTCAGTGATTTGGG - Intergenic
1191623589 X:63244682-63244704 TCCCTTTAGCTCAGTGATTTGGG + Intergenic
1192674689 X:73183379-73183401 TACCTTTGGGTCTTTGATGTTGG - Intergenic
1193181012 X:78456601-78456623 TCCCTTTAGCTGGTTGATTTGGG + Intergenic
1193264365 X:79451101-79451123 TCCCTTTAGCTTAGTGATCTGGG + Intergenic
1195254062 X:103076510-103076532 TACCTTTAGCTTAGTGATTTTGG - Intronic
1195307374 X:103597397-103597419 TACTATCAGCTCTTTGATCTTGG + Intergenic
1195480148 X:105335481-105335503 TTGCTTTAGCTCCTAGCTCTTGG + Intronic
1196981469 X:121218734-121218756 TACTTATAGCTCTCTGATCTTGG + Intergenic
1197426700 X:126305584-126305606 GACCTGTAGCTCCTTCATTTTGG + Intergenic
1198689922 X:139269750-139269772 TATCGTTACATCCTTGATCTAGG + Intergenic
1198853811 X:140995056-140995078 TCCCTTTAGCTCAGTGATTTAGG - Intergenic
1199069178 X:143456635-143456657 TCCCTTTTGCTCCTTGTTCCTGG + Intergenic
1199222792 X:145337012-145337034 TCCCTTTAGCTCAGTGATTTGGG - Intergenic
1201638056 Y:16147245-16147267 TACCTGTAGCTGCTTTATTTAGG - Intergenic