ID: 1172612437

View in Genome Browser
Species Human (GRCh38)
Location 20:36261911-36261933
Sequence AGGGCTGTCACGGGTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172612424_1172612437 20 Left 1172612424 20:36261868-36261890 CCATGGTACATTTGGGGAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 172
Right 1172612437 20:36261911-36261933 AGGGCTGTCACGGGTTTTCTGGG 0: 1
1: 0
2: 0
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172612437 Original CRISPR AGGGCTGTCACGGGTTTTCT GGG Intronic
900737573 1:4308806-4308828 AGGGATGTCACGGTTGCTCTGGG + Intergenic
904277704 1:29395026-29395048 AGGGGTGTCAAGGGTCTGCTTGG - Intergenic
904292934 1:29499287-29499309 AGGGCTGTCATGAGGATTCTGGG + Intergenic
904511542 1:31014107-31014129 TGGGCTGTCACATGTTTTCCAGG - Intronic
904744959 1:32704767-32704789 AGAGCTGGAAAGGGTTTTCTAGG - Intergenic
907642180 1:56202015-56202037 GGGGATATCATGGGTTTTCTGGG - Intergenic
912903858 1:113682260-113682282 AAGGCTTTCAGGGCTTTTCTTGG + Intronic
916202336 1:162283897-162283919 AGGGCTGGCATGGGCTTTGTGGG + Intronic
918048600 1:180955719-180955741 AAGGCTGCCACGGGGTTTGTGGG - Intergenic
918240057 1:182613043-182613065 AGAGCTGTCTCAGATTTTCTGGG - Intergenic
919391620 1:196992301-196992323 CAGTCTGTCACGGGTTTCCTTGG + Intronic
922695268 1:227728292-227728314 AGGGTTGTTACTGGGTTTCTTGG + Intergenic
923437896 1:233985170-233985192 AGGGGTCTCACTGATTTTCTAGG - Intronic
923557583 1:235012917-235012939 GGGGTTGTCAGGGATTTTCTTGG - Intergenic
1067715222 10:48685351-48685373 AGGGCTGACACGGGCTTTCCTGG + Intronic
1069020655 10:63484603-63484625 AGGGTTGTCACTGCTTTTATTGG - Intergenic
1069600917 10:69707313-69707335 AGGCCTGTCTCAGATTTTCTGGG - Intergenic
1070979877 10:80635503-80635525 AGGGCTGTCCCTGAATTTCTAGG - Intronic
1074635363 10:115309672-115309694 AGGGCTCTTTAGGGTTTTCTAGG + Intronic
1074640774 10:115378001-115378023 AGGGCTGCCACTGGATTTCTGGG + Intronic
1074713098 10:116193706-116193728 AGGGCTGGCACAGGTAATCTGGG - Intronic
1076631748 10:131855976-131855998 AGGGCTGACACAGCATTTCTGGG + Intergenic
1077247910 11:1548117-1548139 AGGGCTGTCGGGGGTCTCCTGGG + Intergenic
1078142003 11:8699662-8699684 AGGGCTGTCTCGGGTTTGGGGGG + Intronic
1078854986 11:15199880-15199902 AGTGCTGCCACTGGTTTGCTTGG + Intronic
1085647660 11:78237504-78237526 AAGGCTGTTACTGGTTCTCTAGG + Intronic
1086851335 11:91812727-91812749 AGGTCTGTTACAGGTTTTCATGG - Intergenic
1091360620 11:134976182-134976204 AGGGCTGACACCATTTTTCTGGG + Intergenic
1092999410 12:13981112-13981134 AGGGCTGTCTCTGGTCTTTTGGG - Intergenic
1096574605 12:52544807-52544829 AGGGCAGACAGGGCTTTTCTTGG + Intronic
1098223656 12:68298172-68298194 AGGTCAGGCACTGGTTTTCTGGG - Intronic
1102578978 12:113873975-113873997 AGGGCGGTGACTGGGTTTCTAGG - Intronic
1104493198 12:129212561-129212583 TGAGCTTTCAAGGGTTTTCTGGG - Intronic
1104747530 12:131219634-131219656 AGGGCTGTCCCGGGGACTCTGGG + Intergenic
1105294018 13:19072732-19072754 AGGGCTGTCACTGGCATGCTTGG - Intergenic
1107322519 13:39204546-39204568 TGGGTTGTCACAAGTTTTCTTGG - Intergenic
1114393161 14:22331863-22331885 GGGGCTGTCTTGGGCTTTCTGGG - Intergenic
1123685603 15:22794957-22794979 AGGGCTGTCACGTGTCCACTGGG + Intronic
1123930551 15:25169509-25169531 GGAGCTGTCACGTGCTTTCTGGG - Intergenic
1127859328 15:62980007-62980029 AGTGCTGTCAAGGGTCTGCTGGG + Intergenic
1128662200 15:69510005-69510027 AAGGCTATCACTGGTTATCTTGG - Intergenic
1129897936 15:79122536-79122558 AGGTCTGTCAGGGGACTTCTGGG - Intergenic
1132299247 15:100766252-100766274 GGGGCTCTCAGGGATTTTCTTGG - Intergenic
1138125862 16:54437807-54437829 AGAGCTGTCAGGGGTCTGCTGGG + Intergenic
1140201315 16:72897086-72897108 AGGTGTCTCAGGGGTTTTCTGGG - Intronic
1140261940 16:73388189-73388211 ATGGCTGCCACAGGTCTTCTTGG + Intergenic
1141262909 16:82469974-82469996 AGGCCTGTCTCAGATTTTCTGGG + Intergenic
1142980158 17:3666919-3666941 AGGGCTGTCACTGATTTGCTGGG + Intronic
1144244113 17:13346229-13346251 GGGGCTGTCCCTAGTTTTCTGGG + Intergenic
1144384504 17:14736828-14736850 TGGGCTGTCTGGGGCTTTCTGGG + Intergenic
1145115099 17:20202444-20202466 AATGCTGTCAGGGGTTTTATTGG - Intronic
1148404922 17:47403034-47403056 AGAGCTGATACAGGTTTTCTGGG + Intronic
1149347821 17:55756020-55756042 AGGGCTGCCATGGGTATTGTGGG + Intronic
1150815102 17:68386527-68386549 AGGGCTGACCCGGAATTTCTGGG - Intronic
1151460257 17:74250058-74250080 AGGGCTGTCAGGGTTCATCTGGG - Intronic
1152900985 17:82941077-82941099 GGGGCTGACAAGGGTTTTCCAGG - Intronic
1158112297 18:53953910-53953932 AGGGGTGTTTAGGGTTTTCTAGG - Intergenic
1160417231 18:78719939-78719961 AAGGCTGTCCCGGATTGTCTAGG - Intergenic
1160886390 19:1350948-1350970 AGGGCTGTCACTGGTGTTTCTGG - Intergenic
1161516256 19:4698222-4698244 AGGGCTGGCACGGCGTTTCCAGG + Intronic
1161774560 19:6252344-6252366 TGGCCTGTCACGGGACTTCTCGG + Intronic
1163295417 19:16408693-16408715 AGGGTTGTCATGGCTATTCTGGG - Intronic
1163860745 19:19741520-19741542 AGACCTGTCACGGATTTTCTGGG - Intergenic
1164551974 19:29219508-29219530 AGGGCTGTCTGGGTTTGTCTTGG - Intergenic
1168588701 19:57615071-57615093 AGGGCTATCCAGGGTTTTTTTGG + Intronic
926242701 2:11100760-11100782 TGGGCTGTCTGGAGTTTTCTAGG + Intergenic
928947706 2:36786823-36786845 AAGGCTGTCAATGGTTTCCTAGG - Intronic
933708577 2:85309077-85309099 AGGGCTGTCACAGGGCTTCTCGG - Exonic
938568278 2:132540037-132540059 AGGGTAGACACGGATTTTCTTGG - Intronic
941962919 2:171271243-171271265 AGGGCTGTGATGGGTTTCCTAGG + Intergenic
945285763 2:208079580-208079602 AGAGCTGTCTCAGGTTTTCTAGG + Intergenic
945992400 2:216407082-216407104 AGGGCTGTCAAGTGCTCTCTAGG + Intergenic
1172612437 20:36261911-36261933 AGGGCTGTCACGGGTTTTCTGGG + Intronic
1174037905 20:47679311-47679333 AGGCCTGTCACGGGCCTCCTTGG - Intronic
1175129534 20:56779174-56779196 AGGCCTCTTACTGGTTTTCTCGG + Intergenic
1183112715 22:35662714-35662736 AGACCTGTCTCGGATTTTCTGGG + Exonic
1183773547 22:39947430-39947452 AGGGCTGTTACAGATGTTCTTGG + Intronic
1185245800 22:49772030-49772052 AGGCCTCTCACGGGTGTTCTGGG - Intergenic
949288471 3:2434586-2434608 GGGGCTGGCACTGTTTTTCTTGG + Intronic
954398473 3:50305993-50306015 AGAGCTGTCTCAGATTTTCTGGG + Intronic
960124432 3:113983042-113983064 AGGGCTTTCAGTGGTGTTCTAGG - Intronic
961634295 3:128323203-128323225 AGGGCTGACAAGTGTTTTCCTGG - Intronic
969521768 4:7682206-7682228 AGCCCTGTCCCGGGTGTTCTAGG + Intronic
982230215 4:153201877-153201899 AGAGCTGTCTCAGATTTTCTGGG + Intronic
990462618 5:56043952-56043974 AGGGATTTCATGTGTTTTCTAGG + Intergenic
993342219 5:86738703-86738725 GGGGATGTCAATGGTTTTCTAGG + Intergenic
994073540 5:95627193-95627215 AGAGTTGTAACGGATTTTCTCGG - Intergenic
995804979 5:116041646-116041668 GGGGGTGTCAGGGGTTGTCTAGG - Intronic
998852291 5:146362826-146362848 AGGGGTCTCCCAGGTTTTCTGGG + Intergenic
999953314 5:156673190-156673212 AGGGCTGTCAAAGCTTTCCTGGG + Intronic
1000504431 5:162097295-162097317 AGGGCTGTCCCGGGCATTGTGGG - Intronic
1001929447 5:175662389-175662411 AGGGCTGTCCCGTGTATTGTGGG - Intronic
1003613735 6:7636298-7636320 ACGGCTTTCCCTGGTTTTCTTGG - Intergenic
1004352662 6:14903821-14903843 AGGGCTGCCAGGGGTTTTGATGG - Intergenic
1009616472 6:66014498-66014520 AGAGCTTTCATTGGTTTTCTAGG - Intergenic
1012471547 6:99578099-99578121 AGGGCTGTCCCTAGTTTTGTGGG - Intergenic
1015134245 6:129849924-129849946 AGTGTTGTCAAGGATTTTCTGGG - Intronic
1017881793 6:158567215-158567237 AGAGCCGGCAGGGGTTTTCTAGG + Intronic
1018370407 6:163162901-163162923 AGGGTTGTCAAGGGTTGTCAAGG + Intronic
1020803597 7:12761369-12761391 AGGACTGTCATGGGTTTTATGGG + Intergenic
1021284739 7:18767303-18767325 AGGGCTGCCACGTTTTTACTTGG - Intronic
1022316394 7:29249131-29249153 TGGGCTGTCATGGGGCTTCTCGG - Intronic
1034290992 7:149931469-149931491 AGGGCTGTGAAGGGTCATCTTGG - Intergenic
1034376485 7:150649329-150649351 ATGGCTGTGACTGGGTTTCTCGG + Intergenic
1034422417 7:150996598-150996620 AAGGTCGTCACGGGGTTTCTGGG - Intronic
1034815193 7:154166304-154166326 AGGGCTGTGAAGGGTCATCTTGG + Intronic
1037471698 8:19216789-19216811 AGAGCTGTCTCTAGTTTTCTGGG - Intergenic
1041132098 8:54712014-54712036 AGGCCTGTCCAGGTTTTTCTTGG + Intergenic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1047463779 8:125092908-125092930 AGGGCTGTCCTGTGTTTTGTAGG + Intronic
1048510137 8:135054719-135054741 TGGGATGTCATGGGTTTCCTGGG + Intergenic
1052014191 9:23446029-23446051 AGGATTGTCACGGCTTTACTTGG - Intergenic
1053216990 9:36279829-36279851 AGGGCAGTGACGCGTTATCTTGG + Intronic
1056422089 9:86438484-86438506 AGACCTGTCTCAGGTTTTCTGGG + Intergenic
1057349275 9:94281456-94281478 AGACCTGTCTCAGGTTTTCTGGG - Intronic
1061052569 9:128204968-128204990 AGGGCTGGCATGGGTTTCCCAGG - Intronic
1186957846 X:14702720-14702742 AGGGTTGTCACGGGGGTTCAAGG + Intronic
1191249586 X:58254035-58254057 TGGGAAGTCACGGGTTTCCTTGG + Intergenic
1192143994 X:68668585-68668607 AGGGCTGTCACAGGATCACTTGG + Intronic
1193911780 X:87315256-87315278 AGACCTGTCTCGGATTTTCTGGG + Intergenic
1194485077 X:94476585-94476607 AGGGCTTGCACGGATCTTCTGGG - Intergenic
1196531441 X:116791564-116791586 AGGGTTGTAACGGTTTTTCATGG + Intergenic