ID: 1172606509

View in Genome Browser
Species Human (GRCh38)
Location 20:36217694-36217716
Sequence CCTGCTGCTGGGCCACATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172606502_1172606509 -1 Left 1172606502 20:36217672-36217694 CCCGGAAGCTGCCCTTGGGAAGC 0: 1
1: 1
2: 2
3: 34
4: 246
Right 1172606509 20:36217694-36217716 CCTGCTGCTGGGCCACATTCTGG 0: 1
1: 0
2: 3
3: 17
4: 219
1172606503_1172606509 -2 Left 1172606503 20:36217673-36217695 CCGGAAGCTGCCCTTGGGAAGCC 0: 1
1: 0
2: 0
3: 37
4: 217
Right 1172606509 20:36217694-36217716 CCTGCTGCTGGGCCACATTCTGG 0: 1
1: 0
2: 3
3: 17
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172606509 Original CRISPR CCTGCTGCTGGGCCACATTC TGG Intronic
900209990 1:1450698-1450720 CCTGCATCTGCGCCAGATTCAGG - Exonic
900215082 1:1477290-1477312 CCTGCATCTGCGCCAGATTCAGG - Exonic
900220048 1:1503601-1503623 CCTGCATCTGTGCCACATTCAGG - Intergenic
900222351 1:1516028-1516050 CCTGCATCTGTGCCAGATTCAGG - Exonic
900666290 1:3817627-3817649 TGTGCCGGTGGGCCACATTCTGG - Intronic
900704494 1:4071856-4071878 GCTGCTGCTGAGCCACTTCCAGG + Intergenic
900705181 1:4076065-4076087 CCTGCTGCTGGGCTCCATGGTGG - Intergenic
901564967 1:10106490-10106512 CGTGCTGCTGGGCCTCTGTCTGG - Exonic
902393458 1:16119388-16119410 CCTGCTGCTCGGTGACATTTGGG - Intergenic
902447840 1:16478391-16478413 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902467740 1:16628604-16628626 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902506840 1:16944124-16944146 CCTGCTGCTGGGCCACCTGCAGG - Exonic
902610828 1:17596265-17596287 CCTGCTGCTGGGTCTCTTTTTGG - Intronic
902763217 1:18597923-18597945 CCTGCCACTGGGCCCAATTCTGG - Intergenic
902833697 1:19033865-19033887 GCTGATGCTGGGCCAGATCCTGG - Intergenic
903443585 1:23406445-23406467 TCTGCTGCTTGGCCACTTCCTGG + Intronic
904466977 1:30714113-30714135 ACTGCTGATGGGCTGCATTCTGG - Intronic
904704193 1:32378048-32378070 CCTTCTGCTCCCCCACATTCAGG - Exonic
907020122 1:51059251-51059273 CCTGCTCCTGGCCCCCACTCTGG + Intergenic
907471974 1:54679917-54679939 CATGCAGCTGAGCCACATCCAGG + Exonic
915624292 1:157105484-157105506 ACTGCTGCTGGACCCCACTCGGG - Intergenic
916249285 1:162721250-162721272 CCTGCTCCAGGGCCACAGTGTGG - Intronic
917853747 1:179085662-179085684 CCAGCTGCTGGACCAAATGCTGG - Exonic
919273053 1:195376137-195376159 CCTGGTGCTTGGCCACATGGAGG - Intergenic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
1065765186 10:29022849-29022871 GCTGCTGCTGGGCCCCATTATGG - Intergenic
1067469831 10:46528284-46528306 CCTGGTCCTGGGCCACTCTCAGG - Intergenic
1067522989 10:47022069-47022091 CATGATGCTGGGCCAGTTTCTGG - Intergenic
1067528707 10:47055102-47055124 CCTGCAGGTGGGGCAGATTCAGG - Intergenic
1067753322 10:48985896-48985918 CCTGCTTCTGGGCCCCAGGCAGG - Intergenic
1067830089 10:49606630-49606652 CCTGCAGCAGGGCCACATGGTGG + Intergenic
1069486288 10:68826199-68826221 CCTCCCGCTGGGCCTCAGTCTGG + Intergenic
1069721196 10:70550364-70550386 CAGGCTGCTGGGCCCCACTCTGG + Intronic
1070424066 10:76268348-76268370 CCTGCTTCTCTCCCACATTCAGG + Intronic
1070432559 10:76355849-76355871 CCTGAACCTGGCCCACATTCAGG + Intronic
1072225100 10:93361409-93361431 CCTGCTGCAGAGCCCCAATCAGG + Intronic
1072661695 10:97367253-97367275 CCTGCTCCTGGCCCACACCCTGG + Intronic
1072675147 10:97460189-97460211 GCTGCTGCTGGACCTAATTCTGG + Exonic
1072721328 10:97782649-97782671 CCTGCTAGTGGGCCTCCTTCAGG + Intergenic
1073363680 10:102919434-102919456 ACTGCTGCTGGGCAACGTGCTGG + Exonic
1076140682 10:128076807-128076829 ACAGGTGCAGGGCCACATTCTGG - Intronic
1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG + Intergenic
1077233189 11:1467867-1467889 CCTGCTGCTAGGCCATTGTCTGG - Intergenic
1078330722 11:10417103-10417125 CCTCATGCTGGGCCACATCATGG + Intronic
1079029763 11:16977721-16977743 GCAGCTACTGGGCCACAGTCTGG - Intronic
1079100523 11:17538805-17538827 CTGGCTGCTGGGCCACAGTTAGG + Intronic
1080905780 11:36543394-36543416 GCTGCTGCCAGGCCACATGCCGG + Intronic
1083581467 11:63827840-63827862 CCTGGTGCTGTCCCACCTTCAGG - Intergenic
1084303576 11:68266917-68266939 CCTGGGGCTGGGGTACATTCAGG - Intronic
1085804938 11:79626874-79626896 CCTGCACCTGGGCCTCTTTCTGG + Intergenic
1086095792 11:83048865-83048887 CCTGCTGCTGGGCCCCAGCATGG + Intronic
1089774605 11:120827454-120827476 CCTGCTGCTGGGCCATGGTCTGG + Intronic
1090227618 11:125081264-125081286 CCTCCTGCTGGGACACACACTGG + Intronic
1091634188 12:2185077-2185099 CCTGCTGCTTGGCCACAGCATGG - Intronic
1092006083 12:5071581-5071603 CCTGCTGCCGGGCCACAGCTGGG - Intergenic
1092125821 12:6074344-6074366 CCTGTAGCTGAGCGACATTCAGG + Intronic
1096589308 12:52646855-52646877 CCTGCTGCAGGGCCTCCTCCAGG + Exonic
1100475711 12:94933564-94933586 CATGCTCCTTGGCCATATTCCGG + Intronic
1102418844 12:112788041-112788063 CCTGCTGCAGTGCCACAGGCTGG + Intronic
1102462728 12:113109966-113109988 CCTGCTCCAGGGCCACCTTGGGG + Intronic
1102749880 12:115283252-115283274 CCTCCTGCTTGGCCATCTTCTGG + Intergenic
1102950168 12:117026075-117026097 CCTGCTGCCAGGCCCCAGTCTGG + Intronic
1103729504 12:123017849-123017871 CCTGCTGCTGGGGAACATGGGGG + Intronic
1106207456 13:27613254-27613276 CCTGCTGCAGGGACACCTTTTGG - Intronic
1106227070 13:27793702-27793724 CCTGCTTCTCGGACAGATTCAGG - Exonic
1106818917 13:33441219-33441241 CCACCTCCTGGGCAACATTCAGG + Intergenic
1107624930 13:42272340-42272362 CCTGCCGCTGGTCCCCCTTCTGG + Intronic
1108562333 13:51657725-51657747 CCTGCTGTTGAGCCTCATTATGG + Intronic
1113484235 13:110642639-110642661 CCTGCAGCTGGGCCTCTTTCTGG + Intronic
1114444905 14:22780994-22781016 CTTTCTTCTCGGCCACATTCTGG - Intronic
1119574983 14:75711928-75711950 CTTGCTGCTGTGGCAGATTCTGG - Intronic
1119729227 14:76940408-76940430 CCAGCTGCGGGGCCACAGTCAGG + Intergenic
1119749124 14:77065067-77065089 CCTGCTGCGGGTCCACATGAGGG + Intergenic
1121175181 14:91885535-91885557 CCTGGAGCTGGGCCACCCTCTGG + Intronic
1121440013 14:93942620-93942642 CCTGCTGTTGGGCTAGATTCAGG - Intronic
1122069092 14:99194248-99194270 TCTGCTGCTGGGGGACAGTCCGG - Intronic
1123037090 14:105475916-105475938 CCTGCAGCCTGGCCGCATTCTGG - Intronic
1126893695 15:53235265-53235287 TCAGCTGCTGGGCCACATGTTGG + Intergenic
1128107984 15:65058443-65058465 CCTGCTGCTGGGCAACAAGCTGG - Exonic
1130273943 15:82466805-82466827 CCTTCTGCAGGGCCCCATGCCGG - Intergenic
1130290449 15:82595031-82595053 CATGTTTCTGTGCCACATTCTGG - Intronic
1130466291 15:84194179-84194201 CCTTCTGCAGGGCCCCATGCCGG - Intergenic
1130497973 15:84479357-84479379 CCTTCTGCAGGGCCCCATGCCGG + Intergenic
1130588585 15:85198772-85198794 CCTTCTGCAGGGCCCCATGCCGG - Intergenic
1132379909 15:101359110-101359132 GCTGTTTCTGGACCACATTCAGG + Intronic
1132517883 16:374340-374362 CCCTCTGCTGGGCCACCGTCTGG + Exonic
1135330150 16:21554086-21554108 CTTGTTGGTTGGCCACATTCTGG - Intergenic
1135424275 16:22324610-22324632 GCTGCCGCTGGACCACATCCGGG - Exonic
1136548171 16:30966889-30966911 CTTGCTGCTTGGCCGCGTTCTGG - Exonic
1136569176 16:31086652-31086674 CCTCCTGCTGGGCCACTGGCTGG - Exonic
1138336882 16:56260429-56260451 CCGGCTGCTGGGCCAGAAGCAGG + Intronic
1139314556 16:66057198-66057220 CCACCAGCTGGGCCACATGCAGG + Intergenic
1139446170 16:67000168-67000190 CCTACTCCTCGGCCACACTCTGG - Intronic
1140296347 16:73712835-73712857 CCTATTGCTGGGCCACAAACTGG - Intergenic
1141990152 16:87604692-87604714 CCTGCTCCACGGCCACATCCAGG + Intronic
1142227386 16:88884265-88884287 CCTGCTGCTGGGCCCCCACCGGG + Intronic
1146656964 17:34640108-34640130 GCTGCTTCTGGGACACATGCTGG - Intergenic
1147526254 17:41226704-41226726 CCTGCTGCAGGACCACCTGCTGG + Exonic
1147526789 17:41232536-41232558 CCTGCTGCAGGACCACCTGCTGG + Exonic
1147528417 17:41249770-41249792 CCTGCTGCAGGACCACCTGCTGG + Exonic
1147528937 17:41255420-41255442 CCTGCTGCAGGACCACCTGCTGG + Exonic
1147530838 17:41275732-41275754 CCTGCTGCAGGACCACCTGCTGG + Exonic
1149560927 17:57607509-57607531 CCTGGTGCTTGGCCACACGCTGG + Intronic
1149579207 17:57736646-57736668 CCTGTTCCTGGGCCAGAATCAGG - Intergenic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1150293552 17:63995840-63995862 GCTGCTCCTGTGCCACCTTCTGG + Intergenic
1150293728 17:63997004-63997026 CCTGCTGCTTGGCCCCATCAAGG + Intergenic
1150979300 17:70123774-70123796 TCTGCTGTTAGACCACATTCTGG + Intronic
1151413714 17:73947909-73947931 TCTGCTGCTGGGCCAGATAAGGG + Intergenic
1151727390 17:75892811-75892833 CCTGCTGCTGGGTAACCTCCAGG + Exonic
1151770780 17:76159251-76159273 CTTGGTGCTGGCCCACATCCTGG - Intronic
1152099144 17:78290970-78290992 CCTGCTGCAGGGCCAGCTCCAGG + Intergenic
1152111153 17:78358450-78358472 CCAGCTGCCGGGGCCCATTCGGG - Exonic
1152205028 17:78970050-78970072 CCTGCCGCTGTGCCACGGTCTGG - Intergenic
1152928543 17:83098866-83098888 CCTGCTGAGGGGCCAGAGTCCGG + Intergenic
1203172682 17_GL000205v2_random:163685-163707 CTTGCTCATTGGCCACATTCAGG + Intergenic
1153006372 18:501181-501203 CCTGCTGCTTGGTCTCCTTCAGG - Intergenic
1155259005 18:24023365-24023387 GCCGCTGCTGAGCCACATGCAGG + Intronic
1158448897 18:57546148-57546170 CCTGTTCCTGGGCCACCTTCAGG + Intergenic
1162105183 19:8365995-8366017 GCTGCTGCTGGGCCACCTTGTGG - Exonic
1167288214 19:48610703-48610725 CCAGCTGCTGGGCCAGTTCCAGG + Exonic
1168103699 19:54154158-54154180 CCTGGTGCAGGGACACATACTGG - Intronic
1168519014 19:57033715-57033737 CCTCCAGCTGGGCCAATTTCTGG + Intergenic
925430062 2:3783732-3783754 GCTCCTGCTTGGCCACACTCCGG - Intronic
926218815 2:10921768-10921790 CCAGCTTCTGGGCCACAGTGGGG - Intergenic
927212129 2:20645453-20645475 CCTGGTGCTGGGGCACAGTCAGG + Exonic
929601786 2:43209058-43209080 ACTGCTGCTGCTCCACTTTCGGG - Intergenic
929670666 2:43874766-43874788 CCTGCTGGGGGGCCACAGTGAGG - Intronic
932338283 2:70943448-70943470 CCTGCTGCTCGGACACCTGCAGG - Intronic
934725665 2:96616771-96616793 CATGCTGCTGGGCCACGGTGTGG - Intronic
937859778 2:126698471-126698493 ACTGCTGCTGAGCCTGATTCTGG - Intergenic
938528845 2:132162810-132162832 CCTGCTGCTCAGCCGCATCCTGG - Intronic
938886245 2:135651984-135652006 CCTGCTGCTGGAGCACAGGCTGG - Exonic
939748516 2:146009617-146009639 CCAGCTGCTGGGCTGCAGTCAGG + Intergenic
945946155 2:215997912-215997934 CCTGCTGCTGAACCCCAATCTGG - Intronic
946153022 2:217789039-217789061 CCTTCTGCTGAGCCACACCCTGG + Intergenic
946157018 2:217813649-217813671 CCTGGTCCTGAGCCCCATTCTGG + Intronic
946354007 2:219173451-219173473 CCTGCTGCTCAGCCACACTGGGG + Exonic
947821957 2:233078418-233078440 CCAGCTGCTGGGGCAAATCCAGG + Intronic
948225791 2:236308405-236308427 CATGCAGCTGTGCCACTTTCGGG + Intergenic
948443891 2:238017324-238017346 CCTGGTTCTGGGCCACATCGGGG - Intronic
1168914556 20:1475591-1475613 CCTGCTGATGGTCAACTTTCTGG + Exonic
1172606509 20:36217694-36217716 CCTGCTGCTGGGCCACATTCTGG + Intronic
1173440377 20:43070161-43070183 CATGCTGCTGGTGCACAGTCCGG + Intronic
1175157646 20:56982731-56982753 CCTCCAGCTTGGCCACATGCTGG + Intergenic
1175264439 20:57694025-57694047 CCTGCAGCAGGGCCACAGCCTGG + Intronic
1175781962 20:61688539-61688561 CCTGCTTCTCGGCCGCCTTCCGG + Intronic
1175984346 20:62756490-62756512 CCTGGTGCTGGCCCATTTTCAGG + Intronic
1176062535 20:63178715-63178737 CCGGCAGCTGGGCCGCACTCTGG - Intergenic
1176128838 20:63487802-63487824 CTTGCTGCTGGGCCACGGCCTGG + Intergenic
1176328680 21:5525470-5525492 CATGCTCATTGGCCACATTCAGG + Intergenic
1176399077 21:6295481-6295503 CATGCTCATTGGCCACATTCAGG - Intergenic
1176438080 21:6693623-6693645 CATGCTCATTGGCCACATTCAGG + Intergenic
1176462342 21:7020693-7020715 CATGCTCATTGGCCACATTCAGG + Intergenic
1176485903 21:7402471-7402493 CATGCTCATTGGCCACATTCAGG + Intergenic
1176767661 21:13037102-13037124 CCTGCTGCTCAGCCGCATCCTGG + Intergenic
1178830646 21:36053880-36053902 CCTACTGCTGGGCCTCCTGCAGG + Intronic
1179103412 21:38376766-38376788 CCAGCTGCTGGGCCATAACCTGG - Intergenic
1182778189 22:32846626-32846648 CCTGGTGCTGGGTGACCTTCAGG - Intronic
949869378 3:8574861-8574883 CAGGCTGCTGGCCCAGATTCCGG + Intergenic
952705826 3:36376977-36376999 CCTGCTCCTGGGCCAAGTTTTGG - Intergenic
953257365 3:41304881-41304903 CCTGCAGCTGGGCCAAATGCAGG - Intronic
953457336 3:43053622-43053644 GCTGCGGCTGGTCCACATCCTGG + Exonic
953471413 3:43169793-43169815 CCTTATTCTGGGCCAAATTCCGG - Intergenic
953579292 3:44138992-44139014 ACTGCTGCTGGGTCACTTTAAGG + Intergenic
953985538 3:47439637-47439659 GCTGCTGCTGGGACATATCCTGG + Intronic
955720484 3:61875230-61875252 CCTTCTTTTAGGCCACATTCTGG + Intronic
957945991 3:87063617-87063639 CATGTTGCTGGGACCCATTCTGG - Intergenic
962279714 3:134040504-134040526 CCTGCTGATCAGCCACCTTCCGG + Intronic
974122967 4:57662467-57662489 TCTGCTGCTGGGTCTCATTGGGG - Intergenic
977654844 4:99509050-99509072 TCTGCTGAGGGGCCACTTTCTGG + Intergenic
984474288 4:180216576-180216598 GCTGCTGCTGGCCCACATGTGGG - Intergenic
985368125 4:189255309-189255331 ACTGCTGCTGGGCCACTAACAGG + Intergenic
985949504 5:3212686-3212708 CGTGCAGCTGGGACACATCCAGG - Intergenic
986372483 5:7093737-7093759 CCTTCTGGTGAGCCACATTTTGG - Intergenic
986451554 5:7869725-7869747 CCTGCTACTGCCCCACAATCCGG - Intronic
986774108 5:10997888-10997910 CCTACAGCTGTGCCACATTTAGG - Intronic
988693970 5:33600222-33600244 ACTGCTGCATGGCAACATTCTGG - Intronic
992098751 5:73385577-73385599 CCTGAAACTGGGCAACATTCAGG + Intergenic
992273385 5:75089210-75089232 CCAGCTGTTGGACAACATTCTGG - Intronic
995627811 5:114098342-114098364 CCCACTGCTGGGCCACAGACTGG + Intergenic
995934229 5:117488747-117488769 TCTGAGGCTGGGCCACATTAGGG - Intergenic
996016793 5:118547954-118547976 GCTACTGTAGGGCCACATTCAGG - Intergenic
998139459 5:139691632-139691654 CCAGCTGCAGGGCCACAGGCTGG + Intergenic
999205803 5:149847117-149847139 CCTGCTGCAGTGCCACATAAGGG - Intronic
999286327 5:150396415-150396437 CCTGCACCTGGGCCTCATTCAGG - Exonic
1001738024 5:174022953-174022975 CCTCCTGCTGTGCCTCCTTCAGG - Intergenic
1002467409 5:179414466-179414488 CCTGCTGTCGGGCCACAGGCAGG + Intergenic
1005402253 6:25447083-25447105 CCTGTCTCTGTGCCACATTCTGG - Intronic
1005418213 6:25623570-25623592 TCTACTGCAGGGCCACATTGGGG - Intergenic
1006152292 6:31995979-31996001 CCTGCTCCTGGGCCAAACTCAGG - Exonic
1006158595 6:32028717-32028739 CCTGCTCCTGGGCCAAACTCAGG - Exonic
1006311725 6:33265781-33265803 CCTACTGCTGACCCACAATCAGG - Intronic
1006426528 6:33966750-33966772 CCTGCTGCAGAGACACAGTCAGG + Intergenic
1006672569 6:35738410-35738432 CGTGTTGCTGGGCTACATGCTGG + Exonic
1007269448 6:40624910-40624932 GCTGGGGCTGGGCCACATTGAGG + Intergenic
1012925980 6:105268265-105268287 GCTCCTGTTGGTCCACATTCTGG - Intergenic
1013081766 6:106819154-106819176 ACTGATGCTGGGCCAGAATCTGG + Intergenic
1016427406 6:143949206-143949228 CCTGCTGGTAGGCCACCTCCAGG + Intronic
1016685503 6:146877699-146877721 CCTTCTGCTGGTACACATTAGGG - Intergenic
1017630506 6:156392280-156392302 CGTGCTGCTGGGCTATAGTCTGG + Intergenic
1017765735 6:157605663-157605685 CCTGCTGCTTGCCCGCTTTCAGG - Intronic
1018299754 6:162388792-162388814 CCAGATGCTGGGCCAGATGCTGG - Intronic
1018334798 6:162775179-162775201 TCTGCTGCGGGTCCACTTTCTGG - Intronic
1019937911 7:4268363-4268385 CCTCCTGCACGGCCACCTTCTGG + Exonic
1020107621 7:5429420-5429442 GAGGCTGCTGGGCCACATTCCGG + Intergenic
1026956717 7:74380924-74380946 CTTCCTGCTGGGTCACATTTTGG + Intronic
1028262232 7:88680471-88680493 CTTACTTCTGGGCCTCATTCTGG + Intergenic
1029379552 7:100204101-100204123 CCTGCTGCTGAGCCTCAAGCAGG + Exonic
1031483023 7:122300563-122300585 ACTGCAGCGGGGCCACATCCCGG - Intergenic
1033267337 7:139897535-139897557 CCTGCTGCTTGTCCACATGTGGG - Intronic
1034451581 7:151139861-151139883 ACTGTAGCTGGGCCACACTCAGG - Intronic
1035024289 7:155815993-155816015 CCTGCAGCCAGGCCACAATCAGG - Intergenic
1038421684 8:27437758-27437780 CCTGCAGCTGGGCCACTACCTGG + Exonic
1039476495 8:37841752-37841774 CCTGCAGCTGGCCCAGAGTCAGG + Exonic
1042467932 8:69149530-69149552 CCTTGTTCTGGGCCACACTCTGG - Intergenic
1046524518 8:115367535-115367557 ACTGGTACTGGGCCACAGTCCGG - Intergenic
1048574704 8:135681427-135681449 CCTGCTGCCTGGCCACTTTGGGG - Intergenic
1049013721 8:139905460-139905482 CCTGCTCCTGTGGCACACTCGGG - Intronic
1049015811 8:139919124-139919146 CCGGCTGCAGGGCTGCATTCGGG + Intronic
1053062633 9:35043953-35043975 GATGCTGGTGGGACACATTCAGG - Exonic
1053553085 9:39104818-39104840 CCTGCTGCTGCGACACACTGAGG - Intronic
1053817202 9:41924987-41925009 CCTGCTGCTGCGACACACTGAGG - Intronic
1054107452 9:61068643-61068665 CCTGCTGCTGCGACACACTGAGG - Intergenic
1054613405 9:67262482-67262504 CCTGCTGCTGCGACACACTGAGG + Intergenic
1059459735 9:114422038-114422060 CATGCTCCTGGGCCATTTTCTGG + Intronic
1059941035 9:119360207-119360229 TTTGCTGCTGGGACACATTTTGG - Intronic
1060544778 9:124453441-124453463 CCTGGTGCTGGGCCAGGATCAGG + Exonic
1061328922 9:129880195-129880217 CCAGCGGCTGCGCCACACTCTGG - Exonic
1062402745 9:136379601-136379623 CCTGCCTCTGGGCCCCATGCTGG + Intronic
1062405791 9:136395611-136395633 CCTGCTGCTGGCCCAGAACCGGG - Exonic
1062450160 9:136611832-136611854 CCAGCTGCTGGGTCACCTGCCGG + Intergenic
1062606518 9:137351037-137351059 CCTGCTGCTGGTGCACAGACAGG - Exonic
1203433433 Un_GL000195v1:114995-115017 CTTGCTCATTGGCCACATTCAGG - Intergenic
1189922314 X:45914586-45914608 CCTGCTGCAGGGCCACACATGGG + Intergenic
1192224192 X:69217230-69217252 CCTGCTCTGGGGGCACATTCAGG - Intergenic
1192451928 X:71250094-71250116 GCTGCTGCTGGGCCTCATACAGG + Exonic
1192707125 X:73538071-73538093 GCTGCTACTGGTCCACATTTGGG - Intergenic
1197648490 X:129041553-129041575 CCTGCTGCTGGGCCTGCGTCAGG + Intergenic
1202115941 Y:21468819-21468841 TCTGCTGCTGGGCCTCACTGAGG - Intergenic