ID: 1172618828

View in Genome Browser
Species Human (GRCh38)
Location 20:36306784-36306806
Sequence GGGGCCCGGAACCCCTGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 187}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172618816_1172618828 8 Left 1172618816 20:36306753-36306775 CCCGGACCCTCAAATCGGGGGCG 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1172618828 20:36306784-36306806 GGGGCCCGGAACCCCTGTCCGGG 0: 1
1: 0
2: 3
3: 17
4: 187
1172618808_1172618828 22 Left 1172618808 20:36306739-36306761 CCCATCCATGTCTCCCCGGACCC 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1172618828 20:36306784-36306806 GGGGCCCGGAACCCCTGTCCGGG 0: 1
1: 0
2: 3
3: 17
4: 187
1172618815_1172618828 9 Left 1172618815 20:36306752-36306774 CCCCGGACCCTCAAATCGGGGGC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1172618828 20:36306784-36306806 GGGGCCCGGAACCCCTGTCCGGG 0: 1
1: 0
2: 3
3: 17
4: 187
1172618810_1172618828 17 Left 1172618810 20:36306744-36306766 CCATGTCTCCCCGGACCCTCAAA 0: 1
1: 0
2: 0
3: 14
4: 187
Right 1172618828 20:36306784-36306806 GGGGCCCGGAACCCCTGTCCGGG 0: 1
1: 0
2: 3
3: 17
4: 187
1172618821_1172618828 1 Left 1172618821 20:36306760-36306782 CCTCAAATCGGGGGCGGCGGCAC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1172618828 20:36306784-36306806 GGGGCCCGGAACCCCTGTCCGGG 0: 1
1: 0
2: 3
3: 17
4: 187
1172618807_1172618828 23 Left 1172618807 20:36306738-36306760 CCCCATCCATGTCTCCCCGGACC 0: 1
1: 0
2: 1
3: 6
4: 180
Right 1172618828 20:36306784-36306806 GGGGCCCGGAACCCCTGTCCGGG 0: 1
1: 0
2: 3
3: 17
4: 187
1172618820_1172618828 2 Left 1172618820 20:36306759-36306781 CCCTCAAATCGGGGGCGGCGGCA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1172618828 20:36306784-36306806 GGGGCCCGGAACCCCTGTCCGGG 0: 1
1: 0
2: 3
3: 17
4: 187
1172618809_1172618828 21 Left 1172618809 20:36306740-36306762 CCATCCATGTCTCCCCGGACCCT 0: 1
1: 0
2: 0
3: 27
4: 271
Right 1172618828 20:36306784-36306806 GGGGCCCGGAACCCCTGTCCGGG 0: 1
1: 0
2: 3
3: 17
4: 187
1172618817_1172618828 7 Left 1172618817 20:36306754-36306776 CCGGACCCTCAAATCGGGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1172618828 20:36306784-36306806 GGGGCCCGGAACCCCTGTCCGGG 0: 1
1: 0
2: 3
3: 17
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172618828 Original CRISPR GGGGCCCGGAACCCCTGTCC GGG Intronic
900159736 1:1217863-1217885 GGGCCCCGGAAGGCCTGCCCGGG + Intronic
900607408 1:3530030-3530052 GGAGCTGGGAGCCCCTGTCCTGG - Intronic
901399432 1:9005914-9005936 GGGGCCCGGGCCCCTTCTCCAGG + Intronic
901631158 1:10648862-10648884 GGGGCTCTGAGCCCCTGTCCAGG - Intronic
901673355 1:10868505-10868527 GTGTCCCGGACCCCATGTCCAGG + Intergenic
901781697 1:11598746-11598768 GGTGCCCGGGCCCCCTGCCCTGG + Intergenic
903065266 1:20696179-20696201 GGGGACCGGAACCCGGCTCCTGG + Intronic
904768838 1:32870161-32870183 GGGCCCCGGCACCCCTGATCTGG - Intronic
905179257 1:36156336-36156358 GCGCCGCGGGACCCCTGTCCTGG + Exonic
905632585 1:39526921-39526943 GAGGCCTGGAGGCCCTGTCCTGG - Intergenic
905795764 1:40815717-40815739 AAGGTCAGGAACCCCTGTCCAGG + Intronic
912692317 1:111813599-111813621 GGGGCACGGACCCCTTGGCCCGG - Intronic
914802927 1:150974025-150974047 GCGGCCCGGAGCGCCTGCCCCGG - Intronic
916674571 1:167054705-167054727 GTGGCCTGGAGCCCCTGTCACGG - Intronic
918260277 1:182789642-182789664 CGCGCCCGGAACCGCTGGCCCGG - Intronic
920301289 1:204990675-204990697 GGAGCCTGGAGCCCCTCTCCTGG - Intronic
920387135 1:205577106-205577128 GGGGTCAGGAAGCCCTGTCCAGG - Intronic
922720067 1:227895853-227895875 GGGGCCCGGCACCCCAGGCCTGG + Intergenic
923126580 1:231039626-231039648 GGCGCCCGGAAGCGCTGTGCGGG - Intronic
923592049 1:235327996-235328018 GGGGCCCGGACCTCCAGTCCGGG - Exonic
924621270 1:245663160-245663182 GGGGCCTGGAACCTCTCTCCTGG + Intronic
1063592413 10:7407536-7407558 GGGCCCCGGAACCCCAAACCCGG + Intronic
1067269317 10:44775675-44775697 GGGGCCAGACCCCCCTGTCCTGG + Intergenic
1067668020 10:48295200-48295222 CAGGCCAGGAACCACTGTCCTGG - Intergenic
1069984826 10:72275875-72275897 GGGGGCTGGAACCCCTCCCCGGG + Exonic
1070768774 10:79070522-79070544 GGGGCCCGGACCGGCTGCCCTGG - Intronic
1074555493 10:114485254-114485276 GGGGCTCGAAGCCACTGTCCTGG - Intronic
1075653415 10:124145194-124145216 GGGGCCCAGAACACTGGTCCTGG - Intergenic
1076179936 10:128399305-128399327 GGGGCCGGGGACCCATGCCCAGG + Intergenic
1077035239 11:491276-491298 GGGGCCTGGAACCCGGGTGCTGG + Exonic
1077439668 11:2562071-2562093 GGGGTCCGGCTGCCCTGTCCTGG - Intronic
1081983391 11:47284310-47284332 TGGGCCCCCAACCCCTGCCCAGG - Intronic
1083748398 11:64747386-64747408 GGAGCCAGGAACCCCTTTCCGGG - Intronic
1084527548 11:69706115-69706137 TGACCCCGGAGCCCCTGTCCCGG - Intergenic
1084657607 11:70528406-70528428 GGGACCTGGAGCCCCTTTCCAGG - Intronic
1085307416 11:75495838-75495860 GGGGCCTAGACCCCCTGTGCTGG + Intronic
1088894075 11:114064652-114064674 GGGGCCTGGCTCCCCTGTCTTGG + Intronic
1089729628 11:120512020-120512042 GCGGCCCCGCACCCCTGCCCCGG + Intronic
1094818277 12:34206543-34206565 GCGGCCTTGAACCCCTGTTCTGG + Intergenic
1095099059 12:38162680-38162702 AGGGCCCTGACCCCCTGTTCTGG - Intergenic
1096659991 12:53118346-53118368 GGGGCCTGGATCCCCTCACCTGG - Exonic
1096660081 12:53118810-53118832 GGGCCCCAGAACCCGTGCCCAGG + Intronic
1102084458 12:110124563-110124585 GGGGCCCGATTCCCCTATCCGGG - Exonic
1102978741 12:117225262-117225284 GGGGCCAGGTGCCCCTTTCCAGG + Intronic
1103690990 12:122774457-122774479 GCGGCCCGGAAACCCTGGCGGGG + Exonic
1107605051 13:42048673-42048695 GGAGCCCGGAACCCCGTGCCCGG - Intronic
1107707462 13:43122049-43122071 GGGGCCCAGAACCCCAGGACAGG - Intergenic
1109276202 13:60306741-60306763 GGGGCCCCTAAGCCCAGTCCAGG + Intergenic
1110049904 13:70883754-70883776 GGTGCCGGAAACCCCTTTCCTGG + Intergenic
1113631943 13:111893960-111893982 GGGGCCGGGGACCCCAGCCCTGG + Intergenic
1119497320 14:75091283-75091305 GGGGCCAGCAGCTCCTGTCCTGG - Exonic
1121048521 14:90804903-90804925 GGGGACCTGAACCCCTCTCTGGG + Intronic
1121617223 14:95320744-95320766 GGGGACCGGAAGGCCTGTCCTGG - Intergenic
1121995475 14:98599097-98599119 GGAGCCTGTAACTCCTGTCCTGG + Intergenic
1122086443 14:99310011-99310033 GGGTCCCCAAACCCCTGTGCTGG - Intergenic
1122287336 14:100659576-100659598 AGGCCCCGGAATCCCTGTCTGGG - Intergenic
1122607049 14:102953686-102953708 GGGCCCCTGCTCCCCTGTCCTGG - Intronic
1122976017 14:105171073-105171095 TGGGCCCAGAGCCCCTGGCCAGG - Intergenic
1123965544 15:25453374-25453396 GGGGTCCCCAACCCCTGTCGTGG + Intergenic
1124416236 15:29475157-29475179 GGGGCCCAGAAAGGCTGTCCGGG - Intronic
1126724887 15:51622387-51622409 GGGGCAGGGACCTCCTGTCCAGG - Intronic
1127691273 15:61399727-61399749 GGGGACAAGAATCCCTGTCCTGG + Intergenic
1129319762 15:74767979-74768001 GGGGCCTGGAGCCCCTCTCTGGG - Intergenic
1131509899 15:93044165-93044187 GGGCCCAGGCACCCCTGCCCAGG + Intronic
1133326657 16:4946016-4946038 GGGGCCCTGACCTCCTGACCTGG - Intronic
1134039846 16:11060152-11060174 TGGGCCAGGAATCCCTGTGCTGG + Intronic
1136318372 16:29466916-29466938 GGGGCCTGGCACCCCCGCCCTGG + Exonic
1136366026 16:29809688-29809710 GGGGGCCGCCCCCCCTGTCCCGG + Exonic
1136432947 16:30206265-30206287 GGGGCCTGGCACCCCCGCCCTGG + Exonic
1138431980 16:56974921-56974943 GGAACAGGGAACCCCTGTCCCGG - Intronic
1139594261 16:67948901-67948923 GGGGCCCTGTACCCCTGAGCAGG - Intronic
1139957625 16:70700684-70700706 GGGGCCAGGAAGCACTGTCTGGG - Intronic
1139991528 16:70943729-70943751 ATGGCCCAGAACCTCTGTCCAGG + Intronic
1141709461 16:85689295-85689317 GCGGCCCGGAACCCCACCCCCGG - Intronic
1142246911 16:88974383-88974405 GGGGGCCGGGACCCCTTCCCTGG - Intronic
1143378921 17:6483665-6483687 GGTCCCCGGCACCCGTGTCCAGG + Exonic
1146127184 17:30238686-30238708 GAGGCCGGGAGGCCCTGTCCTGG + Intergenic
1146169292 17:30620944-30620966 GGGTCCCCAGACCCCTGTCCAGG - Intergenic
1146170270 17:30626505-30626527 GGGTCCCCAGACCCCTGTCCAGG + Intergenic
1146343725 17:32042535-32042557 GGGTCCCCAGACCCCTGTCCAGG + Intronic
1147141925 17:38465038-38465060 GGGGACCGGAGGCCCTGGCCAGG + Intronic
1147313070 17:39606447-39606469 TGGCCCCGGAGCCCCTGGCCCGG + Exonic
1151554106 17:74837905-74837927 GGAGCCCAGAGCCCCTGGCCTGG + Exonic
1151662766 17:75527415-75527437 GGACCCCGGAAACCCTGTCCAGG - Intronic
1152942110 17:83178193-83178215 GGGTCCCGGCCCCCCTGGCCTGG + Intergenic
1160190928 18:76713470-76713492 GGGGCCCACAGCCCCTGCCCAGG + Intergenic
1160903020 19:1438600-1438622 GGGGCTGGGAAGGCCTGTCCGGG + Intronic
1160973252 19:1779796-1779818 GGGGCCCCGTCCACCTGTCCCGG - Exonic
1161016277 19:1985342-1985364 GGGGCCCTGAACCCCGGGTCTGG - Intergenic
1161032166 19:2062517-2062539 GAGGCCCGGCACCCCTGCCGAGG + Intergenic
1161271933 19:3394639-3394661 GGGGTCGGGAACCCCTGCTCTGG - Intronic
1161425327 19:4199794-4199816 AGAGCCCGGAGCCCCTGTCGGGG + Intronic
1161558643 19:4958323-4958345 GGGGCCTGGTAACACTGTCCTGG + Intronic
1161896027 19:7081092-7081114 GGTCCCAGGAGCCCCTGTCCAGG - Intronic
1162405106 19:10468601-10468623 GGCGCCCAGAACCCCCATCCTGG + Exonic
1162994549 19:14325888-14325910 GGGGCTGGGAACCCATGTCATGG - Intergenic
1166372639 19:42310617-42310639 GTTGCCCCGAACCTCTGTCCTGG + Exonic
1167080269 19:47273078-47273100 GGGGCCCAGACCCTCTGTCTTGG + Intergenic
928115607 2:28543372-28543394 GTGGCCCAGAACCATTGTCCTGG - Intronic
928435426 2:31251692-31251714 GGGAGCTGGAACCCCTGGCCTGG + Intronic
930675840 2:54199452-54199474 GGGGCCCTGAACCACTGCACAGG + Intronic
930801947 2:55451973-55451995 GGGGCCCTGAGTCCCTGGCCTGG - Intergenic
933780006 2:85794883-85794905 GGGGCCCAGAACCCCAGTTCAGG + Intergenic
934714695 2:96536852-96536874 GGGCCGCCGAGCCCCTGTCCGGG - Intronic
936071948 2:109376953-109376975 GGGGTGCGGAGCACCTGTCCCGG + Intronic
936417700 2:112332378-112332400 GGGGTCGGGCTCCCCTGTCCTGG - Exonic
946225405 2:218261691-218261713 GGGGCCCTGATCCCCTGTCCTGG + Intronic
948047027 2:234952419-234952441 GGCGCCCGGAACCCCGGGCCGGG - Intronic
948891829 2:240910581-240910603 TGGGTCTGGAACCCCAGTCCTGG + Intergenic
1172109974 20:32538845-32538867 GGGGCCCGGCAGCCCTCTCCCGG + Intronic
1172127501 20:32633672-32633694 GGGCTCTGGAGCCCCTGTCCAGG - Intergenic
1172280516 20:33704501-33704523 GGGGTCCGCAACCCCGGTACCGG - Exonic
1172618828 20:36306784-36306806 GGGGCCCGGAACCCCTGTCCGGG + Intronic
1172636576 20:36414171-36414193 GGGGGCTGGGACCCCAGTCCTGG - Intronic
1175199675 20:57268363-57268385 GGGGCCCTGTACGACTGTCCAGG - Intergenic
1175953803 20:62597705-62597727 GGGGCCAGGACCACCTGCCCAGG - Intergenic
1176095757 20:63343671-63343693 GGGGCTGGGAAGCCCTGGCCAGG + Intronic
1176371846 21:6067088-6067110 GGGGCCCCGACTCCCAGTCCAGG + Intergenic
1176856580 21:13979823-13979845 GGTACCCGGAACCCGTGTACAGG + Intergenic
1178065048 21:28895464-28895486 GGGGTTCGGGACCCCTGTCCTGG - Intergenic
1178843773 21:36157439-36157461 GCGGCCCGGATCCCTTCTCCTGG - Intronic
1179481688 21:41682453-41682475 GGGGCCCAGAGCCCGTGCCCTGG - Intergenic
1179628139 21:42660057-42660079 TGGGCCCGGTAGCCCAGTCCTGG + Intronic
1179730481 21:43364705-43364727 GGGGCCCTGATCCTCTGGCCCGG + Intergenic
1179751673 21:43471451-43471473 GGGGCCCCGACTCCCAGTCCAGG - Intergenic
1180049251 21:45323902-45323924 GGGGCACGGAGACCCTGGCCAGG - Intergenic
1180149634 21:45940988-45941010 GGGCCCTGGAACCCCTGTCCCGG + Intronic
1180844475 22:18973674-18973696 GTGGCCCGGAACCTCTCACCGGG + Intergenic
1181000426 22:19985467-19985489 GGGGCCCAGAGCCCCTATGCTGG - Intronic
1181056998 22:20265037-20265059 GTGGCCCGGAACCTCTCACCGGG - Intronic
1181067272 22:20312818-20312840 GGGGCCCTGTACCCCTGCACCGG + Intergenic
1183425114 22:37735041-37735063 CGGGCCCAGACCCCCTCTCCTGG - Exonic
1184510858 22:44932390-44932412 GGGGCCCTGAACCCCCAACCTGG + Intronic
1184786775 22:46675872-46675894 GGGGCCCTGAGCCCCTGCCTCGG + Intronic
1185103946 22:48856680-48856702 GGGGACAGGCAGCCCTGTCCAGG - Intergenic
1185277434 22:49955877-49955899 GGGGCCCTGCACGCCTGCCCTGG + Intergenic
1185344657 22:50306020-50306042 GGGGCCCTCAACCCACGTCCCGG + Intronic
949388945 3:3537573-3537595 GGGCACCGGAGCCCCAGTCCTGG + Intergenic
950674331 3:14545470-14545492 GGGGCTGGGAACCCCTGACTGGG + Intergenic
950940054 3:16883947-16883969 GGGGCCCGGAACAAGGGTCCCGG - Intronic
952889127 3:38029437-38029459 AGGGCCCGGAACAGCTTTCCAGG + Intronic
954036643 3:47854456-47854478 GGGGCCAGGAGCCGCTGCCCTGG - Intronic
954107505 3:48417372-48417394 GGGGCCTGCAACCGCTGGCCAGG + Intronic
954121832 3:48504208-48504230 GGTTCCCGGAACCTCTGTCCGGG + Exonic
954137705 3:48589633-48589655 GGCGCCAGGAACCCTGGTCCAGG + Exonic
954632832 3:52056391-52056413 GGGGCCGGGCAGCCCTGCCCTGG + Exonic
955060028 3:55486213-55486235 GGGGCCGGGGAGCGCTGTCCCGG + Intronic
955387716 3:58492373-58492395 GGGCCCCGGAACCCCCGCCCAGG - Intronic
956764383 3:72472204-72472226 GGGGTTGGGAACCCCTGTCTTGG - Intergenic
967055449 3:185825467-185825489 GGCGCCCGGAGCCCCAGCCCGGG - Intergenic
968511533 4:997800-997822 GGGGGCGGGGATCCCTGTCCCGG + Intronic
968688478 4:1977106-1977128 GGGGCCCAGAGCCCCTGTCCTGG + Intronic
968736145 4:2297469-2297491 GAGGCCAGGACCCACTGTCCGGG + Intronic
968963340 4:3756758-3756780 GGGGCCAGGAAGTCCTGCCCAGG + Intergenic
969427844 4:7136239-7136261 GGGGCCCTGAATACATGTCCAGG + Intergenic
969514427 4:7638579-7638601 GGGACCCGGAACCCCTGGGCTGG + Intronic
969639298 4:8387448-8387470 GGGGTCCCGACGCCCTGTCCCGG - Intronic
969788413 4:9475126-9475148 GGCGCCCGGACCCCCTGCCATGG - Intergenic
978514896 4:109559740-109559762 GGGGCCCGGCACCGCAGCCCGGG + Intergenic
985073576 4:186191547-186191569 GGGGCCCGGAAACCGTTTTCCGG + Exonic
985748515 5:1661385-1661407 AGGGCCCGGAGCCCCTCTCAAGG - Intergenic
985779564 5:1863121-1863143 GGAGCCCAGAACCCCGTTCCCGG + Intergenic
991186635 5:63816013-63816035 GGGGCCTGTAACCTCTGTTCTGG + Intergenic
992609283 5:78493317-78493339 GGGCCCAGGAACTCCTGCCCAGG - Intronic
997365308 5:133321685-133321707 GGGGCCCGGATCCCATTGCCAGG + Intronic
998204585 5:140149587-140149609 GGGGCCCTGTACCCCTGTTCAGG - Intergenic
1000398114 5:160797126-160797148 GGGCCCAGGAACCCCTGGCTGGG + Intronic
1001081526 5:168671204-168671226 GAGGCCCGGGACCCCTGCCTCGG - Exonic
1001677128 5:173528247-173528269 TGGGCCTGGGGCCCCTGTCCTGG - Intergenic
1002018529 5:176346385-176346407 AGGGCCTGGAACGCCTGTGCGGG - Exonic
1004923847 6:20401488-20401510 GGGGCGCGGAGTCCCTGCCCAGG + Intergenic
1005710178 6:28496745-28496767 GGGGCATGGAATCCCTATCCAGG + Intergenic
1006911552 6:37566564-37566586 GGGGCCTGGAAGCCCAGCCCTGG + Intergenic
1018172322 6:161152562-161152584 GGGGCCCCGAACTCCTCCCCAGG - Intronic
1019472605 7:1229580-1229602 GGGGCCCGGAGTCCGGGTCCGGG - Intergenic
1019689709 7:2403746-2403768 GCGGCCCGGGACCCCCGCCCGGG - Intronic
1019941910 7:4298450-4298472 GGGGCCCTGGACCCCAATCCAGG - Intergenic
1022565970 7:31402287-31402309 GGGGTCCCCAACCCCTGTACTGG + Intergenic
1025806538 7:64838631-64838653 GGGCCCCCAAACCCCTATCCAGG - Intergenic
1026830471 7:73607233-73607255 GGGGTCAGGATCCCCTTTCCAGG + Intronic
1026856375 7:73757819-73757841 GGGGACCAGAAACCCTCTCCAGG + Intergenic
1034227905 7:149497411-149497433 GGACCCCGGAACCCCTCCCCAGG + Intronic
1034440275 7:151082617-151082639 GAGGCCCGGGCCCCCTGGCCAGG + Intronic
1034734067 7:153412625-153412647 GGGCCCCCAAACCCCTATCCAGG - Intergenic
1035646265 8:1223194-1223216 GGTGCCCAGCAACCCTGTCCAGG + Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1041535759 8:58923776-58923798 GGGACCCGGAACCCAGGTCCTGG - Intronic
1041840599 8:62266148-62266170 GGAGCCCTGGACCCCTCTCCTGG + Intronic
1047186312 8:122636547-122636569 GGGGCCATGAATCCATGTCCAGG + Intergenic
1048339763 8:133529543-133529565 GGGGCCCGGAGCCCCTCCTCTGG - Intronic
1049083002 8:140457492-140457514 GGAGCCCGCCACACCTGTCCGGG - Intronic
1049995387 9:1029315-1029337 GCTGCCGGGAACCACTGTCCAGG + Intergenic
1053129468 9:35606871-35606893 GCTCCCCTGAACCCCTGTCCTGG + Exonic
1056182876 9:84102514-84102536 GGGGACTGGCACCGCTGTCCAGG - Intergenic
1060792933 9:126498004-126498026 GGGGCCCTGAAGGCCTCTCCCGG + Intronic
1062380520 9:136284635-136284657 GTGGGCCGGGATCCCTGTCCAGG - Intronic
1062405282 9:136393271-136393293 GGGACCCGGGACCCCTGGCATGG + Intronic
1062414703 9:136442404-136442426 GGGGCCCAGCACTCCTGCCCTGG - Intronic
1062454617 9:136629669-136629691 GGGGCTGGGAAGCCCTGACCGGG - Intergenic
1062696602 9:137878915-137878937 TGGGTCCGGAGCCCCTCTCCTGG - Intronic
1188840752 X:35014132-35014154 GGGGCAGGGAACCCCTCTCAGGG - Intergenic
1189666258 X:43357917-43357939 GGGGCCCTGAACCCCTCTTTTGG + Intergenic
1192452820 X:71254116-71254138 AGGGGCCGCGACCCCTGTCCCGG - Exonic
1196770423 X:119288012-119288034 GGGGCCAGGAACCCCACTTCGGG + Intergenic
1199169345 X:144717869-144717891 TGGGCCATGAACCCCAGTCCTGG - Intergenic
1199408106 X:147486003-147486025 GGAGCTCGGAAACCCTGTGCAGG + Intergenic
1201770150 Y:17611225-17611247 GGGCCCCCAAACCCCTATCCAGG + Intergenic
1201831404 Y:18294762-18294784 GGGCCCCCAAACCCCTATCCAGG - Intergenic