ID: 1172612544

View in Genome Browser
Species Human (GRCh38)
Location 20:36262586-36262608
Sequence CTGGTGCTCCAGACTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 277}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172612544_1172612553 20 Left 1172612544 20:36262586-36262608 CCTTCCTCAGTCTGGAGCACCAG 0: 1
1: 0
2: 0
3: 24
4: 277
Right 1172612553 20:36262629-36262651 CCTTCCTCGTTGTCCAGACAAGG 0: 1
1: 0
2: 2
3: 18
4: 135
1172612544_1172612548 -9 Left 1172612544 20:36262586-36262608 CCTTCCTCAGTCTGGAGCACCAG 0: 1
1: 0
2: 0
3: 24
4: 277
Right 1172612548 20:36262600-36262622 GAGCACCAGCTCTCCAGGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 278
1172612544_1172612555 27 Left 1172612544 20:36262586-36262608 CCTTCCTCAGTCTGGAGCACCAG 0: 1
1: 0
2: 0
3: 24
4: 277
Right 1172612555 20:36262636-36262658 CGTTGTCCAGACAAGGAAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172612544 Original CRISPR CTGGTGCTCCAGACTGAGGA AGG (reversed) Intronic
900528852 1:3142847-3142869 CTGGTGTTACAGGCTGCGGAGGG + Intronic
900582487 1:3415924-3415946 CTGCTGCTCCGGGCTGCGGAGGG + Intronic
900954492 1:5878118-5878140 CTGGTGCCAGAGAGTGAGGAAGG - Intronic
901364158 1:8731199-8731221 CTGGAGGTCCAGACTTAAGAGGG + Intronic
903277774 1:22232778-22232800 CTGGGGCTCCAGCCTTTGGAAGG + Intergenic
905526095 1:38641149-38641171 CTGGTGCTCCAGCTTGCTGATGG + Intergenic
906400121 1:45498437-45498459 CAGGAGCTGCAGACTGAGTAAGG - Intronic
907240510 1:53078502-53078524 CAGGTACTCCAGGCTGCGGATGG - Exonic
907408157 1:54266549-54266571 ATGGTCCTCAAGACTGAAGAGGG + Intronic
907823190 1:57990635-57990657 CCAGAGGTCCAGACTGAGGACGG + Intronic
908403912 1:63795146-63795168 CTGGTGCTCCAGAGGGCTGATGG + Intronic
909981391 1:82105709-82105731 CTGGTCCTCCAGCTTGTGGATGG - Intergenic
911105032 1:94122960-94122982 GTGGTGCTCATAACTGAGGAGGG + Intergenic
914220728 1:145679607-145679629 CTGGTGCAACAGAATGAGCATGG + Intronic
914473305 1:148002480-148002502 CTGGTGCAACAGAATGAGCATGG + Intergenic
920259970 1:204682687-204682709 CTGGTGCTTCAGACAGAGAAGGG - Intronic
922189944 1:223309494-223309516 GTGGTGCTCAGGACTGGGGAGGG + Intronic
924039141 1:239966331-239966353 CTGGTGCTCTAGGATGAGGTAGG - Intergenic
924440782 1:244083456-244083478 GTGGAGCTCCAGATTCAGGAAGG + Intergenic
924794272 1:247281290-247281312 CTGCTGCTCCAGGCTGAGGGTGG + Intergenic
1062843047 10:686204-686226 CTGGAGCTCCATTCTGGGGAGGG - Intronic
1064934244 10:20662381-20662403 CTGGTGCTCCAGTCTCGGGAAGG - Intergenic
1065200008 10:23303875-23303897 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1066652208 10:37667226-37667248 CTGGTGCTCCAGCTTGTGTATGG - Intergenic
1067942735 10:50669906-50669928 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1068201173 10:53786293-53786315 CTGGATCTCAGGACTGAGGAGGG - Intergenic
1069299334 10:66886819-66886841 CTGTTGCTTCACACTGAGTAAGG - Intronic
1069372026 10:67758189-67758211 CTGGTTCTCCAGCTTGCGGATGG + Intergenic
1069515640 10:69074659-69074681 CTGAGGCTGGAGACTGAGGATGG + Intergenic
1069819502 10:71218590-71218612 CTGGTGCTCCAGGGGGAGGAAGG + Intronic
1070154220 10:73823884-73823906 CAGTTGCTCCATGCTGAGGAAGG - Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070520693 10:77250531-77250553 CTGGTGCTCCAGAGTGAGCCTGG - Intronic
1070863977 10:79694869-79694891 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1071630876 10:87217095-87217117 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1072446138 10:95500257-95500279 CTGGGGCTCCAGCCTGATGGAGG + Intronic
1072640994 10:97211304-97211326 CTGGTCCTCCACAATTAGGAGGG - Intronic
1074520956 10:114223414-114223436 CTGGAGCCCAAGATTGAGGAAGG - Intronic
1074849058 10:117424273-117424295 CTGGGCCCCCAGACTGAGCAAGG - Intergenic
1075133981 10:119765997-119766019 CTGGTTCTCCAGATTGCAGATGG - Intronic
1075318427 10:121470286-121470308 TTGGTGTTCCAGCCTGAGCAAGG + Intergenic
1075804722 10:125178242-125178264 CTGGTGTCTCAGACTGAAGAGGG + Intergenic
1078937935 11:15968573-15968595 CTTGTGCTCCTGGCTCAGGAGGG + Exonic
1083800683 11:65044711-65044733 CTGGGTCCCCAGCCTGAGGAGGG + Exonic
1084653258 11:70501203-70501225 CTGGGGCTAGAGTCTGAGGATGG - Intronic
1084974618 11:72790008-72790030 CTGCTGCCTCAGACTGATGAAGG + Intronic
1085833488 11:79928347-79928369 GTGGATCTCCAGACTGAGGTAGG - Intergenic
1087154139 11:94884553-94884575 CTGCTGCTTCAGCCTTAGGAAGG + Intergenic
1087683312 11:101238153-101238175 GTGGGGATCCATACTGAGGATGG + Intergenic
1087900776 11:103637977-103637999 CTGGTGCTGATGACAGAGGAAGG + Intergenic
1088696468 11:112370392-112370414 CTGGGGGTCCAGCCTGAGGCTGG + Intergenic
1088750227 11:112836671-112836693 GTGGCACTCCAGCCTGAGGAAGG - Intergenic
1089183555 11:116599225-116599247 CTGGAGCTCCCCACTGAGGGAGG - Intergenic
1090082175 11:123621127-123621149 CTTGTGCTCAAGACAGAGGAGGG - Intronic
1090183969 11:124724149-124724171 CTGGTCCTCCTGAGTGAGGGTGG - Intergenic
1090265472 11:125350695-125350717 CTGGGGCTACAGTCTGAGGACGG + Intronic
1090469665 11:126969112-126969134 CTCCTGCTCAAGACAGAGGAGGG + Intronic
1090542679 11:127726160-127726182 CTGGTACTCCCGGCTTAGGAAGG - Intergenic
1090603558 11:128397353-128397375 CTGGTGGTCCCTGCTGAGGAAGG - Intergenic
1091705962 12:2693551-2693573 AGGCTGCTCCAGAGTGAGGAAGG - Intronic
1092405887 12:8221986-8222008 CTGGAGCTCCAGCCTGCTGACGG - Exonic
1093179878 12:15954654-15954676 CTGGGGCTTGAGAATGAGGAAGG + Intronic
1093240259 12:16661643-16661665 CTGGTTCTGAAGACAGAGGAAGG - Intergenic
1094319948 12:29172907-29172929 GTGGGGCTCCATACTGGGGATGG + Intronic
1097173036 12:57128180-57128202 CTGGTGCTCCAGAGAGCAGAAGG - Intronic
1098141418 12:67453673-67453695 CTGGCGCGGCAGAATGAGGAGGG + Intergenic
1098292392 12:68968889-68968911 CTAAAGCTCCAGATTGAGGATGG - Intronic
1099426977 12:82535415-82535437 GTGGTCCTGCAGAATGAGGATGG - Intergenic
1102655804 12:114481333-114481355 CTGGCGCTGCAGAGGGAGGAAGG + Intergenic
1105255008 13:18738561-18738583 CTGGTGCTCACGTCTGACGAAGG + Intergenic
1105265322 13:18809839-18809861 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1105838506 13:24232112-24232134 CTGGTTCTCCAGGCTGCAGATGG - Intronic
1106380851 13:29237463-29237485 CTGCTTCTCCAGGCTGAGGGTGG + Intronic
1106998401 13:35515294-35515316 CTGAAATTCCAGACTGAGGAGGG + Intronic
1107950991 13:45462113-45462135 GAGGTGCTCTAGATTGAGGAAGG - Intergenic
1108754895 13:53487708-53487730 CTGGTTCTCCAGATTGCAGATGG + Intergenic
1109965414 13:69686748-69686770 CTGGCTCTCCAGATTGAAGATGG - Intergenic
1111372553 13:87336026-87336048 CTGGAGATCCATACTGAGGATGG - Intergenic
1112638525 13:101245143-101245165 CAGGGGCTGCAGACTGAGGAGGG - Intronic
1113303146 13:109045151-109045173 CTGCTGCTCCTAACTCAGGAAGG + Intronic
1113885741 13:113657540-113657562 CAGGTGCTGCAGGCTGAGGCAGG + Intronic
1115995006 14:39187130-39187152 CTGGTGCTCCAGAGTGAAATAGG + Intergenic
1117334208 14:54743020-54743042 CTGCTTCTCCAGAATGAGAATGG + Intronic
1118301308 14:64618910-64618932 CTGGGGCACCCAACTGAGGAAGG - Intergenic
1119262494 14:73245881-73245903 ATGGTGCTCTAGGCTGTGGAGGG - Intronic
1119325012 14:73754683-73754705 CTGGGGCCTCAGACAGAGGAAGG + Intronic
1119422177 14:74513909-74513931 CTGGGGCTCTGGTCTGAGGAAGG - Intronic
1119743389 14:77028078-77028100 CTGGTGCTGCAGACTTGGGCTGG + Exonic
1119760696 14:77148855-77148877 CTGGGCCTCAAGACTGAAGATGG + Intronic
1120488667 14:85148345-85148367 CTGGTTCTCCAGCTTGCGGATGG + Intergenic
1202833170 14_GL000009v2_random:58277-58299 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1123759399 15:23420954-23420976 CTGAGGTTCCAGACTGAGGCGGG + Intergenic
1125549538 15:40535046-40535068 CTGGGGGACCAGACTGTGGAGGG + Intronic
1127399558 15:58572667-58572689 CTGGAGCTCTACACTGAGAATGG - Intergenic
1127809121 15:62548173-62548195 CTGGTCTTCCAGACTCAGGCTGG - Intronic
1128212852 15:65914467-65914489 TTGGTGCTCACGACTGGGGAGGG - Intronic
1128314995 15:66654786-66654808 CTGGTGCTCCAGTTTGGGGAGGG - Intronic
1130906598 15:88244959-88244981 CTGGGGCTGCAGAGTGGGGAAGG + Intronic
1132391660 15:101443556-101443578 CTGGGGGTCCATTCTGAGGAAGG + Exonic
1132841428 16:1980100-1980122 CTGAGCCTCCAGACTGTGGATGG + Exonic
1133772994 16:8878480-8878502 CTGCTGAGCCAGAGTGAGGAAGG + Intergenic
1135926466 16:26698097-26698119 CTGTTGCTGCAGATTGTGGAGGG - Intergenic
1136083668 16:27869129-27869151 ATGGGGCTCCTCACTGAGGATGG + Intronic
1137011010 16:35320142-35320164 TTGGTGCTTCTGACTGAGGTGGG + Intergenic
1137270248 16:46898262-46898284 CAGGAGCTCCAGATTGGGGACGG + Intronic
1138517367 16:57543640-57543662 CAGGGGCTCCAGACTGTGGTTGG + Intronic
1138600015 16:58048619-58048641 CTGGTGCTGCAGCCTGTGGGAGG + Intergenic
1139347967 16:66316659-66316681 CTGCTGCTGCAGATTGAGGGAGG + Intergenic
1139961526 16:70720804-70720826 CTGGAGCTCAAGACTGGGGCCGG + Intronic
1141175088 16:81713474-81713496 CTGGTCCTCTGGCCTGAGGATGG - Intergenic
1142247615 16:88977039-88977061 CTGGGGCTGCAGGCTGGGGAAGG + Exonic
1142273335 16:89102493-89102515 CTGGGCCTCCCCACTGAGGAAGG - Intronic
1142420495 16:89966718-89966740 CTGTGGCCCCAGCCTGAGGAGGG + Exonic
1143328685 17:6118571-6118593 CTGGTGCTGAACACAGAGGAAGG - Intronic
1143782815 17:9238302-9238324 CTGCTGCTCCTGTCTCAGGAGGG + Intronic
1143976192 17:10831746-10831768 CTGATGCCCCAGACTGGGCAAGG + Intronic
1144636028 17:16909672-16909694 CTGGTGCCCTATGCTGAGGAAGG - Intergenic
1144713028 17:17414831-17414853 CAGGTCCTGCAGACTGTGGAGGG + Intergenic
1147794699 17:43034146-43034168 CTTGTCCTGCAGGCTGAGGAAGG + Intergenic
1147867127 17:43560431-43560453 CTGCTGCTCTCTACTGAGGATGG + Intronic
1150599337 17:66637041-66637063 CTGGTTCTCCAGACTTAGGCAGG + Intronic
1151547480 17:74802002-74802024 CTGCTGCTCCTGTCTGAGCACGG + Intronic
1151718824 17:75844547-75844569 CTTCTGCTCCAGCCAGAGGAGGG - Exonic
1151726960 17:75890923-75890945 CTGGGGCTCCAGGCTGTAGAAGG + Exonic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1154423073 18:14251690-14251712 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1155073741 18:22337816-22337838 CTGGTGCCCCAGCCTCAGGGAGG - Intergenic
1161033877 19:2073198-2073220 CTGAGGCTCGAGACTGAGGAAGG + Exonic
1161314981 19:3613478-3613500 CTGGGGCTCCTGCTTGAGGATGG + Exonic
1161960653 19:7521106-7521128 CTGGAGCTCCAGATTGTGGCTGG - Intergenic
1164552299 19:29221859-29221881 CTTGTGCTCCAGAGAGAGAATGG + Intergenic
1165827608 19:38714174-38714196 CTAGTGCCCCACACAGAGGAGGG - Intronic
1167660012 19:50790829-50790851 CCGGTACTCCGGACTCAGGAAGG - Exonic
1167745979 19:51352099-51352121 CTGGTGCTCCCCACTGAGATAGG - Intronic
1168280228 19:55301813-55301835 CTGCCGCTCCAAACTGGGGAGGG + Intronic
1202639497 1_KI270706v1_random:69433-69455 CTGGGGATGCAGACAGAGGAGGG + Intergenic
925823697 2:7825471-7825493 CTGGTTCTTTAGGCTGAGGATGG - Intergenic
926038758 2:9655892-9655914 CTGGGGCTGCAGACTGTGGTGGG - Intergenic
926158152 2:10469464-10469486 CTGGTGCTCCAGAGTGCACAAGG - Intergenic
926309155 2:11662083-11662105 CTGGAGCTGCTGAGTGAGGAGGG - Exonic
929296004 2:40247514-40247536 CTGGTGCTCTAGCATAAGGAAGG - Intronic
929538971 2:42805061-42805083 GAGGTGCTGCAGGCTGAGGATGG + Intergenic
931208385 2:60169368-60169390 CTGGGGCTCCAGGCTGAGCACGG + Intergenic
932424382 2:71619862-71619884 CTTGGGCTGCAGCCTGAGGAGGG - Intronic
933865689 2:86515132-86515154 CTGGCACTCCACACTGAGGGAGG - Intronic
934494982 2:94788883-94788905 CTGGGGATGCAGACAGAGGAGGG + Intergenic
934767278 2:96886732-96886754 CTGTTCCTGCAGACTGAGGATGG + Intronic
935085134 2:99837715-99837737 GTGGTGCTCCAGCCAGAGAAGGG - Intronic
935140972 2:100352698-100352720 CTGGTGCTCCAGTGAGGGGAGGG - Intergenic
936046676 2:109193959-109193981 CTGGTGCCCCAGAAGGAGCATGG - Intronic
936350715 2:111710668-111710690 TTCCTGCTCCAAACTGAGGAAGG + Intergenic
937471809 2:122180459-122180481 CTGGCTCTCCAGCCTGCGGATGG - Intergenic
938387046 2:130873962-130873984 CTGGCTCTCCAGATTCAGGAGGG + Intronic
940014198 2:149086389-149086411 CTGCTCTTCCAGACTGAAGAAGG + Intronic
941052390 2:160749499-160749521 CTGGTGGTCAAGACTGAAGGGGG + Intergenic
941860292 2:170272352-170272374 CCAGTGGTCCAGACTGATGAGGG - Intronic
944168678 2:196750809-196750831 CTGGTGGCCCAGACTGAGCCAGG - Intronic
944339450 2:198578750-198578772 CTGGTGCTCCAGCTTGAGTATGG + Intergenic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
945104871 2:206300520-206300542 CTGATGCTACACACTGAGAAGGG - Intronic
945276449 2:207992162-207992184 CCGCTTCTCCAGCCTGAGGAAGG - Intronic
946157471 2:217816553-217816575 CTGGGGCTTCAGACAGAGAAAGG - Intronic
947875340 2:233464144-233464166 CTGCTGCTCCAGGCGGAGGGAGG - Exonic
947885527 2:233566603-233566625 TTGGTGGCCCAGTCTGAGGAGGG - Intronic
948187432 2:236032462-236032484 CAGGTGCTCCAGAAAGAGGGGGG + Intronic
1168823689 20:794342-794364 CTGGTCCTCCAGATGGAGGCTGG - Intergenic
1169232957 20:3905026-3905048 CTGGAGCCCCAGAATCAGGATGG - Intronic
1170903795 20:20492511-20492533 CTAGTGCTCCTTACTGTGGAAGG - Intronic
1171885971 20:30652659-30652681 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1171886165 20:30653789-30653811 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1172612544 20:36262586-36262608 CTGGTGCTCCAGACTGAGGAAGG - Intronic
1174070268 20:47894764-47894786 GTGGAGCTGCAGACTGAGGCAGG + Intergenic
1175246652 20:57586235-57586257 CTGGTGTTCCCCACTCAGGATGG - Intergenic
1175974601 20:62704242-62704264 CTTGTGCGCTAGGCTGAGGATGG - Intergenic
1176023136 20:62972822-62972844 GTGGTGCCCCAGGCTGGGGACGG - Intergenic
1176647827 21:9367032-9367054 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1177197341 21:17917329-17917351 CTGGTTCTCCAGCTTGAAGATGG + Intronic
1180201521 21:46227596-46227618 GTGGGGCTGCAGGCTGAGGATGG - Exonic
1180362445 22:11912437-11912459 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1180756584 22:18166135-18166157 GAGGTTCTCCAGACTGAGGACGG - Intronic
1181075185 22:20371298-20371320 GAGGTTCTCCAGACTGAGGACGG + Intronic
1181516261 22:23415328-23415350 CAGGTGCTCCAGGCTGTGGCTGG - Intergenic
1182130541 22:27847087-27847109 CTTGCACTCCAGACTGAGGGAGG - Intergenic
1183543090 22:38441191-38441213 CAGGTGCTCCAGGCTGGGCAGGG - Intronic
1183737737 22:39653257-39653279 TTGAGGCTCCAGACAGAGGATGG - Intronic
949615759 3:5752164-5752186 CTGGATCTCCAGCTTGAGGACGG + Intergenic
953008015 3:38995718-38995740 CTGGTTCTCCAGCCTGCAGATGG + Intergenic
954692573 3:52403442-52403464 CTGCTGCACCTGGCTGAGGATGG - Exonic
955926820 3:64014801-64014823 CTGGTGCTCCAGTTTGGGGCTGG + Intronic
960554873 3:119016766-119016788 CTGGTACACAAGACTGGGGAGGG - Intronic
961003843 3:123391480-123391502 CTGGGGCTGAAGACTGAGGGCGG + Intronic
962329696 3:134466779-134466801 ATGGTTCTCCAGGCTGAGCACGG + Intergenic
962459861 3:135600757-135600779 CTGGTTCTCCAGACTGCAGGTGG - Intergenic
962852646 3:139319415-139319437 CTGGAGCTCCTGACTCAGGCAGG + Intronic
963001739 3:140688027-140688049 CTGGTGGACCAGATCGAGGACGG + Exonic
964297984 3:155254711-155254733 CTGGTTCTCCAGCCTGAAAATGG + Intergenic
1202739057 3_GL000221v1_random:37955-37977 CTGGGGATGCAGACAGAGGAGGG - Intergenic
968981832 4:3854462-3854484 ATGGTGCTCCAGCCTGGGGGTGG + Intergenic
969665073 4:8552766-8552788 CATGTGCCCCAGACTGAGGAAGG - Intergenic
972993179 4:44847478-44847500 CAGGTGCTGGAGACTGAGAATGG - Intergenic
973848514 4:54937495-54937517 TTGGTTCTAGAGACTGAGGAAGG + Intergenic
975169507 4:71216672-71216694 CTCCTGCTCCATGCTGAGGAGGG + Intronic
978720750 4:111906112-111906134 CTCCTCCTCCAGACTGAGAAAGG + Intergenic
983794142 4:171838947-171838969 CTGGTGCTTGAGACACAGGAAGG - Intronic
985124239 4:186675643-186675665 CTGTAGCTCCAGGCTGAGGTGGG + Intronic
985162583 4:187060113-187060135 CTGAGGCTACAGACTGAGGGAGG - Intergenic
985423999 4:189810942-189810964 CCGGTGTTCCAGGCTGAGGCCGG + Intergenic
1202766857 4_GL000008v2_random:155288-155310 CTGGGGATGCAGACAGAGGAGGG + Intergenic
985556167 5:559002-559024 CTGGTGGTCCTCACGGAGGATGG + Intergenic
985556206 5:559148-559170 CTGGTGGTCCTCACGGAGGATGG + Intergenic
985740964 5:1617302-1617324 CTGATGTTCCAGTTTGAGGATGG - Intergenic
985892284 5:2724959-2724981 CAGGTGCTGCTGCCTGAGGAGGG + Intergenic
986173241 5:5330723-5330745 CTGGTTCTCCAGGCTGCAGAGGG + Intergenic
986364026 5:7011666-7011688 CTGGAGCTCAAGTCTGAGCATGG - Intergenic
987046762 5:14116047-14116069 CTGGTTCTCCAGCTTGAGGATGG - Intergenic
987420072 5:17709459-17709481 TTGGTGCTACAGAATGAAGAGGG + Intergenic
990168177 5:53018078-53018100 CTGGAGCTCCAGCCTGACCATGG - Intronic
991206067 5:64051436-64051458 CTTGTGCTCCAGCCTGTGGCTGG - Intergenic
991301627 5:65134222-65134244 CCATTGCTCCAGACAGAGGAGGG - Intergenic
992162412 5:74016139-74016161 GTGGAGTTTCAGACTGAGGAGGG - Intergenic
992921163 5:81522782-81522804 CTGGTTCTCCAGACTGTGAGTGG - Intronic
997232948 5:132257340-132257362 GCGGTGCTCCAGCCCGAGGAGGG - Intronic
998167439 5:139852198-139852220 CTGGTGCTCCCGAGGGAAGAAGG + Intronic
998406916 5:141879027-141879049 CGGGGGCTCTAGAGTGAGGATGG + Intronic
998725213 5:145004861-145004883 CTGGTTCTCCAGCTTGAAGATGG - Intergenic
999718557 5:154381368-154381390 CTGGTGCTCCAAGCTCTGGAAGG + Intronic
1001577529 5:172773861-172773883 ATGCTGCTTCTGACTGAGGATGG + Intergenic
1001651544 5:173319505-173319527 CTGGTGGCCCAGACTTAGGGAGG - Intronic
1001813202 5:174646319-174646341 CTGGTGCCCCAAACTGAGCCTGG - Intergenic
1001880556 5:175240482-175240504 CTGGTGTCGCAGACTGAGGAGGG - Intergenic
1003064510 6:2891849-2891871 CTGGTGCTGCTGCCTGACGACGG - Exonic
1003324410 6:5081907-5081929 CAGGGGCTGCAGACTGAGCAAGG + Intergenic
1006145296 6:31955310-31955332 CTCCTGCTCCACACTGAGGTAGG - Intronic
1006735149 6:36268080-36268102 CTGGGGCTGGAGAATGAGGAAGG - Intronic
1007768652 6:44176624-44176646 CTGCTGCACAAGACGGAGGACGG + Exonic
1008927275 6:56900131-56900153 CTGGAGTTCTAGAATGAGGATGG - Intronic
1009034110 6:58095885-58095907 CTGGTTCTCCAGCTTGAAGAAGG - Intergenic
1009209718 6:60847590-60847612 CTGGTTCTCCAGCCTGCAGAAGG - Intergenic
1010467981 6:76191223-76191245 CTGGTTCTCCAGCTTGCGGATGG + Intergenic
1011738939 6:90340121-90340143 CTGGTTCTCCAGATTGCAGATGG + Intergenic
1013038702 6:106412197-106412219 GTGGTGCCCCACAGTGAGGAAGG - Intergenic
1013296545 6:108762727-108762749 CTGGTGCTTCAGCCTGAAGCTGG - Intergenic
1014395564 6:120924126-120924148 CTGGTTCTCCAGCATGTGGATGG - Intergenic
1017360606 6:153564782-153564804 CTGGCACTGAAGACTGAGGAAGG + Intergenic
1018701559 6:166431363-166431385 CTGGTCCTGCAGACTGAGGTGGG + Intronic
1018988890 6:168658531-168658553 CTGTAGCACCAGGCTGAGGAGGG - Intronic
1019726406 7:2605290-2605312 CTGGTCCTCAATACAGAGGAGGG - Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1023654315 7:42404473-42404495 CTGGGGCTCCTGACTGGAGATGG + Intergenic
1024094254 7:45971807-45971829 CTGATGATTCAGAGTGAGGAGGG - Intergenic
1024566508 7:50685863-50685885 CTGGTTTTCCAGAATGTGGATGG + Intronic
1024624927 7:51198891-51198913 GTAGAGCCCCAGACTGAGGAGGG + Intronic
1027800901 7:82747740-82747762 CTGGTCATCCAGTCTGAGGAAGG + Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034087625 7:148334654-148334676 CTGGTGCTCCATGCTGGGGCAGG - Intronic
1035477171 7:159152097-159152119 CTGGTGCTCCAGCTTGCAGAGGG - Intergenic
1036226293 8:6960547-6960569 CTGGGGCTCCAGACAGTGGCAGG - Intergenic
1036391727 8:8329794-8329816 CTGCTGCTCCACAGGGAGGAGGG + Intronic
1037333069 8:17763677-17763699 CTGGGGCTCCAGGCTGGGTAGGG - Intronic
1037524109 8:19708049-19708071 CTGCTGCTCCACCCTGAGAAAGG + Intronic
1037879620 8:22566346-22566368 CTGGAGCTCCAGGCTGAGGCCGG - Exonic
1038307895 8:26421167-26421189 CTGGTGGTCCAGAAGGAGGGTGG + Intronic
1038581385 8:28752007-28752029 ATGGGGCTCCAGACAGAGGCGGG - Exonic
1039701096 8:39962673-39962695 CTGGTGCTCCATTGTGAGGTGGG - Intronic
1043676251 8:82958314-82958336 CTGGTTCTCCAGTTTGAAGATGG + Intergenic
1044279143 8:90336558-90336580 CTGGGCCTCCAGAATAAGGAGGG - Intergenic
1048480852 8:134791295-134791317 AAGGTGCTCCAGCCTCAGGAAGG - Intergenic
1048808266 8:138261175-138261197 CTGGTGATTCAGACAGAGGTGGG - Intronic
1049592743 8:143470006-143470028 CTGGTGCTCAAGAGTGGGGCAGG - Intronic
1051154913 9:14131761-14131783 AGGCTGCTACAGACTGAGGAAGG - Intronic
1051963715 9:22800754-22800776 GTGGAGCCCAAGACTGAGGAAGG + Intergenic
1052881740 9:33604819-33604841 CTGGTGCTCATGTCTGATGAAGG - Intergenic
1053025600 9:34725988-34726010 CTTGTCCCCCAGACTGTGGATGG + Exonic
1053037128 9:34835050-34835072 CTTGTCCCCCAGACTGTGGATGG + Intergenic
1053494573 9:38541018-38541040 CTGGTGCTCTTGTCTGATGAAGG + Exonic
1053499071 9:38569829-38569851 CTGGGGATGCAGACAGAGGAGGG + Intronic
1053667814 9:40328738-40328760 CTGGTGCTCATGCCTGATGAAGG - Intronic
1053917620 9:42955025-42955047 CTGGTGCTCATGCCTGATGAAGG - Intergenic
1054378959 9:64468777-64468799 CTGGTGCTCATGCCTGATGAAGG - Intergenic
1054516797 9:66047545-66047567 CTGGTGCTCATGCCTGATGAAGG + Intergenic
1054721229 9:68606024-68606046 CTGGTGCTACAGGGTGGGGAGGG + Intergenic
1056353547 9:85775838-85775860 ATGGTGCACCAGATTGAGGTTGG + Intergenic
1056586644 9:87931785-87931807 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1056610233 9:88121156-88121178 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1056751737 9:89356931-89356953 CTGGTGCACCAGAGAGAGGATGG - Intronic
1057162119 9:92896171-92896193 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1057678507 9:97154310-97154332 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG + Intergenic
1060719233 9:125963741-125963763 CTGGGGTTCTAGACTTAGGAAGG + Intronic
1062083068 9:134634561-134634583 CCAGTGCTCCACACTGTGGAGGG - Intergenic
1062162562 9:135088193-135088215 CCGGGGCTCCGGACCGAGGAGGG - Intronic
1186750761 X:12619488-12619510 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1186964510 X:14772800-14772822 CTGGTGGCCTGGACTGAGGAGGG + Intergenic
1187034280 X:15521631-15521653 CTGGTTCTGCAGACAGGGGAAGG - Intronic
1187396058 X:18920704-18920726 CTTCTGCTCCAGTCTGGGGATGG - Intronic
1188261510 X:28030413-28030435 TAGGTTCTCCAGACAGAGGATGG + Intergenic
1191945665 X:66531815-66531837 GTGGAGCCCAAGACTGAGGAAGG - Intergenic
1192150421 X:68708899-68708921 CAGGTGGCCCGGACTGAGGATGG - Intronic
1194810464 X:98381780-98381802 CTGGTTCTCTAGCCTGTGGATGG - Intergenic
1196419413 X:115507112-115507134 GTGGGGCTCCATACTGGGGATGG + Intergenic
1200037698 X:153344146-153344168 CTGGGGCTCCATCCTGGGGAGGG - Intronic