ID: 1172612999

View in Genome Browser
Species Human (GRCh38)
Location 20:36265735-36265757
Sequence GGTGATGGACAGAGTCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172612999_1172613005 -9 Left 1172612999 20:36265735-36265757 CCCACAGGACTCTGTCCATCACC 0: 1
1: 0
2: 2
3: 20
4: 162
Right 1172613005 20:36265749-36265771 TCCATCACCTGGCAGGAGAGGGG 0: 1
1: 0
2: 0
3: 28
4: 310
1172612999_1172613008 7 Left 1172612999 20:36265735-36265757 CCCACAGGACTCTGTCCATCACC 0: 1
1: 0
2: 2
3: 20
4: 162
Right 1172613008 20:36265765-36265787 AGAGGGGACCTACCTCGATGTGG 0: 1
1: 0
2: 0
3: 2
4: 52
1172612999_1172613004 -10 Left 1172612999 20:36265735-36265757 CCCACAGGACTCTGTCCATCACC 0: 1
1: 0
2: 2
3: 20
4: 162
Right 1172613004 20:36265748-36265770 GTCCATCACCTGGCAGGAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 277
1172612999_1172613009 12 Left 1172612999 20:36265735-36265757 CCCACAGGACTCTGTCCATCACC 0: 1
1: 0
2: 2
3: 20
4: 162
Right 1172613009 20:36265770-36265792 GGACCTACCTCGATGTGGTTAGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172612999 Original CRISPR GGTGATGGACAGAGTCCTGT GGG (reversed) Intronic
900819289 1:4873792-4873814 GGTCATGGACAGTGTCTTATTGG - Intergenic
904827373 1:33282157-33282179 GGACATGCACAGAGCCCTGTGGG - Intronic
905121806 1:35688325-35688347 GGTGATGGACAGAGACAGGTGGG + Intergenic
909496883 1:76288785-76288807 GGTGATGGTCAGAGTCAGATGGG + Intronic
910499694 1:87875830-87875852 GGTGATGGTCAAAGTCCCTTTGG - Intergenic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
914940892 1:152022023-152022045 CCTGATGGACAGAGGACTGTGGG + Intergenic
917191880 1:172426760-172426782 GGTGAAGGACAGAGGGCTGAGGG - Intronic
919921401 1:202168570-202168592 GGAAATGGACAGAGGCCTCTGGG - Intergenic
919932146 1:202228318-202228340 GGTCATGGGGAGAGACCTGTGGG - Intronic
922997497 1:229976203-229976225 GGGGGTGGGCAGAGTCCTGTTGG - Intergenic
923605037 1:235435570-235435592 GGTGATGCACATATTCCTGCCGG - Intronic
1062915764 10:1240426-1240448 GGTGATGGATTGTGTTCTGTGGG + Intronic
1063570734 10:7212424-7212446 GGAGAGGAACAGAGCCCTGTGGG + Intronic
1064161804 10:12953002-12953024 GGTAATCCACACAGTCCTGTTGG + Intronic
1065287450 10:24200022-24200044 GGGGAAGGACAGTGTACTGTGGG - Intronic
1067031940 10:42884199-42884221 GGTCAAGGATGGAGTCCTGTTGG + Intergenic
1067837738 10:49652042-49652064 GCTGACGGACACAGTGCTGTAGG + Intronic
1070496986 10:77033684-77033706 GGTCAGGGAAGGAGTCCTGTTGG - Intronic
1071146838 10:82584867-82584889 GGTGAAGGACACAGTGCTTTTGG + Intronic
1074529583 10:114288128-114288150 GGGGATGCAGAGAGGCCTGTGGG - Intronic
1076738249 10:132468218-132468240 GGGGGTGGTCAGAGTCCTGCTGG + Intergenic
1077228837 11:1449769-1449791 GCTGATGGACCGAGACCTGGAGG - Exonic
1079036588 11:17025609-17025631 GGAAATGGAAAGAGTCCTGAAGG + Intergenic
1083026651 11:59556929-59556951 GGTGAAGGACTGCGTCCAGTTGG - Intergenic
1088991299 11:114955870-114955892 GGCTATGGTCACAGTCCTGTGGG + Intergenic
1089034825 11:115377201-115377223 GGTGATGCACAAAGTTCTGTAGG - Intronic
1089671092 11:120057638-120057660 AGGCATGGACAAAGTCCTGTGGG + Intergenic
1089792521 11:120955095-120955117 GCTGATCTTCAGAGTCCTGTAGG + Intronic
1090453977 11:126831288-126831310 GGTGATGGCCAGAGAAATGTTGG + Intronic
1091295864 11:134473708-134473730 GGTGAGGGACAGCTTCCTGGAGG - Intergenic
1091442328 12:521196-521218 GGTGATGACGAGAGTCCTGCTGG - Intronic
1091616000 12:2052133-2052155 GGTGCTGGATAGATTCCTGCCGG + Intronic
1094756884 12:33481646-33481668 GGTGATTGCCAGGGACCTGTGGG + Intergenic
1097482306 12:60144304-60144326 GGTGCTGATCAGAGTCCAGTGGG + Intergenic
1100592783 12:96044935-96044957 GGTGGGGGGCAGAGTCCTGAAGG - Intergenic
1101509528 12:105380181-105380203 GATGATGGAAATAATCCTGTAGG - Intronic
1101549788 12:105751149-105751171 GGTGAGGGGCAGAGTCATGCAGG + Intergenic
1101789620 12:107914862-107914884 GGTGATGGAGAGTCTCCTGGAGG + Intergenic
1103028719 12:117594918-117594940 GGAGCTGGACAGTGTTCTGTTGG - Intronic
1104535377 12:129613667-129613689 GGTGCTGGAGACAGTCCTCTCGG - Intronic
1105260238 13:18773745-18773767 GGTGTTGGAGATAGTCGTGTGGG - Intergenic
1106995204 13:35472451-35472473 GGTGATGGAGAGAGTCCCCTTGG - Exonic
1109737038 13:66499508-66499530 GGTGATGGAGACAATGCTGTTGG + Intronic
1111379620 13:87430939-87430961 GCCGATGGAAAGATTCCTGTTGG + Intergenic
1113645986 13:111996335-111996357 GGGAATGGAGAGAGTCCTGTGGG - Intergenic
1113662071 13:112114564-112114586 GGTGAGGGGCAGAGTCCTCTGGG - Intergenic
1114390166 14:22298843-22298865 GGAGATGGACAGGGTGCTGTAGG - Intergenic
1118065089 14:62181878-62181900 GGTGTTGGTGAGAGTCCTTTAGG + Intergenic
1120813518 14:88829105-88829127 GGTGAGGGACAGAGGCCAGCCGG + Intronic
1121246006 14:92461188-92461210 GGCGCAGGAGAGAGTCCTGTTGG - Intronic
1122566994 14:102666206-102666228 TGTGAGGGATAGAGTCCTGAGGG + Intronic
1122735731 14:103839697-103839719 GGTGATGGAGAGAGTAGTGTAGG - Intronic
1122973143 14:105160238-105160260 GGGCGTGGACAGAGTCCTGGTGG - Intronic
1124643781 15:31420200-31420222 GGTGCTGCCCAGAATCCTGTGGG + Intronic
1126021317 15:44404751-44404773 GGTGATGTGCAAAGTACTGTGGG - Intronic
1128557250 15:68640185-68640207 GGTGATGGACAGAGGCTGGAAGG - Intronic
1128989927 15:72251092-72251114 GTTGATGGACAGAGCAATGTAGG + Intronic
1129921934 15:79326739-79326761 GGGAAGTGACAGAGTCCTGTGGG + Intronic
1130899109 15:88193525-88193547 GGTGAAGGCCATAGTCATGTAGG - Intronic
1132728650 16:1349891-1349913 GGTGCTGGCCACAGGCCTGTTGG + Exonic
1132801233 16:1754946-1754968 GGTAATGAACGGATTCCTGTGGG - Intronic
1133161463 16:3914842-3914864 GGTGATGGCCAGACGCCTGCAGG - Intergenic
1134278084 16:12794438-12794460 GGGGAGGGACAGGGTCCTGAAGG - Intronic
1135098110 16:19581323-19581345 AAAGATGGACAGAGTGCTGTGGG - Intronic
1135771252 16:25220152-25220174 GGTGTTGGACAAAGTCCTTTTGG + Intronic
1138495083 16:57403974-57403996 GGTGAAGGAGTGAGTCCTGCAGG + Intergenic
1139009733 16:62617196-62617218 GGTGATGGACGCTATCCTGTGGG - Intergenic
1139155813 16:64440745-64440767 TGTGCTGGACACAGGCCTGTTGG + Intergenic
1139378431 16:66515304-66515326 GGTGAGGGTCACAGTCCTCTTGG - Intronic
1141248351 16:82331970-82331992 GGACAAGGACCGAGTCCTGTGGG + Intergenic
1143143065 17:4753843-4753865 GGAGATGAACGGAGTCCTTTGGG - Intergenic
1146658081 17:34646883-34646905 GTGGATGGAGAGAGGCCTGTCGG + Intergenic
1149071282 17:52546741-52546763 GGTGCTGAACTGAGTACTGTTGG + Intergenic
1151746278 17:76013556-76013578 GGTGATGCCCAGGGTTCTGTTGG - Intronic
1156693390 18:39735893-39735915 GGTCATGAACAAAGTGCTGTAGG + Intergenic
1157333036 18:46717099-46717121 GGTGATGGCCTCTGTCCTGTAGG - Intronic
1158612270 18:58952120-58952142 TGTGATGGAGAGTGTCCTGAAGG + Intronic
1158719496 18:59911432-59911454 GAGGATGGCCAGAGTCCAGTAGG + Intergenic
1161509540 19:4662898-4662920 GGTGCTGGGCAGAGTCCTGGTGG - Intronic
1163245662 19:16092450-16092472 GATGTTGGGGAGAGTCCTGTAGG - Intronic
1163636859 19:18441055-18441077 GGTGATGGCCAGAGTATTGCTGG + Intergenic
1164803028 19:31093407-31093429 GCTCATGAACAAAGTCCTGTAGG + Intergenic
1167107692 19:47440102-47440124 GGAGATGGACAAAGTCATTTTGG - Intronic
1167114544 19:47480921-47480943 CGTGCTGGGCAGAGCCCTGTGGG - Intronic
1167666046 19:50823313-50823335 GGGGATGATCAGAGTCCTGTGGG + Intronic
1168009260 19:53517405-53517427 TTTTATGGCCAGAGTCCTGTGGG - Intergenic
927542238 2:23923337-23923359 GGTGATTGCCAGGGTCTTGTGGG + Intronic
930063938 2:47313240-47313262 GGTGATGGAATGAGTCATGCAGG - Intergenic
931550461 2:63439787-63439809 GGTGATTGACAGAAGCCTGGTGG - Exonic
932050015 2:68389027-68389049 GGGCATGGACAGAGTCCTGGGGG + Intronic
936172052 2:110185371-110185393 GGTGATGGCCTGAGGCCTGGGGG + Intronic
937000360 2:118460427-118460449 GGTGATGGACAGAGTGAAGGGGG - Intergenic
938185714 2:129230197-129230219 GGTGATGTACACAGTCGTGCTGG - Intergenic
941539250 2:166761687-166761709 GCAGATGGAGAGAGTCCTGTGGG - Intergenic
943798200 2:192025157-192025179 GGTGATGGACAGAGTGCCTATGG + Intronic
944534833 2:200698345-200698367 GGGGAAGGACAGAGTTCTGTGGG - Intergenic
948278248 2:236726406-236726428 TGTGAAGGACAAAGGCCTGTGGG + Intergenic
948847598 2:240690583-240690605 GGTGCTGGAGTGAGTCCTGGGGG + Intergenic
1169839141 20:9915479-9915501 GGTGATGGGCATCCTCCTGTTGG + Intergenic
1170174978 20:13459050-13459072 GGTGATGGAGAGTGGCCTCTAGG - Intronic
1172612999 20:36265735-36265757 GGTGATGGACAGAGTCCTGTGGG - Intronic
1174903475 20:54525001-54525023 GGTGATGGTCACTGTCCAGTGGG + Intronic
1177208631 21:18042055-18042077 GCTGATGAACGGTGTCCTGTAGG + Intronic
1177887587 21:26764626-26764648 GGTAAAGGACAGAGCCCTGTGGG + Intergenic
1180855453 22:19042210-19042232 GGTGATGGTCAGAGGGGTGTTGG - Intronic
1181102771 22:20552552-20552574 GCTGGTGCACACAGTCCTGTGGG + Intronic
1184938481 22:47742070-47742092 AGTGATGACCAGAGTCCAGTGGG - Intergenic
950476141 3:13216070-13216092 GGTGTTGGACAGAGCTCTGGAGG - Intergenic
951677351 3:25257290-25257312 TGTGCTGGACACAGTCCAGTTGG - Intronic
953785020 3:45904934-45904956 AGTGAGGGACAGAGATCTGTGGG - Intronic
955516448 3:59730818-59730840 GGTGCTGGACAGAGTCAGGGTGG - Intergenic
956410419 3:68973150-68973172 GGTGAGAGAGAGAGACCTGTCGG + Intergenic
957292839 3:78299124-78299146 GGTGATGTACAGAGAACTATGGG - Intergenic
960571233 3:119187311-119187333 GGTGATGGCCAGAGTCATATGGG - Intronic
960938915 3:122921039-122921061 GGAGCTGGGCAGAGGCCTGTGGG - Intronic
960993801 3:123328344-123328366 TGTGATAGACAGAGTTCTGGAGG - Intronic
961332283 3:126149693-126149715 GGTGAGGGGCAGAGTCAGGTGGG - Intronic
962502704 3:136011099-136011121 GGTGATGGAGTGAGTCCTGCAGG - Intronic
964517737 3:157531097-157531119 AGTGCTGGATAGAGTACTGTGGG + Intronic
968573619 4:1354959-1354981 GGTGAGGGACAGAGCCCTCGCGG - Intronic
968911017 4:3477026-3477048 GGGGATGGCCTGAGTCCTCTGGG + Intronic
974449152 4:62028746-62028768 GGTGGGGGACAGAGGCCTTTGGG + Intronic
979955059 4:126942460-126942482 GGTGATTGACAGAGTCTGGTGGG + Intergenic
981342085 4:143633172-143633194 GGTCATCCACAGAGTGCTGTTGG + Intronic
986124723 5:4874565-4874587 GGTGCTGCACAGAGTACGGTTGG - Intergenic
988993120 5:36690426-36690448 GGTGATGGGCAGCGTCCTAGAGG + Intergenic
989179460 5:38562116-38562138 GGGGATGGACAGAGTTCACTCGG - Intronic
989396431 5:40962122-40962144 GGTGATGGACAGAATTCTGTTGG - Exonic
991301406 5:65132562-65132584 GTTGATGGGCAGAGTCCTCCAGG - Intergenic
992551229 5:77862182-77862204 GGGGATGGAAACAGTCCGGTGGG - Intronic
995176810 5:109187599-109187621 GCTGGAGGACAGAGTCCTGAAGG - Exonic
996443268 5:123514548-123514570 GGTAATTCACAGATTCCTGTGGG + Intronic
997462088 5:134059589-134059611 GCTGATGCTCAGAGGCCTGTGGG - Intergenic
998848425 5:146333020-146333042 GGTGGTGGACAGAGCACTGGAGG - Intronic
1001098119 5:168791908-168791930 GGTGATGTTCAGAGGCCGGTGGG - Intronic
1004254035 6:14046414-14046436 CGTGATGGGCAGAGTTCAGTTGG - Intergenic
1006302545 6:33201242-33201264 CGTGATGGCCAGAGGCCTGGGGG + Exonic
1009587260 6:65623175-65623197 GTTGATGGACAATGTCCTGCTGG + Intronic
1012841876 6:104339279-104339301 GGTGATGGACAGAGGCCTGGAGG - Intergenic
1015792658 6:136979721-136979743 TGTGATGGAAAGAATCCTGGGGG - Intergenic
1018115904 6:160585142-160585164 GGTGATGGACAGAGTTATCGAGG - Exonic
1018116346 6:160589649-160589671 GGTGATGGACAGAGTTATCGAGG - Exonic
1018116783 6:160594054-160594076 GGTGATGGACAGAGTTATCGAGG - Exonic
1018122574 6:160650434-160650456 GGTGATGGACAGAGTTATCGAGG - Exonic
1019636979 7:2081226-2081248 GGTGGTGGAAAGCGGCCTGTGGG + Intronic
1024301005 7:47887650-47887672 GGTGACGGACACAGCCCTCTGGG + Intronic
1025850029 7:65237657-65237679 GGTGATGGAGAGAGCCCAGCAGG + Intergenic
1026747641 7:73025450-73025472 GGTGGTGGACGGAGAACTGTGGG + Intergenic
1026751291 7:73053589-73053611 GGTGGTGGACGGAGAACTGTGGG + Intergenic
1026754940 7:73081703-73081725 GGTGGTGGACGGAGAACTGTGGG + Intergenic
1026758592 7:73109737-73109759 GGTGGTGGACGGAGAACTGTGGG + Intergenic
1026805166 7:73424746-73424768 GGGGCTGCACAGAGTGCTGTGGG - Intergenic
1027088813 7:75283748-75283770 GGTGGTGGACGGAGAACTGTGGG - Intergenic
1027092456 7:75311676-75311698 GGTGGTGGACGGAGAACTGTGGG - Intergenic
1027096099 7:75339643-75339665 GGTGGTGGACGGAGAACTGTGGG - Intergenic
1027323242 7:77028049-77028071 GGTGGTGGACGGAGAACTGTGGG + Intergenic
1028732105 7:94162879-94162901 GGTGAAGGACAGAATCCTCATGG + Intergenic
1030199372 7:106886863-106886885 GGAGATGGACAGACTCATGTAGG - Intronic
1031137279 7:117898948-117898970 GCTGATGGTCAGTGTGCTGTTGG - Intergenic
1032415671 7:131733583-131733605 GGTGATGGGTAAAGTCCTGTTGG + Intergenic
1032665602 7:134033260-134033282 GGTGAAGAAAATAGTCCTGTAGG - Intronic
1032984984 7:137327823-137327845 GATCATGGACAGTGTCTTGTTGG + Intronic
1036445246 8:8816194-8816216 GGTGATGGACATACTCATGATGG + Intronic
1037097204 8:15000175-15000197 AGTCAAGGAGAGAGTCCTGTAGG + Intronic
1039772800 8:40704935-40704957 GGTGATGTTCAGAGTCCCATGGG + Intronic
1045997856 8:108384345-108384367 AGAGATGAACAGAGTCCTGGTGG - Intronic
1049637350 8:143696129-143696151 GTGGATGGACTGAGTCGTGTGGG + Intronic
1057817193 9:98304321-98304343 GGTGGTGGACAGGGTTCTCTGGG + Intronic
1060403403 9:123361164-123361186 GGTGAGGGACAGTGCTCTGTGGG + Intronic
1060406841 9:123377014-123377036 GGAGATGGACAGTGTCCTCAAGG + Exonic
1060529438 9:124339795-124339817 GGTGAAGGACAGGGCCCTGGTGG - Intronic
1061848772 9:133402686-133402708 CGAGATGGACAGACTCCTCTGGG + Intronic
1062324172 9:136004492-136004514 GGTGGTGGACACAGGCCTCTTGG - Intergenic
1062461554 9:136664546-136664568 GGTGCAGGACAGGGGCCTGTAGG + Intronic
1185792099 X:2934972-2934994 GGTGATGGAACGAGTCCAGCAGG - Exonic
1186413854 X:9366385-9366407 GGTGATAAGCAGAGTCCTCTAGG + Intergenic
1187104786 X:16230250-16230272 GGGGATGGACACATGCCTGTGGG - Intergenic
1192539548 X:71956629-71956651 GCTGATGGTCAGAGTGATGTCGG + Intergenic
1193397699 X:81004340-81004362 GGTGATGTAAAGAGTTTTGTTGG + Intergenic
1194773244 X:97930499-97930521 GTTGATCGCAAGAGTCCTGTTGG - Intergenic
1195803065 X:108734648-108734670 GGTGGTGGCCAGAGACCTGGAGG - Exonic
1200464126 Y:3494188-3494210 GGTGATCGGCAGATTCCTGATGG + Intergenic
1201281584 Y:12347331-12347353 GGTGATGGAACGAGTCCAGCAGG + Intergenic
1201731368 Y:17207343-17207365 GGTGATGGCCAGAGAACTGGTGG + Intergenic