ID: 1172611868

View in Genome Browser
Species Human (GRCh38)
Location 20:36258495-36258517
Sequence GCAGCTTGCTCAAGATCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 666
Summary {0: 1, 1: 3, 2: 19, 3: 110, 4: 533}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172611868_1172611873 27 Left 1172611868 20:36258495-36258517 CCGTGTGATCTTGAGCAAGCTGC 0: 1
1: 3
2: 19
3: 110
4: 533
Right 1172611873 20:36258545-36258567 CATGAAATAAGAGTTGGCTTGGG 0: 1
1: 0
2: 0
3: 22
4: 198
1172611868_1172611874 28 Left 1172611868 20:36258495-36258517 CCGTGTGATCTTGAGCAAGCTGC 0: 1
1: 3
2: 19
3: 110
4: 533
Right 1172611874 20:36258546-36258568 ATGAAATAAGAGTTGGCTTGGGG 0: 1
1: 0
2: 1
3: 15
4: 235
1172611868_1172611872 26 Left 1172611868 20:36258495-36258517 CCGTGTGATCTTGAGCAAGCTGC 0: 1
1: 3
2: 19
3: 110
4: 533
Right 1172611872 20:36258544-36258566 GCATGAAATAAGAGTTGGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 222
1172611868_1172611870 21 Left 1172611868 20:36258495-36258517 CCGTGTGATCTTGAGCAAGCTGC 0: 1
1: 3
2: 19
3: 110
4: 533
Right 1172611870 20:36258539-36258561 TCCTCGCATGAAATAAGAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172611868 Original CRISPR GCAGCTTGCTCAAGATCACA CGG (reversed) Intronic
900885899 1:5415212-5415234 GTGACTTGCTCAAGGTCACAGGG - Intergenic
901837113 1:11931343-11931365 GCAGCAAGCTCAAGGTCCCAAGG - Intergenic
901931698 1:12600068-12600090 GTAACTTGCTCAAGGTCACACGG + Intronic
902204251 1:14855760-14855782 AGAGCTTGCTCAAGTGCACATGG + Intronic
902376380 1:16031956-16031978 GTGACTTGCTCAAGGTCACACGG - Intronic
902554770 1:17240441-17240463 GCAACCTGCTCAAGTGCACAAGG - Intronic
902564732 1:17303917-17303939 GCACCAGGCTCAAGGTCACACGG - Intergenic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903424823 1:23245804-23245826 TGACCTTGCTCAAGGTCACACGG - Intergenic
903451235 1:23455138-23455160 GCAGCTTGCCCGAGGTCACACGG - Intronic
903703896 1:25270717-25270739 GTGACTTGCTCAAGGTCACAGGG - Intronic
903723345 1:25422607-25422629 GTGACTTGCTCAAGGTCACAGGG + Intronic
903892859 1:26581456-26581478 GCAACTTGCCCAAGGTCACATGG - Intergenic
903971156 1:27119681-27119703 GCAACTTGATCAAAGTCACATGG + Intronic
903976816 1:27155442-27155464 GTAACTTGCTCAAGGTCACACGG - Intronic
904583985 1:31569003-31569025 GTGACTTGCTCAAGGTCACATGG + Intergenic
904703856 1:32375900-32375922 GTAACTTGCCCAAGTTCACATGG - Intronic
904747104 1:32718073-32718095 GCAGCTTGCCTAGGGTCACATGG + Intergenic
904752477 1:32749532-32749554 GTGACTTGCTCAAGTTCACATGG + Intronic
905334264 1:37233348-37233370 GCGGCTTGCTCAAGGTCATTTGG - Intergenic
905434052 1:37944961-37944983 ACAACTTGCTCAAGATCATGTGG + Intronic
905486367 1:38299787-38299809 ACAACTTGCTCAAGGTCCCATGG + Intergenic
905597789 1:39223381-39223403 GCAGCTTGCCCAAGATCACAAGG - Intronic
905835463 1:41116410-41116432 GGAGCTTGCTCAAGATCACGTGG - Intronic
905868364 1:41388633-41388655 GGAGCTGGCTCAAGGCCACAGGG - Intergenic
906238613 1:44227804-44227826 GGAACTTGCTCAAGTTCACATGG - Intronic
906267790 1:44447262-44447284 GCAACTAGCTCAGGATCACAGGG - Intronic
906481005 1:46198703-46198725 GCACCTTGGACCAGATCACAGGG + Intronic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
906596631 1:47083489-47083511 GCAGTTTGTTCAAGGTCACAAGG + Intronic
907069901 1:51524975-51524997 GAAGCTTGCCCTAAATCACAAGG + Intergenic
907156669 1:52341258-52341280 TTAACTTGCTCAAGATTACAAGG + Intronic
907262950 1:53235305-53235327 GGAACTTGCCCAAGGTCACATGG + Intronic
907490245 1:54804864-54804886 GTGACTTGCTCAAGATCCCACGG + Intergenic
907492390 1:54816373-54816395 GCAACTTGCCCAAGGTAACACGG - Intronic
907798421 1:57740379-57740401 GTACCTTGCCCAAGAACACATGG - Intronic
907917900 1:58887586-58887608 GCAGTTTCCTCAGTATCACAGGG + Intergenic
908653283 1:66359957-66359979 GCAACTTGCCCAAGCTCAGAGGG - Intronic
909428158 1:75552139-75552161 GTGGCTTGCCCAAGATCACAGGG - Intronic
909597315 1:77421306-77421328 GAAGTTTACTCAAGGTCACATGG + Intronic
912146556 1:106800997-106801019 ACAGTTTTCTCAAGTTCACATGG - Intergenic
912278678 1:108289490-108289512 TCAGGTTGCTGAAGATCAGATGG - Intergenic
912289548 1:108404867-108404889 TCAGGTTGCTGAAGATCAGATGG + Intronic
912420526 1:109539534-109539556 GCAACTTGCCCAAGGTCACACGG + Intergenic
913044073 1:115058466-115058488 GTAACTTGCTCAAGGTCACAAGG + Intronic
913201545 1:116498717-116498739 AAGGCTTGCTCAAGGTCACATGG + Intergenic
913477224 1:119249818-119249840 CCAGCTTTCTTAAGTTCACATGG - Intergenic
914772134 1:150697156-150697178 TCAGCTTCCTCAGGATCACTAGG + Intergenic
915051609 1:153080369-153080391 ACAGCTTTCTCAAGAGAACATGG + Intergenic
915865287 1:159493031-159493053 AAAGCTTGCCCAAAATCACACGG + Intergenic
915960207 1:160260250-160260272 GTAACTTGCTCAAGGTCACATGG + Intronic
916592026 1:166201096-166201118 GTGGCTTGCCCAAGTTCACATGG - Intergenic
916956621 1:169843445-169843467 ACAATTTGTTCAAGATCACATGG - Intronic
917437865 1:175039292-175039314 GTAACTTGCTCAAGGTCCCAGGG - Intergenic
917630726 1:176888838-176888860 GTAACTTGCCCAAGGTCACATGG - Intronic
918516003 1:185364116-185364138 TCAGCTTGTTGAAGATCAGATGG - Intergenic
919688702 1:200508830-200508852 GCAACGTGTTCAAGGTCACAGGG - Intergenic
920689208 1:208132897-208132919 GCAACTTGCCCAAGGTCACATGG + Intronic
920749570 1:208660979-208661001 GCAGTTTGTCCAAGATCACTGGG + Intergenic
920960918 1:210663380-210663402 GCAGCTTGCTTCAGGTCACATGG - Intronic
921964604 1:221075166-221075188 GTAACTTTCTCAAGGTCACAAGG - Intergenic
922006228 1:221533348-221533370 GGAGCTTGCTCCGGATGACAAGG + Intergenic
922084312 1:222331360-222331382 GTAACTTGTCCAAGATCACAAGG + Intergenic
922109167 1:222540609-222540631 GCAACTTGCTCAGGGTCACATGG - Intronic
923196339 1:231671772-231671794 GTAGCTTGCCCAACCTCACATGG - Intronic
923559901 1:235031075-235031097 GCAGATTGCTCAAGCTCAAGAGG + Intergenic
924012113 1:239676679-239676701 GGAGCTTGCCCAATACCACAGGG - Intronic
1063215053 10:3916988-3917010 GTAACTTGCTCAAAATCTCATGG + Intergenic
1063571235 10:7216096-7216118 GCAACGTGCTCAAGGCCACAGGG + Intronic
1063735069 10:8743763-8743785 GAAACTTGCCCAAGGTCACATGG - Intergenic
1064084510 10:12335144-12335166 AGAACTTGCCCAAGATCACAAGG - Intergenic
1064131045 10:12710005-12710027 GAAGTTTGCTCAAAGTCACACGG - Intronic
1064186751 10:13168465-13168487 GGGGCTTGTTCAGGATCACATGG - Intronic
1064382264 10:14856363-14856385 GTAGCTTCCTCAAGATCACACGG + Intronic
1065310698 10:24413552-24413574 GCAGCTCAATCAAGAGCACAAGG + Intronic
1065850445 10:29783333-29783355 GCGATTTGCTCAAGGTCACATGG + Intergenic
1066415395 10:35216604-35216626 GTAGCTTGCCAAAGGTCACATGG + Intergenic
1066634891 10:37490594-37490616 AGAACTTGCCCAAGATCACATGG - Intergenic
1067472273 10:46545885-46545907 GTAACTTGCCCAAGATCACATGG + Intergenic
1067701846 10:48579517-48579539 GCAGCTTGCACAAGCTCAAATGG - Intronic
1068120260 10:52777391-52777413 GCATATTGCTGAAGAACACACGG + Intergenic
1068833061 10:61520267-61520289 GCTGCATGCTCTAAATCACAGGG + Intergenic
1069229986 10:65996772-65996794 CCAGCTTGGTCAGGATCACCTGG - Intronic
1069821806 10:71233127-71233149 CAACCTTGCTCAAGGTCACAGGG - Intronic
1069836114 10:71309197-71309219 GCAATTGGCTCAAGGTCACATGG - Intergenic
1069872577 10:71542271-71542293 GTAACTTGCCCAAGGTCACATGG - Intronic
1070631481 10:78088113-78088135 GGAGCTTTCTCAAGATCTTATGG + Intergenic
1070658135 10:78285149-78285171 ACAGCTGGCTCCAGATCACTGGG + Intergenic
1070692872 10:78540779-78540801 GTAACTTGCCCAAGATCACAAGG + Intergenic
1070700681 10:78599624-78599646 GCAACTTGCTCAAGATCATGTGG + Intergenic
1070726560 10:78795470-78795492 GTAGCTTGCTCAAGGCCACTTGG - Intergenic
1070975110 10:80600160-80600182 TCAGGTTGCCCAAGATCACACGG + Intronic
1071277157 10:84065777-84065799 GCAACTTGCCTAAAATCACAGGG + Intergenic
1071356444 10:84801027-84801049 GTTGCTCTCTCAAGATCACAGGG - Intergenic
1072237061 10:93462484-93462506 GTAACTTGCTCAAGATCACAGGG + Intronic
1073290904 10:102412822-102412844 GCTGCTTCCTCAAGCTCCCAGGG + Intronic
1073294596 10:102431493-102431515 GTAACTTGCCCAAGGTCACAAGG + Intronic
1073703377 10:105955477-105955499 GCCACTTGCTCAAGGTCTCATGG + Intergenic
1074183323 10:111081707-111081729 GCGACTTGCTCAGGATCCCAAGG + Intergenic
1074565898 10:114577577-114577599 GCAGCCTTTTCCAGATCACATGG + Intronic
1074822012 10:117186699-117186721 GTAACTTGCCCAAGGTCACATGG - Intergenic
1074921315 10:118016773-118016795 GTAACTTGCTCAAGGTCACAGGG - Intronic
1075050266 10:119178444-119178466 GGCGCTTGCCCAAGATCACAGGG + Intronic
1075073641 10:119335842-119335864 GCTACTTGCTCAAAGTCACAGGG - Intronic
1075193687 10:120335365-120335387 GCAATTTGGTCAAGGTCACATGG - Intergenic
1075211407 10:120494360-120494382 GCACCTTGCCCAAGGTCACGTGG + Intronic
1075548457 10:123373981-123374003 ACAATTTGCCCAAGATCACAAGG + Intergenic
1076722681 10:132399561-132399583 GAATCTTGCTTCAGATCACATGG - Intronic
1076934458 10:133558271-133558293 GGGGCTTGCTCACGGTCACATGG + Intronic
1077146893 11:1050475-1050497 GCAGCCTGCCCAAGGTCACCGGG + Intergenic
1077856330 11:6129823-6129845 GAAACTTGCCCAAGGTCACAGGG + Intergenic
1078196393 11:9140320-9140342 GTAGCTTGTCCAAGATCACATGG + Intronic
1078362604 11:10680694-10680716 ACAGCTTGCCCAAGGTCACATGG - Intronic
1078868101 11:15317191-15317213 GTAACTTGCCCAAGATCACACGG - Intergenic
1079531647 11:21461709-21461731 GCATCTTGCCTAAGCTCACAAGG + Intronic
1080332110 11:31151141-31151163 GTAGCATGCTCATGAACACAAGG + Intronic
1080644792 11:34180689-34180711 GCGCCTTGCTCAAGGTTACACGG + Intronic
1081586142 11:44385198-44385220 GCAGCTTGCTTGAGGTCACACGG + Intergenic
1081870497 11:46380840-46380862 GGGGCTTGCTCAAGGCCACAGGG - Exonic
1081915846 11:46729636-46729658 GCAACTTGCTCAAAGTCACATGG - Intronic
1082802764 11:57426784-57426806 GGAACTTGCCCAAGGTCACAGGG + Intronic
1082931190 11:58607349-58607371 GAAGCTTATTCAAAATCACAAGG - Intronic
1083258794 11:61512017-61512039 GTGACTTGCTCAAGATCACTTGG - Intergenic
1083403384 11:62440197-62440219 GTGGCTTTCTCAAGCTCACAGGG + Intronic
1083465274 11:62841409-62841431 GAAGATTGCTGAAGACCACATGG + Intronic
1083488730 11:62999573-62999595 GCACCTTGACCAAGGTCACAGGG + Intronic
1083598775 11:63933410-63933432 GCAGCTTGCCTAAAGTCACAAGG + Intergenic
1083925359 11:65802901-65802923 CCATCTTGCTCAAGGTCACACGG + Intergenic
1083959649 11:66007455-66007477 GCAACTTGCTCCAGATCGCATGG - Intergenic
1084199628 11:67547077-67547099 GCATCTAGCTCAAGGTCACATGG - Intergenic
1084569532 11:69951097-69951119 GCTGCTTGCTCAAGCTCCCACGG + Intergenic
1085487039 11:76873364-76873386 GCAGTTTGTTAAGGATCACAGGG + Intronic
1085626662 11:78079149-78079171 GCAGCTTGCCCAAGGTCATATGG - Intronic
1085790739 11:79495256-79495278 ATAGCTTGTTCAAGGTCACACGG + Intergenic
1085821577 11:79799217-79799239 GTAACTTAGTCAAGATCACATGG + Intergenic
1087662235 11:101001117-101001139 GTAACTTGCCCAAGGTCACATGG - Intergenic
1087985120 11:104669347-104669369 GCACATGGCTGAAGATCACAGGG + Intergenic
1088455244 11:110026604-110026626 GTTGCTTGCTGAAGATAACATGG + Intergenic
1088455258 11:110026746-110026768 GAAACTTGCCCAAGGTCACAAGG - Intergenic
1088807721 11:113367291-113367313 GCAACTTGCCCAAAGTCACATGG - Intronic
1089072705 11:115712722-115712744 CCAGGATGCTCAAGATTACATGG + Intergenic
1089185010 11:116608812-116608834 GCAGCTTGCCCAGGGTCAAATGG + Intergenic
1089529585 11:119117828-119117850 GTTGCCTGCTCAAGATCACTTGG - Exonic
1090422033 11:126582015-126582037 GCAGCCTGCCCAGGGTCACACGG + Intronic
1090733435 11:129591159-129591181 GCAGCTGGCTCAGGGTCACAAGG + Intergenic
1090735009 11:129605061-129605083 ACAACTTGGTCAAGGTCACATGG + Intergenic
1090998865 11:131891541-131891563 GCTGCTTGCTCAGGATGTCATGG - Intronic
1091004588 11:131941427-131941449 GTAACTTGCCCAAGGTCACATGG - Intronic
1091171217 11:133521258-133521280 ACTGCTTGCCCAAGATCACTTGG + Intronic
1091281672 11:134385051-134385073 GCAGCTTGCTCAAGGGCACAGGG - Intronic
1091307122 11:134543344-134543366 GCAGCTTTATCAAGTTCTCAGGG + Intergenic
1091780909 12:3214071-3214093 GCAGTTTGCCCAGGATCACACGG - Intronic
1091855997 12:3740796-3740818 GCAACTTGCTCGAGGTCACATGG - Intronic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1092785743 12:12025041-12025063 GCACTTTGCTCAAGATCATCTGG - Intergenic
1093420761 12:18971721-18971743 GAGGCTTGCTCAAGTTCACATGG - Intergenic
1094023683 12:25940865-25940887 ACAACTTGCTCATGATCACTTGG + Intergenic
1096108490 12:49013656-49013678 GCAACTTGCCCAAGGTCACATGG + Intronic
1096302091 12:50438734-50438756 GTAGCTTGCTCAAGGATACAAGG + Intronic
1097126677 12:56782086-56782108 GAAGCATGCTCAAGGTCACCTGG - Exonic
1097356826 12:58611631-58611653 GGAACTTGCTCAAGGTCACACGG + Intronic
1098229407 12:68357730-68357752 GCAGCTTACCCAAGATCACATGG - Intergenic
1098827719 12:75318638-75318660 GCAGCTTGTATAGGATCACAGGG - Intronic
1098870239 12:75809280-75809302 GAGTCTTGCTCAAGACCACATGG + Intergenic
1098954099 12:76670653-76670675 GGAACTTGCCCAAGATCACAGGG - Intergenic
1100507805 12:95237201-95237223 GGAACTTGCCCAAGGTCACAAGG - Intronic
1100819424 12:98417497-98417519 GCAACTTGCTCAAGGTCACATGG - Intergenic
1100874586 12:98948811-98948833 GCAACAGGCTCAAGAGCACACGG + Intronic
1100976352 12:100126233-100126255 GCAGCACGTTCAAGATTACAGGG + Intronic
1101060510 12:100966368-100966390 ATAGCTTGTTCAAGATCACAGGG + Intronic
1101116028 12:101532136-101532158 GGTACTTGCTCAAGATCATATGG - Intergenic
1101241894 12:102847209-102847231 GTGACTTGCTCATGATCACAGGG + Intronic
1101437175 12:104673762-104673784 GGAACTTGCCCAAGGTCACACGG - Intronic
1101714470 12:107298408-107298430 GGAGCTTGCCCAAGGACACATGG - Intergenic
1101991057 12:109485477-109485499 GCAGCTTGCCCAATATCACATGG + Intronic
1101991335 12:109487806-109487828 GCAGCTTGTTCAAGGCCACGTGG - Intronic
1102075804 12:110059030-110059052 GAAGCTTGTCCAAGGTCACATGG + Exonic
1102552747 12:113703475-113703497 GCAACTGGCCCAAGGTCACAAGG - Intergenic
1102716341 12:114976247-114976269 GGGGCTTGCTCAGGGTCACATGG + Intergenic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1103036782 12:117663282-117663304 GCAGTTGGCCCAAGGTCACAAGG - Intronic
1103231805 12:119337395-119337417 GCAGCTTGCCCAAGACCACAGGG - Intronic
1103357639 12:120333413-120333435 GTAACTTGCTCAAAGTCACATGG + Intergenic
1103466646 12:121147224-121147246 GAAGCTTGTCCAAGGTCACATGG - Intronic
1103744335 12:123111816-123111838 CCAGCTTGCTCATGGTCACTGGG - Intronic
1104044877 12:125154640-125154662 GGAACTTGCCCAAGATCCCATGG + Intergenic
1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG + Intergenic
1104294266 12:127497332-127497354 GAAGCTTGCCCAAGAGCAGAGGG - Intergenic
1104707588 12:130958940-130958962 GCGATTTGCTCAAGGTCACAGGG + Intronic
1105531373 13:21223751-21223773 ACATCTTGCCCAAGGTCACATGG - Intergenic
1106567802 13:30901412-30901434 GAAACTTGCTCAAGATGACATGG + Intergenic
1106997813 13:35508104-35508126 GTAATTTGCTTAAGATCACAGGG + Intronic
1108578002 13:51805514-51805536 GCAGCATGCTCAGGTTCACCTGG - Intergenic
1110136293 13:72071443-72071465 GTAACTTGCCCAAGCTCACACGG + Intergenic
1110313760 13:74081182-74081204 GTATCTTGCTTAAGATCACCTGG - Intronic
1111741622 13:92212270-92212292 GCAGTTTGCCCAGGATTACAGGG + Intronic
1112038388 13:95519016-95519038 GCAATTTACTCAAGGTCACATGG - Intronic
1112097481 13:96150702-96150724 GCATCCTGCTCAAAGTCACAGGG - Intronic
1112179021 13:97058376-97058398 GCAGCTTAATCAAGAACATACGG - Intergenic
1112362984 13:98733746-98733768 GCACCTTGATCAAGGCCACATGG - Intronic
1113031268 13:105996500-105996522 GGAGCTTGCTTCGGATCACATGG - Intergenic
1113637226 13:111927966-111927988 GCAACTTTCCCAAGATCACACGG + Intergenic
1113833009 13:113311683-113311705 CTACCCTGCTCAAGATCACAGGG - Intronic
1114610053 14:24034156-24034178 GGAGCTTGGTGAACATCACATGG - Intergenic
1114866995 14:26608024-26608046 ACAGCTTGTCCAAGGTCACATGG - Intergenic
1115199972 14:30842800-30842822 ATTACTTGCTCAAGATCACATGG + Intergenic
1115756476 14:36531340-36531362 GTAAATTGCTGAAGATCACATGG + Intergenic
1118241825 14:64067360-64067382 GTAACTTGCTCAAATTCACAAGG + Intronic
1118595184 14:67429957-67429979 GTAACTTCCTCAAGATCACGTGG + Intergenic
1119432402 14:74577010-74577032 GTGGCTTGCCCAAGGTCACAAGG + Intronic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1120531793 14:85640928-85640950 GCAACTTGCCCAAGGTCACGGGG - Exonic
1120833271 14:89016898-89016920 GTGACTTGCTCAAGGTCACATGG - Intergenic
1120886708 14:89457472-89457494 GTAGCTTGCCCAAGGTCATACGG - Intronic
1120913633 14:89690429-89690451 GTAGGTTGCCCAAGGTCACATGG + Intergenic
1121285473 14:92732101-92732123 GTGACTTGCTCAAGGTCACATGG - Intronic
1121294921 14:92812374-92812396 TCAGCTTACTCAAGAGCACATGG + Intronic
1121323613 14:93007138-93007160 GCTGCCTGCCCAAGGTCACACGG + Intronic
1121895918 14:97647398-97647420 GCAATTTGGACAAGATCACATGG - Intergenic
1124494270 15:30176815-30176837 GCAACCTGCTCAAGTTCCCATGG - Intergenic
1124749300 15:32361830-32361852 GCAACCTGCTCAAGTTCCCATGG + Intergenic
1124848333 15:33311985-33312007 GCGACTTGCTCAAGGTCACTTGG - Intronic
1125286640 15:38100279-38100301 CCAGCTTGTCAAAGATCACATGG - Intergenic
1126733387 15:51707620-51707642 GCAACTTGCTCAAGATCTCATGG + Intronic
1127489971 15:59453277-59453299 GCAACTGGCCCAACATCACATGG - Intronic
1127669019 15:61176660-61176682 GCAGCTTGCCCATGTTCATATGG - Intronic
1127785681 15:62352823-62352845 GTAATTTGCCCAAGATCACATGG - Intergenic
1128093026 15:64931737-64931759 GTAACTTGCTCCAGGTCACAGGG - Intronic
1128554105 15:68618723-68618745 GTAACTTGCCCAAGGTCACATGG + Intronic
1129665241 15:77575967-77575989 GCAGGTTGCTCAAGCTCTCTGGG - Intergenic
1130231321 15:82099474-82099496 GCAACTTGCCCAGTATCACAGGG - Intergenic
1130892437 15:88144644-88144666 ACAGGTAGTTCAAGATCACATGG - Intronic
1131174851 15:90202989-90203011 GTAGCCTGCTCAAGGTCACATGG - Intronic
1131376476 15:91928393-91928415 GCAGCTTGTTCAGGGTCATATGG + Intronic
1131439891 15:92451802-92451824 GTAACTTGCACAAGATCCCACGG + Intronic
1131504523 15:93004895-93004917 CCAGCCTGCTGAAGAGCACATGG - Intronic
1132555081 16:568771-568793 GCAGCTGGCCCAGGATCTCAAGG - Exonic
1132997664 16:2831604-2831626 GTAACGAGCTCAAGATCACAGGG + Intronic
1133888532 16:9855211-9855233 GTGGCTTGTTCAAGGTCACATGG - Intronic
1134174333 16:11993626-11993648 GTAACTTGCTCATGATCACATGG + Intronic
1134637313 16:15802366-15802388 GCAACTTGCCCAAGGTCACTAGG + Intronic
1134681281 16:16127568-16127590 GTTACTTGCCCAAGATCACATGG + Intronic
1134830058 16:17315744-17315766 GCAACTTGCCCAAGGTCACCTGG + Intronic
1135932115 16:26747241-26747263 GGAGCATGCTCCAGAGCACATGG - Intergenic
1135968640 16:27055964-27055986 GTCACTTGCCCAAGATCACATGG + Intergenic
1137790637 16:51171870-51171892 GGGACTTGCTCAGGATCACATGG - Intergenic
1137983825 16:53091295-53091317 GCAGCTTGCCCAAGGTCACCCGG - Intronic
1138644006 16:58409595-58409617 GCAGCTTTCCCTAGACCACAAGG - Intergenic
1139297041 16:65910051-65910073 GTAACTTGTTCAAGGTCACACGG - Intergenic
1140439440 16:74975730-74975752 GTAACTTGCCCAAGATCACATGG + Intronic
1140649165 16:77067624-77067646 GCAACATTCTCAATATCACAAGG + Intergenic
1140659215 16:77171320-77171342 GTAACTTGCTCAAGGTCATATGG - Intergenic
1140713442 16:77699910-77699932 GTAGCTTGCCCAAAGTCACACGG + Intergenic
1140776466 16:78253463-78253485 GTACCCTGCTCAAGATCACTGGG + Intronic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1141921023 16:87135589-87135611 CCAGCTGGCTCAAGAACACAGGG + Intronic
1142616833 17:1141406-1141428 GTAGCTTGCCCAAGGTCACATGG - Intronic
1142754355 17:2007052-2007074 GCAGCTTGCCCAGCATCATACGG - Intronic
1142950273 17:3472449-3472471 GTAACTTGCCCAAGGTCACAGGG - Intronic
1143289413 17:5817695-5817717 GCAACTTGCTCAAGGCCACAGGG + Intronic
1143849881 17:9802884-9802906 GCAACCAGCTCAAGGTCACATGG - Intronic
1144475117 17:15580982-15581004 ATAATTTGCTCAAGATCACACGG + Intronic
1145088799 17:19968737-19968759 GTAACTTGTCCAAGATCACATGG - Intronic
1145770918 17:27492499-27492521 GCAGCTTGTCCAAGGTCACATGG - Intronic
1146008476 17:29177059-29177081 GGGACTTGCTCAAGGTCACACGG - Intronic
1146520031 17:33519186-33519208 GTAGCTTACCCAAGGTCACACGG + Intronic
1146931519 17:36781363-36781385 GCAACTTGCCCAAAGTCACACGG - Intergenic
1146959097 17:36957208-36957230 GTAACTTGCCCAAGGTCACATGG - Intronic
1147499890 17:40952914-40952936 GTAACTTGCCCAAGATCTCATGG + Intergenic
1147638357 17:41978102-41978124 GTAACTTGCCCACGATCACATGG + Intronic
1147789540 17:43004948-43004970 GAAACTTGCCCAAGGTCACAGGG - Intergenic
1147833662 17:43314961-43314983 GCAGCTTGCCCAAGACCACAGGG - Intergenic
1148196129 17:45714674-45714696 GTAACTTGCCCAAGGTCACACGG + Intergenic
1148546614 17:48524172-48524194 GCAACTTGCCCAAGGCCACAGGG + Intergenic
1149005802 17:51803985-51804007 GCAACTTGGTCAAGATCACACGG - Intronic
1149035490 17:52129489-52129511 GTAACTTGCTTAAGATCACATGG + Intronic
1149445028 17:56706682-56706704 ATTACTTGCTCAAGATCACACGG + Intergenic
1149559859 17:57600935-57600957 GCAGTTTGCCCAAGGTCACATGG + Intronic
1149577490 17:57724635-57724657 AGAGCTTGTTCAAGGTCACACGG + Intergenic
1149609529 17:57949938-57949960 ATAACTTGCCCAAGATCACATGG - Intronic
1149982115 17:61318986-61319008 TGAGCTTGCTCAAGATCACATGG - Intronic
1150439783 17:65181741-65181763 AGAGCTTGCCCAAGATCACATGG - Intronic
1150722785 17:67627767-67627789 GAGGCTTGCTCAAAGTCACATGG - Intronic
1151530789 17:74703412-74703434 GCAGGTTGCTCAAGTTCAGCTGG - Intronic
1152381034 17:79942340-79942362 GCAGCTTGCCCAGGGCCACACGG - Intronic
1153583382 18:6597783-6597805 GCACCTTGCTGAAGGTCAAACGG + Intergenic
1154145576 18:11863614-11863636 GCTGCTTCCTTAAAATCACATGG + Intronic
1155073893 18:22338727-22338749 GCAATTTGCTCAAGCTCACTTGG - Intergenic
1155157739 18:23171583-23171605 GCAGATTCCTAAAGATCTCAAGG - Intronic
1156005879 18:32440268-32440290 ATAACTTGCTTAAGATCACACGG + Intronic
1156083410 18:33368677-33368699 GCAACTTGTTCAAGCTCACAAGG - Intronic
1157203316 18:45677486-45677508 GCAACTTGCCCAGGATTACATGG - Intronic
1157356051 18:46935364-46935386 GCAGCTTCCTCAGGAAAACAAGG - Intronic
1158308597 18:56134187-56134209 GTGGCTTGCTCAAAATCACATGG + Intergenic
1158503235 18:58022414-58022436 GGAGCTAGCTCGAGGTCACATGG - Intergenic
1158545745 18:58395002-58395024 GTAACTTGCCCAAGGTCACACGG - Intronic
1158589834 18:58769905-58769927 CTGGCTTGCTCAAGGTCACAGGG + Intergenic
1160461242 18:79040386-79040408 AAAACCTGCTCAAGATCACATGG + Intergenic
1161682102 19:5685211-5685233 GCGACTTGCCCAAGGTCACACGG - Intronic
1161885101 19:6988482-6988504 GTGGCTGGCTCAAGGTCACATGG - Intergenic
1162401638 19:10450373-10450395 ACAGCTTCTTCAAGACCACATGG - Intronic
1162897772 19:13775708-13775730 ACAATTTGCTCAAGATCACAGGG - Intronic
1163890386 19:20007517-20007539 GAAGCTTGCTCAAAGTCACTGGG + Intronic
1164463661 19:28469774-28469796 GCATCTTGCTCAAGATCATTCGG + Intergenic
1166608939 19:44171596-44171618 GGAACGTGCTCAAGTTCACATGG + Intronic
1166820211 19:45574594-45574616 GCTGCCTGCTCAAAGTCACATGG + Intronic
1166887483 19:45971062-45971084 ACCGCTTGCCCAAGGTCACACGG - Intronic
1166896068 19:46022594-46022616 GCAGCTTACTGAACCTCACAAGG - Intronic
1167146947 19:47686856-47686878 GCAGCCTGCTGAAGGTCACAGGG - Intronic
1167245066 19:48368203-48368225 ATAGCTTGCTCAGGGTCACACGG - Intronic
1167356338 19:49006554-49006576 TCAGATCGCTCAAGATCCCACGG + Intronic
1167666479 19:50825417-50825439 GCCTCTTGTTCAAGATCACACGG + Intronic
1168463036 19:56577404-56577426 ACACCTTGCTCAACATCAGAGGG + Exonic
925114312 2:1365679-1365701 GCAGCTTGGTACAGATGACAGGG - Intronic
926268599 2:11347241-11347263 GTAACTTGCTCAGGGTCACATGG - Intronic
926729267 2:16023010-16023032 GCAACTTGCCCAAGTTCACATGG - Intergenic
926855157 2:17247969-17247991 GTAACTTGTTCAAGATCAAATGG - Intergenic
927070893 2:19528570-19528592 TTTACTTGCTCAAGATCACAGGG + Intergenic
927187815 2:20494821-20494843 GCAGCTTGTCCAAGGTCACAGGG + Intergenic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
928540871 2:32282401-32282423 GTAGCTTGCCCAAGATCACATGG - Intronic
928641696 2:33305898-33305920 CCAGCTTGCTAAAAATCCCATGG - Intronic
929324866 2:40597009-40597031 TTAGCCTGCTCAAGATCACATGG - Intronic
929874699 2:45786845-45786867 GTAACTTGCACAAAATCACATGG + Intronic
930737846 2:54797793-54797815 GTAACTTGCCCAAGATTACATGG - Intronic
931709486 2:64976149-64976171 GTAACTTTCCCAAGATCACAAGG + Intergenic
932020136 2:68076033-68076055 GCATGTTGCTAAAGATCATATGG + Intronic
932046023 2:68350793-68350815 GTAACTTGCCCAAGGTCACATGG + Intergenic
932443989 2:71760775-71760797 GCAGCTTTCTCAAAATAAAAAGG + Intergenic
932721331 2:74140870-74140892 AAAACTTGCTCAAGGTCACATGG + Intronic
932909089 2:75786969-75786991 GCTGCTTCTTCAAGATCAAAGGG - Intergenic
932924946 2:75962501-75962523 ACATTTTGCTCAAGTTCACAAGG + Intergenic
933364706 2:81336407-81336429 ACATTTTTCTCAAGATCACATGG + Intergenic
933693146 2:85195132-85195154 GTAACTTGCTCAAGGTTACAAGG - Intronic
933808231 2:86015574-86015596 GCCACTTGCTGAAGGTCACAGGG + Intergenic
934558526 2:95300239-95300261 GCAGCTAGCTCCAGGTCACGTGG - Intronic
934615349 2:95767298-95767320 GCGCCTTGTTCAAGATCATAGGG + Intergenic
934838960 2:97613350-97613372 GCGCCTTGTTCAAGATCATAGGG - Intergenic
936246082 2:110828710-110828732 GTCATTTGCTCAAGATCACATGG + Intronic
936264126 2:110987543-110987565 GTACCTTGCTCAAGGTTACATGG + Intronic
936688526 2:114857943-114857965 GTAGCTTTCTCAAGGTCACATGG - Intronic
937034588 2:118770207-118770229 GCAACTTGCCCAAGGTCGCATGG - Intergenic
937358726 2:121214316-121214338 GTAGCCTGCTCAAAATCATACGG + Intergenic
937397637 2:121552049-121552071 TCAGCTTGTTGAAGATCAGATGG - Intronic
937646482 2:124271056-124271078 GGAGATTGCTCACGACCACAGGG - Intronic
938233223 2:129679753-129679775 GTAACTTGCCCAAGGTCACATGG + Intergenic
938626883 2:133119795-133119817 GTAACTTGCTTATGATCACATGG - Intronic
938707144 2:133942205-133942227 GTAGCTTTCTTATGATCACAGGG - Intergenic
938979537 2:136513247-136513269 GTGACTTGTTCAAGATCACATGG - Intergenic
939002361 2:136751079-136751101 GTATCTTGTTCAAGGTCACAAGG + Intergenic
939057976 2:137385516-137385538 GAAGCTGGCTCAAGACCACTGGG - Intronic
939096462 2:137838429-137838451 GCAAGTTGCTTAACATCACAAGG - Intergenic
939402505 2:141712475-141712497 GTGGCTTGCTCAGGATCCCACGG - Intronic
939763310 2:146212019-146212041 GTATCTTGCTCAAGGTCATATGG + Intergenic
940130770 2:150378934-150378956 GAAGCATGTCCAAGATCACATGG - Intergenic
940259846 2:151768136-151768158 GCAGCTTTCCCAGGGTCACATGG - Intergenic
941493273 2:166169029-166169051 GGACCTTGTTCAGGATCACATGG - Intergenic
941977386 2:171420230-171420252 GCGGCTTGGTCAAGATCTCAGGG + Intronic
942157813 2:173149594-173149616 GAACCTTGCTCAATAGCACAGGG + Intronic
942368288 2:175253460-175253482 GTAGCTTGCTTCAGGTCACAGGG + Intergenic
943537038 2:189165652-189165674 GGAACTTGTTCAAGGTCACAAGG + Intronic
944056899 2:195531741-195531763 GTTGCTTGCTCAGGATCACATGG + Intergenic
944407236 2:199399044-199399066 GCAGGTCGCTTAAGCTCACAAGG + Intronic
945306662 2:208265818-208265840 GCAATTTGCTTAAGATCATATGG + Intronic
945314111 2:208352074-208352096 GCAACTTGCTCAAGATCACTTGG - Intronic
945444242 2:209916996-209917018 GAGGCTTGCACAAGATCTCATGG + Intronic
945622492 2:212158179-212158201 GCAACTTGCCCAAAGTCACATGG + Intronic
946076683 2:217079446-217079468 CCAACTTGGGCAAGATCACATGG + Intergenic
946247762 2:218397165-218397187 GCAGGTTGGTCAAGAAGACACGG + Intergenic
947186551 2:227460406-227460428 GTTGCTTGCTCAAGCTCCCAGGG - Intergenic
947186701 2:227461860-227461882 GTTGCTTGCTCAAGCTCCCAGGG + Intergenic
948125775 2:235563902-235563924 GAAGCTTGCTCCAGGTTACATGG + Intronic
948853026 2:240717647-240717669 GCAGCCTGCCCAAGGGCACACGG + Intronic
948934666 2:241155317-241155339 GCAGCTTGTCCAAGGGCACACGG + Intronic
1170585361 20:17730265-17730287 GTGGATTGCTCAAGATCACATGG + Intronic
1171118318 20:22546487-22546509 GCCACTTGTTCAACATCACAAGG + Intergenic
1171470971 20:25371038-25371060 GCAGCTTGCTCATGATGGGAGGG - Intronic
1172611868 20:36258495-36258517 GCAGCTTGCTCAAGATCACACGG - Intronic
1172822866 20:37753843-37753865 GGAGCTTGCACAAGATTACATGG + Intronic
1172822881 20:37753973-37753995 GGGGCTTGCACAAGATTACATGG + Intronic
1173010503 20:39177328-39177350 GCATCTTGCCTAAGATCACTGGG - Intergenic
1173113393 20:40217534-40217556 GTAGCTTACCCAAGGTCACAGGG + Intergenic
1173759409 20:45546621-45546643 GTAACTTGCCCAAGATTACAGGG + Intronic
1173813474 20:45970546-45970568 GTAGCTTGCTCAAGATCACACGG + Intronic
1174171992 20:48623558-48623580 GCAGCTTCATAAAGATCACCTGG + Intergenic
1174267840 20:49344845-49344867 GTGGCTTGCTCAAGGTCCCATGG - Intergenic
1174324065 20:49765012-49765034 GTAATTTGCTCAGGATCACATGG + Intergenic
1174367713 20:50066551-50066573 GCCACTGGCTCAAGGTCACAGGG + Intergenic
1174728730 20:52892707-52892729 ACAACTTTCTCAATATCACAGGG - Intergenic
1175469217 20:59214479-59214501 CCAGCTGACTCAAGATGACATGG - Intronic
1175669937 20:60893369-60893391 ATAACTTGCTCAAGGTCACATGG + Intergenic
1175910067 20:62401019-62401041 GCAACTTGCCCAAGATGACATGG + Intronic
1177650509 21:23954986-23955008 ATAACTTGCTCAAAATCACATGG + Intergenic
1177849150 21:26325695-26325717 GCAGCTTGGTCAAGTTCTTATGG + Intergenic
1178681149 21:34672763-34672785 GTAACTTGCCCAAGGTCACACGG - Intronic
1178883860 21:36469516-36469538 GTATCTTACTCAAAATCACACGG + Intronic
1179156204 21:38853323-38853345 GCAGCAGGCTCAACATCACCTGG - Intergenic
1179228821 21:39481465-39481487 GTAGATTGCTCCAGGTCACAAGG + Intronic
1179567267 21:42257143-42257165 GGAACTTGCCCAAGGTCACACGG + Intronic
1180382461 22:12153880-12153902 CCAGCTTGGTCAACATAACAAGG - Intergenic
1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG + Intronic
1181915469 22:26276308-26276330 GGAATTTGCTCAAGGTCACATGG + Intronic
1181949473 22:26543705-26543727 GCAGCTTGCCCAAGGTTGCATGG + Intronic
1181975918 22:26729583-26729605 GTAGCTTGCTCAAGAGCACACGG + Intergenic
1182065601 22:27429344-27429366 GTAACTTGCTCAAGGTCATATGG + Intergenic
1182070202 22:27458178-27458200 CCAGCTTGCTGAAGCACACAGGG - Intergenic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182124684 22:27807914-27807936 GGAGCTTGCCCTAGGTCACACGG + Intergenic
1182323500 22:29493870-29493892 GCAGCTTGCTCAGGATTCTATGG - Intergenic
1182554548 22:31122270-31122292 GGAACTTGCTCAAGGTCACCTGG - Intergenic
1182639539 22:31755476-31755498 GGAGCTTGCCCAAGGTCACCAGG - Intronic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183492779 22:38125640-38125662 GTGACTTGCTCAAGGTCACACGG - Intronic
1183516373 22:38269092-38269114 GCATCTTGCCCAAGGCCACAGGG + Intronic
1183529908 22:38347725-38347747 GTGACTTGCTCAAGGTCACATGG + Intronic
1183670706 22:39270736-39270758 GCCCCTTGCTCAGGGTCACAAGG - Intergenic
1183713213 22:39519088-39519110 GCTTCTTGCTCAAAGTCACAAGG - Intergenic
1184212118 22:43042170-43042192 GCAGCTTGCTCAAGGTCTGGTGG + Intronic
1184550586 22:45202397-45202419 CCAGCTTGCCCCAGGTCACAAGG - Intronic
1184684913 22:46091886-46091908 GGGGCTGGCCCAAGATCACACGG - Intronic
1185364311 22:50429843-50429865 CAAGGTTGCTCAAGGTCACATGG + Intronic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
950243233 3:11390924-11390946 GATACTTGCTCAAGGTCACATGG - Intronic
950367681 3:12499625-12499647 GTAGCTTGCCCAAGATTACGTGG + Intronic
950683461 3:14601284-14601306 GAGGCTTGTCCAAGATCACAGGG + Intergenic
950839869 3:15957618-15957640 GTAGCTTTCCCAAGGTCACATGG + Intergenic
951586002 3:24215344-24215366 GCAACTTGCTCCAAGTCACAAGG + Intronic
952231789 3:31438975-31438997 GCAGCTTGATCCAGCTAACAGGG + Intergenic
952354107 3:32569174-32569196 GCAACTTGCTTAAGATCCTAGGG + Intronic
952743964 3:36760940-36760962 GTATCTCGCTCAGGATCACATGG + Intergenic
952968080 3:38633254-38633276 GCAGCTTCCGCAGGTTCACACGG - Exonic
954416340 3:50395305-50395327 GCAGCCTGCCCAAGGTCACATGG + Intronic
955412438 3:58664640-58664662 GCAACTTGCCTAAGGTCACATGG + Intronic
955741762 3:62098600-62098622 GTAACTTGCCCAAGGTCACATGG + Intronic
956100201 3:65760344-65760366 GAAACTTGCCCAAGGTCACACGG + Intronic
956165760 3:66397138-66397160 ACAGCATGCTGAACATCACAGGG + Intronic
956247670 3:67202685-67202707 GCAGCTAGTCCAAGGTCACAAGG + Intergenic
956417680 3:69051078-69051100 GTAACTTGCTCTAGGTCACACGG - Intronic
956573288 3:70721273-70721295 GTAGACTGCTTAAGATCACATGG + Intergenic
956737602 3:72250045-72250067 GTACCTTGCCCAAGATCAGATGG - Intergenic
959206399 3:103312354-103312376 ATAACTTGCCCAAGATCACAAGG - Intergenic
960056083 3:113277486-113277508 GCAATTTGCTCAAGGCCACACGG - Intronic
960701289 3:120441883-120441905 GTAGTTTTCCCAAGATCACATGG + Intronic
960737902 3:120800741-120800763 GTAATTTGCCCAAGATCACATGG + Intergenic
961588217 3:127952990-127953012 GCAACTTGCTCAAAATCACATGG - Intronic
961591714 3:127986205-127986227 TCATCTTGCCCAAGTTCACATGG - Exonic
961647956 3:128402542-128402564 GTACCTTGCCCAAGGTCACACGG - Intronic
962468154 3:135679689-135679711 GCAGGTTGTCCAAGATCACATGG + Intergenic
962976568 3:140451182-140451204 TCAGCTTGTTAAAGATCAGATGG + Intronic
963219746 3:142796152-142796174 GTAACTTGCGCAAGGTCACATGG + Intronic
963297966 3:143567750-143567772 GCAGCTTGCTCATTAACACGTGG - Intronic
963313715 3:143735843-143735865 GTAGCTTGCTCAATGTCACATGG - Intronic
963897098 3:150698654-150698676 GCAACTTGCCCAACATCACAAGG + Intronic
964724284 3:159798265-159798287 GTAATTTGCTCAAGGTCACATGG - Intronic
964991545 3:162818824-162818846 CCATCTTGCTCAAGACCACAAGG + Intergenic
965197411 3:165619284-165619306 GCAGCATGCTCATTCTCACATGG - Intergenic
965654259 3:170967277-170967299 ACAACTTGCTGAAGGTCACAGGG + Intergenic
966112686 3:176421865-176421887 GTAGCTTGGTAAAAATCACAGGG + Intergenic
966239437 3:177739922-177739944 GTAACTTGCTGAAGGTCACATGG - Intergenic
967317439 3:188162626-188162648 AGAACTTGTTCAAGATCACAGGG - Intronic
967412859 3:189184175-189184197 GGAGCTTGCCCAGGGTCACACGG - Intronic
968126277 3:196162840-196162862 GCAGCTTGCCCAGGGTCACCCGG + Intergenic
968228568 3:196991035-196991057 GTAACTTGCCCAAGATCACTCGG - Intronic
968387506 4:155068-155090 CCTGCAGGCTCAAGATCACATGG - Intronic
968447451 4:658857-658879 GCACCTTCCTCTAGCTCACACGG + Intronic
969053925 4:4390133-4390155 CCTGCGTGCTCAAGGTCACATGG + Intronic
969085117 4:4650783-4650805 GCAGCTTGCTCAAGATAACAAGG + Intergenic
969116844 4:4875611-4875633 GCACCTTTTCCAAGATCACATGG + Intergenic
969837602 4:9855820-9855842 TCAGCTTGTTGAAGATCAGATGG - Intronic
969842112 4:9890345-9890367 GTGTCTTGCCCAAGATCACACGG + Intronic
969974513 4:11084547-11084569 GCCTCTAGCTCAAGGTCACATGG + Intergenic
970192412 4:13529055-13529077 GCAGCTTATCCAAGATCTCAAGG - Intergenic
970209707 4:13696623-13696645 GCTGGATGCTCAAGACCACAAGG + Intergenic
970254262 4:14151088-14151110 GCAATTTGATCAAAATCACACGG + Intergenic
970372342 4:15420677-15420699 GCAATTTGCCCAAGGTCACATGG + Intronic
970814267 4:20135445-20135467 GCAGGTTGTTGAAGATCACAAGG - Intergenic
970828588 4:20307818-20307840 GTAACTTGCCCAAGCTCACATGG + Intronic
970912858 4:21298017-21298039 ATAACTTGCTTAAGATCACAAGG - Intronic
972019335 4:34290540-34290562 GCATTTTGCCCAAGAACACATGG + Intergenic
972234714 4:37117847-37117869 GCAACTTGCTCAAGGTCACATGG - Intergenic
972356405 4:38283052-38283074 GAAGCCTGGTCAAGATCACTAGG - Intergenic
972736672 4:41848750-41848772 GAGGCTTGGTCAAGGTCACATGG + Intergenic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
973797476 4:54442866-54442888 GTAGCTTGCCCAAAGTCACACGG - Intergenic
975387011 4:73769644-73769666 GCAGCTTCCTCCTGATCTCAGGG - Intergenic
976334334 4:83868288-83868310 ACAACTTGCCCAAGATCACGTGG - Intergenic
978382558 4:108144806-108144828 GCAGATTGCTCAGAATCACCTGG - Intronic
979293005 4:118998985-118999007 ATGGCTTGCCCAAGATCACACGG - Intronic
979513892 4:121584959-121584981 GAAACTTGCTCAAGGTCACTTGG - Intergenic
979532037 4:121779162-121779184 GCAGCTGGCTCCAGACCTCAGGG - Intergenic
981171773 4:141633545-141633567 ACAGCTTGCCTAAGATCACATGG - Intergenic
981250384 4:142594503-142594525 GCAGCTTGCTCCAAATTACATGG + Intronic
981302277 4:143201239-143201261 ACAGCTTTGTCAAGATCAGATGG - Intronic
981572018 4:146161834-146161856 GTAATTTGCTCAAGATCACATGG - Intergenic
982168212 4:152635404-152635426 GTGGCTTGTTCAAGTTCACATGG - Intronic
982342405 4:154315276-154315298 GTAACTTGTTCAAGGTCACATGG + Intronic
982798455 4:159673135-159673157 GCAGCTTCCTCCTGATCTCAGGG - Intergenic
983514020 4:168638252-168638274 GCATCTTGCCCAAGATCACATGG + Intronic
984880254 4:184404596-184404618 GGAGTTTGCCCAAAATCACATGG + Intronic
985471026 5:46202-46224 GCAGCTTACTGAAGTTTACACGG + Intergenic
986157082 5:5187088-5187110 GCAGCTTGCTGAGGACAACAGGG - Intronic
987998981 5:25325782-25325804 ACAGCTTGCTTAAGTTCACACGG - Intergenic
988093878 5:26577103-26577125 GGGACTTGCTCAACATCACAGGG - Intergenic
990007127 5:50956632-50956654 GTAACTTGCACAAGATTACAGGG + Intergenic
990253023 5:53936353-53936375 ACAATTTGCTCAAGGTCACATGG + Intronic
991206541 5:64056231-64056253 GTAACTTGTCCAAGATCACACGG - Intergenic
992036833 5:72787889-72787911 ACAAATTGCTTAAGATCACATGG - Intergenic
992182722 5:74213807-74213829 GTAGCTTGTCCAAGGTCACATGG + Intergenic
992614273 5:78534365-78534387 GCAGCCTGCTCGAGGACACACGG - Intronic
993456487 5:88132956-88132978 GTAACTTGCCCAAGATCACTTGG - Intergenic
993570950 5:89538312-89538334 GCAACTTGACCAAGATCACAAGG + Intergenic
993998274 5:94748303-94748325 AGAGCTTGCTAAAGAGCACAGGG + Intronic
996032738 5:118724069-118724091 GTGGCTTGCCCAAGATCACTTGG - Intergenic
996596535 5:125209659-125209681 GAACCTTGATCAAGTTCACATGG + Intergenic
997607194 5:135183599-135183621 GCAACTTACCCCAGATCACACGG - Intronic
997690242 5:135823245-135823267 GGGGCTTGCTCAGGATCAAAGGG + Intergenic
997858747 5:137397016-137397038 GCAACTTGCTCAACATCTCTGGG - Intronic
998796261 5:145822636-145822658 GTGACTTGCTCAAGGTCACATGG - Intronic
999182530 5:149680352-149680374 GCAGCTTGCCCTAGGTCACGCGG + Intergenic
999267217 5:150274717-150274739 GTAGATTGCCCAAGGTCACATGG + Intronic
999652413 5:153780348-153780370 GCTACTTTCTCAAGATCACATGG - Intronic
1000036191 5:157449926-157449948 GCAAACTGCTCAAGGTCACAAGG + Intronic
1000119171 5:158180162-158180184 GCAACTTGCCCAAGGCCACACGG - Intergenic
1000815230 5:165912907-165912929 GGAACTTGCTCAAGGTCAAAGGG - Intergenic
1001119593 5:168968844-168968866 GTAACTTACTCAAGGTCACACGG - Intronic
1001245355 5:170102001-170102023 GAAACTTGGCCAAGATCACAAGG + Intergenic
1001694680 5:173661128-173661150 GCGACTTGCTCAAGATCATGTGG + Intergenic
1002372495 5:178766643-178766665 GGAGCTTGCCCAAGGTCACATGG - Intergenic
1003044066 6:2716731-2716753 ATAGCTTGTCCAAGATCACATGG - Intronic
1003916681 6:10793351-10793373 GTAGCCTGCCCAAGATCTCACGG + Intronic
1004943817 6:20589941-20589963 ACAGCTTTCTCAAAGTCACATGG - Intronic
1005899311 6:30204197-30204219 GCAACTTGCCCAAGAGCACATGG + Intronic
1006550049 6:34815006-34815028 GCAGTTTGCCCTAGATGACAGGG - Intronic
1006748656 6:36363005-36363027 GTGACTTGCGCAAGATCACATGG - Intronic
1006803704 6:36775356-36775378 AGAGCTTGCTCAAGGTCACACGG - Intronic
1007056416 6:38890179-38890201 GCCGATTGTTCAAGGTCACATGG - Intronic
1007243843 6:40445804-40445826 GCAACTTGCCCAAGACCACAGGG - Intronic
1007479390 6:42140242-42140264 GCAGCTGGCTGGAGATGACAGGG + Intronic
1007736827 6:43987185-43987207 GGAGCTTGCTCAAGAGCCCGTGG + Intergenic
1008506362 6:52234678-52234700 GCGACTTGCTCAAGGTCACTTGG - Intergenic
1009471892 6:64036842-64036864 GTAACTTGCTCTAGACCACACGG + Intronic
1010057194 6:71580187-71580209 GTAACTTGCCCAAGGTCACACGG + Intergenic
1010731632 6:79397383-79397405 GCAACTTGCTCGATATCTCATGG + Intergenic
1011514440 6:88137188-88137210 GTATCTTGCCCAAGTTCACATGG - Intergenic
1011554476 6:88560334-88560356 GTAGCCTGCCCAGGATCACATGG + Intergenic
1011709335 6:90036187-90036209 GCAGTTGGCACAAGATCATATGG + Intronic
1013441352 6:110173510-110173532 GTAATTTGCTCAAGGTCACATGG - Intronic
1013581329 6:111537351-111537373 GTAACTTGCCTAAGATCACATGG + Intergenic
1014181613 6:118390557-118390579 GCAGCTTGCCCAAGTTGAAAGGG + Intergenic
1014764750 6:125393519-125393541 TCAGCTGCCTCAAGAGCACAGGG + Intergenic
1016143646 6:140643946-140643968 CCAGCAGGCTCAACATCACATGG + Intergenic
1017676569 6:156820326-156820348 ACAGCTTCCTCAATACCACATGG - Intronic
1017746326 6:157449909-157449931 TAAACTTGCTCAAGTTCACATGG - Intronic
1018607256 6:165610868-165610890 GCTGCTTGCTAAAGGTCACATGG - Intronic
1020154779 7:5713902-5713924 TTAAATTGCTCAAGATCACAGGG + Intronic
1020444993 7:8259679-8259701 GTAACTTGGTCAAGGTCACACGG + Intronic
1021596416 7:22321932-22321954 AAAGCTTGGTCAAGATTACAAGG + Intronic
1021612030 7:22466873-22466895 GTAACTTGGTCAAGATCTCATGG - Intronic
1021660208 7:22912561-22912583 TCAGCTTGCTCAAGTTAGCAAGG + Intergenic
1021715119 7:23454641-23454663 TCAGTTTGCACAAGATCACAGGG + Intronic
1022045983 7:26622787-26622809 GCATCTTGCTCAAGGTCACTGGG - Intergenic
1022680111 7:32536919-32536941 GCAGCATGCTAAAGATGGCATGG - Intronic
1022799361 7:33761097-33761119 GTCACTTCCTCAAGATCACATGG + Intergenic
1023255415 7:38307903-38307925 GCTGATTGGTCAGGATCACATGG + Intergenic
1023377058 7:39566813-39566835 GCAGTTTGTTGAGGATCACAGGG + Intronic
1027162429 7:75812479-75812501 GTAACTTGCTCAAGGTCACGTGG - Intronic
1027206878 7:76107441-76107463 GCAGCCTGCCCAAAATCACATGG + Intergenic
1027435163 7:78156637-78156659 GTAACTTCCTCAAGGTCACATGG + Intronic
1027658564 7:80961620-80961642 ACAGCTTGCCCGAGATCAAAAGG - Intergenic
1028234607 7:88345838-88345860 GCATCTTGCCCAAGGACACACGG - Intergenic
1028921187 7:96312204-96312226 ATAACTTGCCCAAGATCACATGG - Intronic
1030271477 7:107673408-107673430 GTACCTTGATCAATATCACAGGG - Intronic
1031713091 7:125073700-125073722 GCAACATGCTGAAGATCAAACGG + Intergenic
1032087026 7:128889852-128889874 GTAACTTGCCCAAGACCACACGG + Intronic
1032684318 7:134216061-134216083 GTAACTTGCCCAAGGTCACATGG - Intronic
1033846239 7:145435410-145435432 AGAGTGTGCTCAAGATCACAAGG + Intergenic
1034105953 7:148490015-148490037 GTATATTGCTCAAGGTCACACGG - Intergenic
1034500801 7:151449212-151449234 GTAGCTTGCACAAGGTCACAGGG + Intergenic
1034702007 7:153104652-153104674 GCAACTTGCTTAAGTTCACTTGG + Intergenic
1034731145 7:153388570-153388592 GTAACTTGCCCAATATCACATGG + Intergenic
1035218961 7:157393555-157393577 TCACCCTCCTCAAGATCACAGGG - Intronic
1037493113 8:19414015-19414037 CCAGCTTGCACCAGCTCACAAGG + Intronic
1037981693 8:23258929-23258951 AAAGCTTCCTCAAGTTCACAAGG - Intronic
1039236105 8:35504244-35504266 ACAGCTTGCCTAAGGTCACACGG - Intronic
1039756197 8:40525603-40525625 GAAGCTTGCCCGAGATCTCAAGG + Intergenic
1040629915 8:49198444-49198466 GCAGCTTACAGAAGCTCACAGGG - Intergenic
1040906308 8:52472816-52472838 AGAACTTGCTCAAGGTCACATGG + Intergenic
1041283268 8:56233131-56233153 GTGACTTGCTCAAGTTCACATGG + Intergenic
1041755110 8:61305023-61305045 GCAACTTGCTCAAGACCCCATGG - Intronic
1041874556 8:62673074-62673096 GCAGCTTTCTCAAGGTCCAACGG + Intronic
1042545362 8:69946571-69946593 AGAGCCTGCTCAAGGTCACATGG - Intergenic
1042652730 8:71060831-71060853 GCAACTTGGTCAAGACCACATGG + Intergenic
1042998064 8:74722841-74722863 GCATCTTGCCCAAGATTACACGG + Intronic
1043880828 8:85540441-85540463 GTAACTTGTTCAAGATCCCATGG - Intergenic
1044210358 8:89542822-89542844 GCAATTTGCTCAAAATCGCATGG + Intergenic
1044759710 8:95505316-95505338 GCAACTTGGCCAAGGTCACATGG + Intergenic
1044794556 8:95883853-95883875 GTAACTTGCTCAAAATCAAATGG + Intergenic
1045743129 8:105385948-105385970 GTAACTTGCTCAAGGTCACATGG - Intronic
1045757061 8:105556511-105556533 GTAACTTGCTAAGGATCACATGG + Intronic
1045769411 8:105717892-105717914 GTAGCTTGCTCATCATCTCATGG + Intronic
1047325144 8:123828810-123828832 GCACTTTGCCCAAGGTCACATGG - Intergenic
1047495695 8:125407115-125407137 CCAGCTTTCTCCACATCACACGG - Intergenic
1047657199 8:126991003-126991025 ATAACTTGGTCAAGATCACATGG - Intergenic
1048396679 8:134020631-134020653 GTAACTTGCTCAAGGTCACACGG + Intergenic
1048577620 8:135705641-135705663 GAAGTTTGCTCCAGACCACAGGG + Intergenic
1048842287 8:138576701-138576723 GCAGCCTGCTCAGGATGACACGG + Intergenic
1048844579 8:138594529-138594551 GTAGCTTGCTCAAGGCCACCTGG - Intronic
1049190941 8:141287032-141287054 GCGACTTCCTCAAGGTCACACGG - Intronic
1050870228 9:10558539-10558561 GTAGCTTGCCCAAGGCCACATGG - Intronic
1051380378 9:16451966-16451988 GTATCTTGCTCAAGATCAGGAGG + Intronic
1051722129 9:20047989-20048011 GAAGCATGGTCAGGATCACATGG + Intergenic
1052036984 9:23693895-23693917 GTGGCTTGCTCAAGACCACAGGG + Intronic
1052575479 9:30284224-30284246 GCAGCTTCCTCCTGATAACAGGG + Intergenic
1052691162 9:31818515-31818537 GCAACTTGCCAAAGGTCACATGG - Intergenic
1052974172 9:34399749-34399771 GTGGCTTGTTGAAGATCACAGGG + Exonic
1053446940 9:38159811-38159833 GGAGCTTGATCAAGGTCACTCGG + Intergenic
1054754688 9:68945735-68945757 GTAACTTTCTCAAGACCACATGG + Intronic
1054878987 9:70125374-70125396 GAAACTTGTTCAAGGTCACAGGG + Intronic
1054970753 9:71083360-71083382 GCAACTTGCCCAAGGTTACAAGG + Intronic
1054991372 9:71330988-71331010 GCAGCTTGCCCAAGCTCTCATGG - Intronic
1055790100 9:79914495-79914517 TCAGCTTTCCAAAGATCACAGGG + Intergenic
1056140167 9:83669913-83669935 ATAACTTGCCCAAGATCACATGG - Intronic
1056411763 9:86335193-86335215 ATAACTTGCTCAAGGTCACAAGG + Intronic
1056559708 9:87719352-87719374 GGAGCTTGCCCAAGGGCACAGGG - Intergenic
1056566410 9:87776722-87776744 GGAGCTTGCCCAAGGGCACAGGG + Intergenic
1057718392 9:97513735-97513757 GCAGTTTGCTCAAGGTCATATGG + Intronic
1058644999 9:107123206-107123228 GTAAATTGCTCAAGAGCACACGG - Intergenic
1059251877 9:112893113-112893135 GAAATTTGCACAAGATCACAAGG + Intergenic
1059332822 9:113546903-113546925 GCAATTTGCTCAAGGTCACACGG - Intronic
1059544144 9:115159442-115159464 GCAACTTACACAAGTTCACATGG - Intronic
1059754090 9:117276271-117276293 GTAGCTAGCCCAAGATCACACGG + Intronic
1060000232 9:119952118-119952140 GTAACTTGCACAAGCTCACATGG + Intergenic
1060053200 9:120391602-120391624 GCAGCTGGTTCCAGGTCACATGG + Intronic
1060063356 9:120481450-120481472 GTAACTTGTTCAAGGTCACATGG - Intronic
1060398940 9:123336400-123336422 AAACCTTGCCCAAGATCACAGGG + Intergenic
1060709832 9:125849096-125849118 TCAGCTTGCTCCGGATCACATGG + Intronic
1060748992 9:126156372-126156394 ATCGCTTGCTCAAGGTCACAGGG + Intergenic
1060880604 9:127115545-127115567 GTCGCTTGTTCAAGATCACTTGG + Intronic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061268725 9:129524110-129524132 GGGACTTGCTCAAGGTCACAAGG - Intergenic
1061276480 9:129571788-129571810 GCAGCTTGCCCAAGGACCCAGGG - Intergenic
1062175291 9:135158669-135158691 GGAGCTTGTTCAAAATCCCAAGG + Intergenic
1062348051 9:136124570-136124592 GCAACTTGCTCGAGGTCACTTGG + Intergenic
1185762563 X:2700012-2700034 GGAGCTTGCTGGTGATCACATGG + Intronic
1186395988 X:9209592-9209614 GCAGATTGATCAAGATAAAAAGG + Intergenic
1186517845 X:10179890-10179912 ACAACTTGCTTAAGGTCACACGG + Intronic
1186754827 X:12659294-12659316 GCAGCATGCTGAAGATGACATGG - Intronic
1187444005 X:19344551-19344573 AAAACTTGCTCAAGGTCACAGGG - Intronic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189226284 X:39415908-39415930 GTAACTTGCTCAAGGTCACATGG - Intergenic
1189266330 X:39719606-39719628 TCAGCCTGCTCAAGATCATGTGG + Intergenic
1190261570 X:48801039-48801061 GCAACTTGCCCAAAGTCACATGG + Intergenic
1190479522 X:50862118-50862140 GCTGCTTGGTCAAAATCAAAAGG - Intergenic
1190638873 X:52463751-52463773 GTATCTTGCCCAACATCACAAGG - Intergenic
1191979596 X:66911339-66911361 GTGACTTGCTCAAGTTCACATGG - Intergenic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1196084512 X:111670530-111670552 GCTGTTTGCTCGAGATCACATGG - Intronic
1197627888 X:128823594-128823616 GTAACTTGCTCAAAGTCACAGGG + Intergenic
1197752919 X:129977924-129977946 GTGGCTTGCTCAAGATTGCATGG - Intergenic
1197848418 X:130830018-130830040 GCAACTTGCCTAAGGTCACATGG + Intronic
1198228620 X:134669339-134669361 GTAACTTGCCCAACATCACACGG - Intronic
1199434793 X:147801521-147801543 GTAACTTGCTCAGGGTCACAGGG + Intergenic
1199531745 X:148855757-148855779 GTAACTTGACCAAGATCACATGG - Intronic
1199557448 X:149124673-149124695 GCAGATTGCTCAACATCAGGTGG + Intergenic
1199982812 X:152930104-152930126 GTAACTTGCTCAAGGTCACATGG + Intronic