ID: 1172606148

View in Genome Browser
Species Human (GRCh38)
Location 20:36215460-36215482
Sequence CTATGTGTATGTCAGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172606148_1172606155 16 Left 1172606148 20:36215460-36215482 CCAACCTCCTGACATACACATAG 0: 1
1: 0
2: 1
3: 28
4: 226
Right 1172606155 20:36215499-36215521 ATCTAGACTAGCCAGCAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 74
1172606148_1172606154 12 Left 1172606148 20:36215460-36215482 CCAACCTCCTGACATACACATAG 0: 1
1: 0
2: 1
3: 28
4: 226
Right 1172606154 20:36215495-36215517 ATCAATCTAGACTAGCCAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172606148 Original CRISPR CTATGTGTATGTCAGGAGGT TGG (reversed) Intronic
903805670 1:26004056-26004078 CTATGTGAAGATGAGGAGGTTGG - Intergenic
903887224 1:26547503-26547525 CAATGTGTTTGTCAGGGGGCGGG + Intronic
905669223 1:39780199-39780221 CTCTGTGCATCTCAGGAAGTGGG + Intronic
907561773 1:55397531-55397553 CTATGTGTATGTGAGGGTGTTGG - Intergenic
911615778 1:100009273-100009295 CTATTTGTGTTTCAGTAGGTCGG + Intronic
912157345 1:106938040-106938062 ATGTGTGTGCGTCAGGAGGTGGG - Intergenic
913192608 1:116426286-116426308 GTGTGTGTATGTGGGGAGGTAGG + Intergenic
914046646 1:144099276-144099298 CTATGTGTTTTTAAGGAGGCCGG + Intergenic
914131464 1:144861410-144861432 CTATGTGTTTTTAAGGAGGCCGG - Intergenic
915020525 1:152775036-152775058 CTATGTGGGTGTCGGGAGGCAGG + Intronic
916323646 1:163533464-163533486 CTCTGTGTATGGCAGGGCGTAGG + Intergenic
917223268 1:172754401-172754423 CCATGTTTATGTGAGGAGTTAGG - Intergenic
920044384 1:203124161-203124183 CTGTGTGTTTGTGAGGCGGTGGG - Intronic
920774154 1:208919830-208919852 CTATGTGGATGTCTGGATGAAGG + Intergenic
921280300 1:213560142-213560164 GTATGTGTATATCAGGGGCTGGG - Intergenic
921336038 1:214087375-214087397 CTGTGTATATGCCAGGAGCTTGG + Intergenic
921707697 1:218343206-218343228 GTATGTCTATGTCAGGAAGAGGG + Intergenic
922062031 1:222102000-222102022 CTGTGTGTTTGTCAGGGGCTGGG - Intergenic
1064641256 10:17417905-17417927 AGAGGTGTATGTGAGGAGGTAGG + Intronic
1066164008 10:32766103-32766125 ATATTTGCATGTCAGAAGGTGGG + Intronic
1066667313 10:37797270-37797292 ATATATGTATATCATGAGGTAGG - Intronic
1067603353 10:47633800-47633822 CTAGGGGGATGTCAGGGGGTAGG - Intergenic
1069149261 10:64935122-64935144 CTTTGTTTATGTGAGGAGGTGGG + Intergenic
1069533439 10:69235543-69235565 AGATGTGTATGTCAGGGGGTTGG + Intronic
1069662598 10:70133275-70133297 TTATGTGTATGTCTGAAGGAAGG - Intergenic
1070375810 10:75830287-75830309 CTTTGTGTATGCCAGGGGTTTGG + Intronic
1070565410 10:77600373-77600395 CGAGGTGTATGTCAGGTGCTTGG - Intronic
1072696440 10:97607230-97607252 CTGTGTGTCTGGCAGCAGGTGGG + Intronic
1073318227 10:102597771-102597793 GTATCTATATGACAGGAGGTGGG - Intronic
1075022025 10:118959158-118959180 CTATGTGTATGGGGGGTGGTGGG - Intergenic
1075516195 10:123110306-123110328 CTATGTGTAACTCAGCAGGTGGG - Intergenic
1077205495 11:1340944-1340966 CTCTGTGTGTGTCTGGATGTGGG - Intergenic
1078689484 11:13564679-13564701 CTATCTATAAGTCAGGAGCTGGG - Intergenic
1079701392 11:23553008-23553030 CTCTGTGTGTGTGAGGGGGTGGG + Intergenic
1083504947 11:63147789-63147811 CCGTTTGTATGTCAGGAGGTTGG - Intronic
1083517067 11:63270000-63270022 CTGTCTGTATGTCAAGAGTTTGG - Intronic
1083919669 11:65775538-65775560 CTTTGTGGGTGTCAGGAGGCAGG + Intergenic
1085413922 11:76307733-76307755 CTGTGTGTGTGTTGGGAGGTGGG - Intergenic
1085871049 11:80349606-80349628 CTGTGTGTATGTCAGTGGGGAGG - Intergenic
1087040284 11:93792611-93792633 TTTTGTGTAGGTCAGGAGTTTGG - Intronic
1087591859 11:100199419-100199441 ATATGTGGCGGTCAGGAGGTTGG - Intronic
1087984947 11:104666520-104666542 CTGTGTGTATGTCGTGGGGTGGG + Intergenic
1088580383 11:111310118-111310140 CTTTGTGTATATGAGGAAGTTGG - Intergenic
1090168091 11:124572533-124572555 CTAAGTGTTAGTAAGGAGGTAGG + Intergenic
1091415612 12:280477-280499 GTATGTGTATGTTAGGAGGAGGG - Exonic
1093884333 12:24441957-24441979 CTTTGTGGATTTAAGGAGGTAGG + Intergenic
1096028432 12:48388745-48388767 ATATGAGTATGTAAGTAGGTGGG - Intergenic
1096706630 12:53425956-53425978 CTGTGTGTATGTATAGAGGTGGG + Intronic
1098486752 12:71030391-71030413 ATATGTTTTTGTCATGAGGTGGG + Intergenic
1099358887 12:81673078-81673100 CTAGGTGTAAGTCAACAGGTAGG - Intronic
1100665838 12:96752144-96752166 CTATGTGAATGGCAGGATGATGG - Intronic
1100974092 12:100103078-100103100 CTATGTGTATTACAGGTGTTGGG + Intronic
1102817353 12:115877860-115877882 TTATGTGTATCTCAGAAGGCAGG - Intergenic
1105702988 13:22947837-22947859 CTATGTGTATATGTGGGGGTGGG - Intergenic
1105855740 13:24370634-24370656 CTATGTGTATATGTGGGGGTGGG - Intergenic
1107245228 13:38286071-38286093 CTATCTGTAAATCAGGAAGTGGG + Intergenic
1107290276 13:38844609-38844631 TTATGTGTCTGTGAGGAGTTGGG + Intronic
1108019508 13:46112450-46112472 CTATGTGTGTGTTGGGGGGTGGG + Intergenic
1108423524 13:50274611-50274633 CTATGTGTCTATCAGCAGGCTGG - Intronic
1109743939 13:66595268-66595290 ATATCTTTATGACAGGAGGTAGG - Intronic
1111495209 13:89039145-89039167 GTATGTGTGTGTGAGGGGGTTGG - Intergenic
1113964024 13:114142237-114142259 CTATGTGTATGTGTGCATGTGGG - Intergenic
1114376399 14:22151299-22151321 ATATCTTTATGACAGGAGGTTGG - Intergenic
1114966200 14:27963818-27963840 CTACGTGTATGTTATGAAGTAGG - Intergenic
1116691778 14:48117033-48117055 ATATGTTTATTTCAGGAGATTGG - Intergenic
1122268071 14:100556009-100556031 CTATGTGTATGTAGTGAGGGAGG + Intronic
1122844630 14:104486077-104486099 CTATGTGTATATGTGGGGGTGGG - Intronic
1126459272 15:48897746-48897768 GTGTGTGTGTGTCAGAAGGTGGG - Intronic
1129590508 15:76910925-76910947 ATGTGTGGAAGTCAGGAGGTGGG - Intergenic
1130147588 15:81286148-81286170 CTGTGGGAATGTCTGGAGGTAGG + Intronic
1130875675 15:88011996-88012018 CTGTGTGTCTGTCATAAGGTGGG - Intronic
1131107789 15:89746546-89746568 CTGTGTGTATGTGTGGAGGTTGG - Intergenic
1133542893 16:6773405-6773427 CTATGTGTATGTGTGGGAGTTGG + Intronic
1134871293 16:17654497-17654519 CTATGTGTATGTGAGGGGGAGGG + Intergenic
1135407365 16:22207543-22207565 GTATGTATATGTCAGGTGCTTGG + Intronic
1135782929 16:25322021-25322043 CTATGTGTGTGTCGGGGGGGTGG + Intergenic
1137354898 16:47752033-47752055 CTATGTATATGTCAGCAGATTGG + Intergenic
1141391286 16:83666808-83666830 GTGTGTGTATGTGTGGAGGTGGG - Intronic
1141770586 16:86087372-86087394 AAATGGGTATGTCGGGAGGTCGG + Intergenic
1142761509 17:2044685-2044707 GTGTGTGTGTGTCAGGGGGTGGG - Intergenic
1143969479 17:10784933-10784955 GTATGTGTATGTATGGAGGGAGG + Intergenic
1148518124 17:48241344-48241366 CTGTGTGCATGTGTGGAGGTGGG + Intronic
1150624218 17:66831126-66831148 ACGTGTGTATGTCAGGAGGCTGG - Intergenic
1150950383 17:69797557-69797579 CTTCCTGTATGTCAGGACGTGGG + Intergenic
1151694265 17:75706110-75706132 CCATGTGTGTGGCAGGAGGCAGG - Intronic
1153356119 18:4137294-4137316 CTTTGTATATGCCAAGAGGTAGG + Intronic
1153744449 18:8162783-8162805 TTACGTGTGTTTCAGGAGGTGGG + Intronic
1155767935 18:29659154-29659176 GTATGTGTATGTATGGGGGTGGG + Intergenic
1157058486 18:44258133-44258155 CCATGTGGATGTCAGCAGGCAGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158439621 18:57463107-57463129 TTTTGTGTATGACATGAGGTAGG + Intronic
1159150858 18:64521996-64522018 ATATGTATATATCAGGATGTGGG - Intergenic
1160509250 18:79444057-79444079 CTCTGGGTCTGTCAGGAGGCTGG + Intronic
1163255704 19:16154492-16154514 GTATGTATATGACAGGAGGCTGG + Intronic
1165069348 19:33246888-33246910 ATATGTGTATGGGAGGAGGAAGG + Intergenic
1165194052 19:34087416-34087438 GTATGTGAATACCAGGAGGTGGG + Intergenic
1166437470 19:42780593-42780615 CTATGTGTATATCAGGTGGAGGG + Intronic
1166466363 19:43035258-43035280 CTATGTGTATATCAGGTGGAGGG + Intronic
1166472516 19:43091330-43091352 CTATGTGTATATCAGCTGGAGGG + Intronic
1166486162 19:43214676-43214698 CTATGTGTATATCAGGTGGAAGG + Intronic
1166493277 19:43278318-43278340 CTATGTGTATATCAGGTGGAGGG + Intergenic
1167789589 19:51665348-51665370 CTTTGTGTATGGTATGAGGTAGG + Intergenic
1202686200 1_KI270712v1_random:52690-52712 CTATGTGTTTTTAAGGAGGCCGG + Intergenic
927250636 2:20992274-20992296 CTTTGTGTCTGTCAGAAGGTAGG - Intergenic
927381929 2:22489260-22489282 CTATGGGTAGGGCAGGAGGTTGG + Intergenic
927816339 2:26220922-26220944 ACATGTGTCTGTCAGAAGGTGGG + Intronic
928436517 2:31257977-31257999 CTATCTGTAAATCAGGAAGTTGG + Intronic
930996778 2:57729035-57729057 AGATGTGAATATCAGGAGGTAGG + Intergenic
931167004 2:59758974-59758996 CTAGGTCTACATCAGGAGGTTGG + Intergenic
931848934 2:66233840-66233862 CTATGTGTATTTGAGGAAGGAGG + Intergenic
931888708 2:66646495-66646517 CTATGTGTGTCTCTGCAGGTGGG + Intergenic
933615883 2:84482107-84482129 CTGTGTTTGTGTCAGGAGGTGGG - Intergenic
934245523 2:90302130-90302152 CTATGTGTTTTTAAGGAGGCCGG - Intergenic
934263223 2:91494909-91494931 CTATGTGTTTTTAAGGAGGCCGG + Intergenic
934947862 2:98554858-98554880 CTATGTGTATTTGGGGACGTGGG + Intronic
936717365 2:115203640-115203662 CTATGTGTATGTCTGGGTGTGGG - Intronic
938595818 2:132786137-132786159 CTATGTGTCTTTCAAGAGCTAGG - Intronic
938796810 2:134724563-134724585 CTATGTTAGTGTCAGGAGTTGGG - Intergenic
939136420 2:138300099-138300121 GTATGTATATGTCAGAATGTTGG - Intergenic
941878887 2:170461822-170461844 GTATGTATATGTATGGAGGTCGG + Intronic
943794082 2:191969839-191969861 CTATGAGTATTTCTGAAGGTGGG + Intronic
943888003 2:193247923-193247945 CTGTGTGTGTGTCTGGAGATGGG - Intergenic
944261434 2:197682029-197682051 TTTTGTGTATAGCAGGAGGTAGG - Intergenic
945929311 2:215839500-215839522 CTATGTGTAGTTCAGGAGCTGGG + Intergenic
947562530 2:231169500-231169522 ATATGTGTGTGTCAGGAGAAGGG + Intronic
947694107 2:232168679-232168701 CTATGTGTGGGTCAGGTGGTAGG - Intronic
1168868529 20:1109296-1109318 CTGTGTGTATGTAGGGTGGTGGG - Intergenic
1169198625 20:3696957-3696979 CTGTGTGTGTGGCAGGAGGTGGG - Intronic
1169598097 20:7224021-7224043 TTTTGTATATGTCAGGAGTTAGG + Intergenic
1169986167 20:11447359-11447381 CTGTGTGTATGTCAGAGGGAGGG + Intergenic
1171423835 20:25037194-25037216 CTAGGTGGATGCCAGGAGGAAGG - Intronic
1171431554 20:25086028-25086050 GTGTGTGTTTGTCAGGGGGTGGG - Intergenic
1172012431 20:31853357-31853379 CTTTGTGTATGACAATAGGTAGG - Intronic
1172606148 20:36215460-36215482 CTATGTGTATGTCAGGAGGTTGG - Intronic
1172783431 20:37450707-37450729 CTCAATGTATGTCAGGTGGTAGG - Intergenic
1177779047 21:25603304-25603326 CTATGTGAATGTTAACAGGTAGG + Intronic
1178945806 21:36946793-36946815 CTGTGTGTCTGCGAGGAGGTGGG - Intronic
1180930164 22:19584755-19584777 CTAAGTGTTTGTAATGAGGTAGG + Intergenic
1181381292 22:22506895-22506917 CTATGTGAATTCCAGGAAGTGGG - Intronic
1181887925 22:26036363-26036385 CTGTGTGTCTGTGAGGAGATAGG + Intergenic
1182597753 22:31435280-31435302 ATATGTGTATATATGGAGGTGGG + Intronic
1182718340 22:32377755-32377777 CAGTGTTCATGTCAGGAGGTTGG + Intronic
1183123798 22:35754852-35754874 ATATCTGTAAGTTAGGAGGTTGG + Intronic
1184303277 22:43576720-43576742 CTATTTGGATGTGAGGAGGAAGG + Intronic
1184307384 22:43614981-43615003 CTCTGTGCAGGACAGGAGGTTGG + Intronic
1184453077 22:44594387-44594409 CTATGAGTAGGTGAGGAGGGAGG - Intergenic
949380937 3:3445017-3445039 CTTTTTGTATCTCAGGAGGCTGG - Intergenic
949615768 3:5752269-5752291 GTGTGTGTATGTGAGAAGGTGGG - Intergenic
950213447 3:11140640-11140662 CTAAGGGTATGACAGGAGGTAGG - Intronic
951858010 3:27219280-27219302 ATATCTTTATGACAGGAGGTAGG - Intronic
952277333 3:31890053-31890075 CTTTGTGAAGGTCAGGAAGTCGG + Intronic
952900866 3:38110993-38111015 CTATGTGTATGTGTGTATGTGGG - Intronic
952933894 3:38380383-38380405 CTAAGGGTCTGTAAGGAGGTTGG + Intronic
953600228 3:44355873-44355895 CTAAGTGTATGTCAGACGTTGGG + Intronic
953920601 3:46948793-46948815 CCATGTGTCTGTCAGGAGTGTGG + Intronic
954321146 3:49832799-49832821 CTCCTTGTATGACAGGAGGTGGG - Intronic
956734459 3:72227465-72227487 GTGTGTGTATGTGTGGAGGTGGG - Intergenic
957136544 3:76295926-76295948 CTATGTGTACGTGGGGAGGGTGG - Intronic
957343131 3:78926698-78926720 GTATGTGAATGCAAGGAGGTGGG + Intronic
960995618 3:123338352-123338374 CTTTGTCTCTGACAGGAGGTGGG - Intronic
961100127 3:124191477-124191499 GGAGCTGTATGTCAGGAGGTAGG + Intronic
961365260 3:126395424-126395446 CCAAGGGTATGTCAGGAGCTTGG + Intronic
961657435 3:128451089-128451111 CTACGTGACTGGCAGGAGGTTGG - Intergenic
963588267 3:147222722-147222744 CTGTGTGTATTTCAGGAGATAGG - Intergenic
964289652 3:155163180-155163202 CTATGTGTGTGTATGGAGGGAGG - Intronic
967366880 3:188697137-188697159 CGGTGTGTCTGTCAGAAGGTAGG + Intronic
969157786 4:5227100-5227122 CTATGTATCTGTCAGAAGTTAGG - Intronic
969426695 4:7128574-7128596 GTGTGTGTGTGTCAGGGGGTGGG + Intergenic
970898676 4:21133227-21133249 CATTGTGTATGTGAGGAAGTAGG - Intronic
975735193 4:77373732-77373754 CTGTGTGTGTGTTTGGAGGTGGG + Intronic
978879409 4:113683217-113683239 GTCTGTGTATGATAGGAGGTGGG - Intronic
981343115 4:143645558-143645580 CTATGTTTCAGTCATGAGGTAGG - Intronic
981521248 4:145664952-145664974 CAATCTGTGTTTCAGGAGGTGGG + Intergenic
983611183 4:169647048-169647070 CTATCTGAATGTCATGATGTAGG - Intronic
988001512 5:25355484-25355506 GTTTGTGTATGTTAGGAAGTGGG + Intergenic
988623327 5:32845697-32845719 CTAGATGTATCTCTGGAGGTGGG + Intergenic
988724264 5:33910072-33910094 CTAGGCATATGTCAGGAGCTGGG + Intergenic
989152513 5:38314431-38314453 TTATGTGAATGTGAGGATGTGGG + Intronic
989542215 5:42630805-42630827 TTATGTTTGTGTCAGGAGGATGG - Intronic
992366208 5:76092768-76092790 ATATGTGTATGGCGGGAGTTGGG - Intronic
992472117 5:77068325-77068347 CTATGTTTGTGTGATGAGGTGGG + Intergenic
995743556 5:115379686-115379708 CTAGGTTTATGTCAGGACCTGGG - Intergenic
996919955 5:128756416-128756438 CTGAGTATATGTGAGGAGGTAGG + Intronic
997058350 5:130471209-130471231 CTATATGCATGTGTGGAGGTAGG - Intergenic
998160457 5:139810042-139810064 CTATGTGGATTGCAGGGGGTGGG + Intronic
1001156393 5:169275991-169276013 CTGTGTGTATGTCAGTGTGTGGG + Intronic
1001241501 5:170074989-170075011 CAATATGTGTGCCAGGAGGTGGG - Intronic
1002255868 5:177958380-177958402 CCACGTGTGTGCCAGGAGGTGGG + Intergenic
1002321344 5:178377819-178377841 CTGTGTGTGTGGCAGGAGCTGGG + Intronic
1003339062 6:5202439-5202461 CTGTTTGTATGTAAGGAGGTTGG - Intronic
1003740288 6:8929449-8929471 GTATGTGTATGTGTGGAGGCAGG - Intergenic
1003997387 6:11556558-11556580 GTATGGGGATCTCAGGAGGTGGG + Intronic
1005442663 6:25887404-25887426 CCATTTGCAAGTCAGGAGGTGGG - Intergenic
1006624378 6:35386952-35386974 TTATATATTTGTCAGGAGGTGGG + Intronic
1006624384 6:35386990-35387012 TTATATATTTGTCAGGAGGTGGG - Intronic
1007310753 6:40944305-40944327 GTGTGTGTATGTCGGGGGGTGGG - Intergenic
1008356806 6:50564514-50564536 CTTTGTGTATGGTATGAGGTAGG - Intergenic
1008858441 6:56119878-56119900 TTTTGTGTATGCCAGGAGATAGG - Intronic
1010837077 6:80601722-80601744 CTTTGTGTATGACAAGAGATAGG + Intergenic
1011237966 6:85238621-85238643 AGATGTGTATGAAAGGAGGTAGG - Intergenic
1016225074 6:141724884-141724906 TGATGTGCATGTCAGGGGGTGGG + Intergenic
1016397909 6:143646253-143646275 CTATGTCTATGTCAGTAATTGGG + Intronic
1016772382 6:147866174-147866196 CTATGTGTATGTCTGGTTGGAGG - Intergenic
1017514696 6:155145616-155145638 CTGTGTGTATGTCAAGTGCTGGG - Intronic
1017613408 6:156215423-156215445 CTTTGTATATGTCTAGAGGTGGG - Intergenic
1022415005 7:30170079-30170101 ATATTGGTATGTCAGGAGGTTGG - Intergenic
1024157287 7:46638477-46638499 CTAAGTATAAGTCAGGAGCTGGG - Intergenic
1024159223 7:46657216-46657238 ATATTTGTGTGTCAGAAGGTGGG - Intergenic
1024445052 7:49467605-49467627 ACATGTGTATGTCAGGCAGTGGG + Intergenic
1026082122 7:67231024-67231046 GTATGTGTATGTTAGGAGGGTGG - Intronic
1026544300 7:71308429-71308451 CTATGTGTTTCTCAGGAGTAGGG + Intronic
1026694945 7:72582974-72582996 GTATGTGTATGTTAGGAGGGTGG + Intronic
1027344848 7:77248030-77248052 CTAAGTGTCTGTCAAGAGATTGG + Intronic
1028191180 7:87854250-87854272 CTATGTGTCTGTGAAGAGGGAGG - Exonic
1028784635 7:94777974-94777996 CTATCTCTATCTCAGGTGGTAGG - Intergenic
1029415738 7:100442104-100442126 ATGTGTGTGTGTCTGGAGGTTGG - Intergenic
1030169347 7:106585961-106585983 CTAAGTTTCTTTCAGGAGGTTGG + Intergenic
1032272103 7:130418689-130418711 AGATGTGTTTTTCAGGAGGTTGG - Intronic
1038136510 8:24791788-24791810 CTCTGTCTTTGTCTGGAGGTTGG + Intergenic
1038225373 8:25652101-25652123 CTATGTGTATGTTTACAGGTGGG + Intergenic
1039806410 8:41003634-41003656 CTATGGGCATGTGATGAGGTGGG - Intergenic
1044704838 8:94998694-94998716 CTATGAGTAGGTCAGGTGGAAGG + Intronic
1045368227 8:101495101-101495123 CTATGTGTGTGACATGGGGTGGG + Intronic
1045620968 8:103977949-103977971 CTTTCTGTAGGTCAGTAGGTGGG + Intronic
1047643436 8:126845114-126845136 ATATGTGTATGTCTGGTGTTTGG - Intergenic
1047696716 8:127410891-127410913 CTAAGTGTATGTCAGAGAGTAGG + Intergenic
1048379521 8:133852852-133852874 TTATGTGTATGTCATGAGGCAGG - Intergenic
1049029936 8:140027279-140027301 CTGTGTATATGTTAGGTGGTTGG - Intronic
1050181615 9:2928811-2928833 CATTGTGTGTGTCAGGGGGTTGG + Intergenic
1053094666 9:35314504-35314526 TTATCTGTGTGTTAGGAGGTAGG + Intronic
1056342017 9:85645164-85645186 CTATGTATATGTAAAGAGTTTGG + Intronic
1056756143 9:89383146-89383168 CGATGTGGATGTCAGTGGGTGGG + Intronic
1058604236 9:106703706-106703728 TTATTTGTATTTCAGGAGATGGG + Intergenic
1059514990 9:114885217-114885239 TGATGTGTGTGACAGGAGGTGGG + Intergenic
1059698069 9:116747733-116747755 CTCTGTGTATGTATGGGGGTAGG - Intronic
1059911439 9:119048731-119048753 CTGTGTGTGTGTCGGGGGGTGGG - Intergenic
1060553907 9:124498757-124498779 CCATGTGTCTGTCATGGGGTGGG - Intronic
1060680326 9:125557044-125557066 CTATGTGTGTGTCTGGGAGTGGG + Intronic
1060717416 9:125945384-125945406 CTATGTGTTTGGCAGGGGGCAGG - Intronic
1185913313 X:4006511-4006533 CTGTGTGTATGTCAGGAGGCAGG + Intergenic
1185957610 X:4508774-4508796 GTATATGTGTGTGAGGAGGTGGG - Intergenic
1187047545 X:15662281-15662303 GTATCTTGATGTCAGGAGGTTGG - Intronic
1188249997 X:27881481-27881503 CCATGTGTATGGCAGCAGCTAGG - Intergenic
1188505416 X:30877487-30877509 CAATATGTATGTCACAAGGTAGG + Intronic
1188745283 X:33833764-33833786 TTTTGTATATGTCAAGAGGTAGG + Intergenic
1189656272 X:43248176-43248198 CTAAGTATATGTGAGGAGGGGGG + Intergenic
1190731802 X:53231492-53231514 CTGTGTGTCTGGCATGAGGTAGG + Intergenic
1192616279 X:72626143-72626165 GTATGTGTATGGGAGGATGTAGG + Intronic
1193037534 X:76968844-76968866 GTATGTGTATGGTAGGAGGAAGG - Intergenic
1193146882 X:78085632-78085654 CTATGTATATGTGAGGGTGTGGG + Intronic
1193681375 X:84523259-84523281 CTATGTGTATGTCTGGGGTGGGG - Intergenic
1193744617 X:85260813-85260835 CTGTGTGTATGTCAGCAGGGGGG - Intronic
1194251869 X:91585969-91585991 TTATGTATATGTCAAGAGATAGG - Intergenic
1195593722 X:106663280-106663302 ATATTTATATGTGAGGAGGTAGG - Intronic
1198436803 X:136625201-136625223 CTGTGTATATGTCAAGGGGTCGG + Intergenic
1200570801 Y:4827200-4827222 TTATGTATATGTCAAGAGATAGG - Intergenic