ID: 1172611367

View in Genome Browser
Species Human (GRCh38)
Location 20:36255303-36255325
Sequence TGTCCAGTAGAACCCCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172611355_1172611367 30 Left 1172611355 20:36255250-36255272 CCTTAGTACCGACTGGTGTAGCT 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1172611367 20:36255303-36255325 TGTCCAGTAGAACCCCCCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 113
1172611362_1172611367 -3 Left 1172611362 20:36255283-36255305 CCTCTGGGTTACTGCCCGGGTGT 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1172611367 20:36255303-36255325 TGTCCAGTAGAACCCCCCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 113
1172611359_1172611367 3 Left 1172611359 20:36255277-36255299 CCTGTTCCTCTGGGTTACTGCCC 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1172611367 20:36255303-36255325 TGTCCAGTAGAACCCCCCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 113
1172611356_1172611367 22 Left 1172611356 20:36255258-36255280 CCGACTGGTGTAGCTACTACCTG 0: 1
1: 0
2: 0
3: 11
4: 73
Right 1172611367 20:36255303-36255325 TGTCCAGTAGAACCCCCCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172611367 Original CRISPR TGTCCAGTAGAACCCCCCAG GGG Intronic
908168023 1:61477235-61477257 TGTCCAGCAGATCCACACAGTGG - Intergenic
908330204 1:63063553-63063575 ATACCAGTAGCACCCCCCAGTGG - Intergenic
919177814 1:194041394-194041416 TGTCCAGTTGTCCCCCACAGAGG - Intergenic
920334684 1:205237107-205237129 TTTCCAGTAGAAACTCCAAGTGG + Intronic
921214969 1:212928902-212928924 TGTCCAGGAAACCCCCGCAGAGG + Intergenic
1069288048 10:66741613-66741635 TGTGCAGTAGAACCCAGCAAAGG - Intronic
1070644224 10:78190356-78190378 TGTGCAGTGGAACTCCCTAGGGG - Intergenic
1071204331 10:83255984-83256006 TTTCCATTAGAACCCCCTGGGGG + Intergenic
1072636848 10:97183864-97183886 TGTCCAGAGGACCCCCGCAGTGG - Intronic
1073323106 10:102627642-102627664 TGCCCACCAGAACTCCCCAGCGG - Intronic
1077411225 11:2404838-2404860 CCTCCAGCGGAACCCCCCAGGGG - Exonic
1078357506 11:10643274-10643296 TGTCCAGCAGAACTCAGCAGAGG - Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1080425733 11:32152468-32152490 TTTCCAGAACAATCCCCCAGAGG - Intergenic
1084562160 11:69911193-69911215 TGGCCAGCAGAAGCCACCAGGGG + Intergenic
1086033829 11:82392837-82392859 TGTCCAGTAGAAACTGACAGGGG + Intergenic
1087862267 11:103174496-103174518 TGTCCATTGGAATCACCCAGTGG + Intronic
1089338116 11:117739607-117739629 TACCCACTAGAACCCCACAGTGG + Intronic
1092778792 12:11966452-11966474 TGTCCAGTAGAATCACCTTGAGG - Intergenic
1096837093 12:54357939-54357961 TATCCTGTAGAGCCCCTCAGAGG - Intergenic
1097276693 12:57818452-57818474 TGTTCAGAAGAACCCCTTAGAGG - Intronic
1098607327 12:72407481-72407503 TGTCCAGTAGTCACCCTCAGAGG + Intronic
1102581152 12:113888940-113888962 CGTCCAGAAGAGCCCCCCAAAGG - Intronic
1106082857 13:26514962-26514984 TGTACAGAAGAACACCCGAGAGG + Intergenic
1109592718 13:64507468-64507490 TATCCAGTAAAATCTCCCAGAGG - Intergenic
1111962141 13:94823391-94823413 TGTCTATAAGAACCACCCAGAGG - Intergenic
1112396167 13:99034304-99034326 TCTCCAGTAGCACACCCAAGAGG + Intronic
1121533257 14:94673355-94673377 TGTCCACTGAAGCCCCCCAGGGG + Intergenic
1125264110 15:37859937-37859959 TGTACATTAGAATCACCCAGGGG + Intergenic
1129596188 15:76966250-76966272 TGTGCATGAGAATCCCCCAGAGG - Intergenic
1130088115 15:80795494-80795516 TGTCCAGGAGAACTCCCAGGTGG + Intronic
1132034947 15:98474580-98474602 TGTCCAGTTGTAACCCCCAGTGG - Intronic
1133091898 16:3411204-3411226 GGTTCAGTAGAACCCACTAGAGG - Intronic
1134217757 16:12329394-12329416 TGTCCAGTTGAACTCTCCACAGG + Intronic
1134502789 16:14782162-14782184 TGTCCATCAGAAACCCCCGGAGG - Intronic
1134577774 16:15346733-15346755 TGTCCATCAGAAACCCCCGGAGG + Intergenic
1134724814 16:16410814-16410836 TGTCCATCAGAAACCCCCGGAGG - Intergenic
1134942618 16:18301045-18301067 TGTCCATCAGAAACCCCCGGAGG + Intergenic
1138135415 16:54517091-54517113 TTCCCAGTAGCAGCCCCCAGAGG - Intergenic
1141681146 16:85544739-85544761 TGTCCAGCAGACCCCAGCAGCGG + Intergenic
1142939118 17:3366827-3366849 TCTCCAGTAAACCCCTCCAGAGG + Intergenic
1144636529 17:16912782-16912804 TGTCCAATAGAACCCGCTACCGG + Intergenic
1144992466 17:19243127-19243149 TGTGCAGCAGAAGCACCCAGAGG + Intronic
1150379049 17:64706359-64706381 TCTCCATTAAAACCCTCCAGTGG + Intergenic
1155746121 18:29358080-29358102 TGACAAGAAGAACCCCCTAGTGG + Intergenic
1161183461 19:2900785-2900807 TGTCCAATCGAAGGCCCCAGGGG + Intergenic
1167807758 19:51800392-51800414 TGTCCAGTATAAACCTGCAGAGG + Intronic
1168126744 19:54288157-54288179 GGTCCAGTAGGAGACCCCAGGGG - Intergenic
1168173653 19:54607771-54607793 GGTCCAGTAGGAGACCCCAGGGG + Intronic
932300993 2:70666952-70666974 TGGCCAGTGGAACCCTCCAGTGG - Intronic
937022585 2:118671902-118671924 TGTACATTACAACCCCCCTGGGG + Intergenic
947868994 2:233422049-233422071 TGTGTAGTAGGACCCCCGAGGGG + Intronic
948263087 2:236618623-236618645 TCTCCACTAGAAGCCTCCAGAGG - Intergenic
948363479 2:237438733-237438755 TGTTCATTAGGAACCCCCAGTGG - Intergenic
1172611367 20:36255303-36255325 TGTCCAGTAGAACCCCCCAGGGG + Intronic
1172715477 20:36960206-36960228 TGACCAGTGGAAACCCCTAGAGG + Intergenic
1176019876 20:62957170-62957192 TGGGCAGAAGACCCCCCCAGAGG + Intronic
1176946118 21:14983869-14983891 TGTCCAGTAGGTCCCAACAGCGG - Intronic
1183096977 22:35558159-35558181 TGTCCGATAGAACACCCCAAAGG - Intergenic
951105414 3:18736412-18736434 TTTCAAGTGGAACCCCCAAGAGG - Intergenic
951926543 3:27914335-27914357 TGTCCATTACATGCCCCCAGCGG - Intergenic
961691836 3:128675552-128675574 TCCCAAATAGAACCCCCCAGAGG + Intronic
973041210 4:45472238-45472260 TGAGCAGTAGAACCACTCAGAGG - Intergenic
977210044 4:94208028-94208050 TCCCCAGTATAACCCCCTAGCGG - Intronic
979859489 4:125676286-125676308 TGTCGAGAAGAACACACCAGCGG + Intergenic
982485387 4:155959449-155959471 AGTCAAGTGGAACCCTCCAGAGG + Intergenic
985574831 5:669246-669268 TGTCCAGCAGCATCCCCCAGGGG + Intronic
995530435 5:113086833-113086855 TGTGTACTAGAATCCCCCAGAGG + Intronic
998151287 5:139758929-139758951 GGCCCAGCAGAACCTCCCAGCGG - Intergenic
1001034399 5:168287198-168287220 TGTCCACAAGACCCCCCAAGGGG - Intergenic
1002094630 5:176823673-176823695 TGTCCCATAGAGCCCCCCTGTGG - Intronic
1003592201 6:7445777-7445799 TGTCCAGTAGCACCCCCGTAAGG - Intergenic
1005871511 6:29977117-29977139 TTTCCACCAGAACCGCCCAGAGG - Intergenic
1006057976 6:31399928-31399950 TTTCCATCAGAACCGCCCAGAGG + Intronic
1006070365 6:31494141-31494163 TTTCCATCAGAACCGCCCAGAGG + Intergenic
1007175313 6:39892467-39892489 TGTCCCCTAGTACTCCCCAGGGG + Intronic
1010393258 6:75360714-75360736 TATCCAATAGAACTCACCAGCGG - Intronic
1014073425 6:117209415-117209437 TGTCCACTACAACATCCCAGAGG + Intergenic
1016605107 6:145911987-145912009 TTTCCAGTAGAGTACCCCAGTGG - Intronic
1018897203 6:168028016-168028038 GTTCCAGAAGAACCCCCCTGTGG + Intronic
1018973135 6:168542900-168542922 TGCCCAGTAAAACTCCTCAGGGG - Intronic
1019545312 7:1571435-1571457 TAACCAGTAGAAACCCCTAGAGG + Intergenic
1020044688 7:5032095-5032117 TGTCCAGCAGAGCCCTCCTGAGG - Intronic
1020290042 7:6716117-6716139 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1021754980 7:23843086-23843108 TGTGCAGAAGAACTCACCAGGGG + Intergenic
1022816428 7:33918779-33918801 TGCCCAGTGGGACCCACCAGAGG + Intronic
1023825641 7:44007109-44007131 TGTCCAGCAGAGCCCTCCTGAGG + Intronic
1026089193 7:67285885-67285907 TGTCCAGCAGAGCCCTCCTGAGG + Intergenic
1026725058 7:72864465-72864487 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1026747190 7:73022661-73022683 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1026750840 7:73050804-73050826 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1026754489 7:73078914-73078936 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1026758141 7:73106947-73106969 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1027033294 7:74907232-74907254 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1027089264 7:75286537-75286559 TGTCCAGCAGAGCCCTCCTGAGG + Intergenic
1027092907 7:75314465-75314487 TGTCCAGCAGAGCCCTCCTGAGG + Intergenic
1027096550 7:75342432-75342454 TGTCCAGCAGAGCCCTCCTGAGG + Intergenic
1027118783 7:75501203-75501225 TGTCCAGCAGAGCCCTCCTGAGG + Intergenic
1027273013 7:76534256-76534278 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1027322797 7:77025248-77025270 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1027326462 7:77053340-77053362 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1029397659 7:100319406-100319428 TGTCCAGCAGAGCCCTCCTGAGG + Intronic
1029718704 7:102348814-102348836 TGTCCAGCAGAGCCCTCCTGAGG - Intergenic
1029753911 7:102560441-102560463 TGTCCAGCAGAGCCCTCCTGAGG + Intronic
1029771861 7:102659531-102659553 TGTCCAGCAGAGCCCTCCTGAGG + Intronic
1032485541 7:132284582-132284604 TGTCCACTAGAACACCCAAGGGG + Intronic
1033453585 7:141482773-141482795 TGTCCAGTTGTCCCCTCCAGTGG + Intergenic
1034973967 7:155437186-155437208 TGTCCACTTGGACCCCCAAGTGG - Intergenic
1038356568 8:26834744-26834766 TGTCCTGTAGACCCAGCCAGAGG - Intronic
1041379780 8:57242725-57242747 TGACCAGTAGAACCTTTCAGAGG + Intergenic
1043837040 8:85060229-85060251 TCAGCAGTAGAACCACCCAGGGG - Intergenic
1055337309 9:75246130-75246152 TGTCCAGTTGTAATCCCCAGTGG + Intergenic
1062456744 9:136643559-136643581 TCTCCAGGAGAACCCACCCGAGG - Intergenic
1062605787 9:137348416-137348438 TGAGCACTAGAGCCCCCCAGGGG - Intronic
1186449765 X:9662277-9662299 TGTCCTTTAGAACACCTCAGCGG + Intronic
1190925501 X:54899909-54899931 TGTCCAGCAGTACCCTCAAGAGG - Intergenic
1192379310 X:70599236-70599258 TTTCAACTACAACCCCCCAGGGG + Intronic
1193853227 X:86565500-86565522 TATCCATTAGAATCACCCAGAGG - Intronic